ID: 1139441565

View in Genome Browser
Species Human (GRCh38)
Location 16:66970525-66970547
Sequence ATCTGACAGCTGAGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139441565_1139441574 17 Left 1139441565 16:66970525-66970547 CCCTAGAGCCTCAGCTGTCAGAT 0: 1
1: 1
2: 1
3: 6
4: 176
Right 1139441574 16:66970565-66970587 TGGGGCCAAATCCCAGCCCTGGG 0: 1
1: 0
2: 4
3: 24
4: 250
1139441565_1139441573 16 Left 1139441565 16:66970525-66970547 CCCTAGAGCCTCAGCTGTCAGAT 0: 1
1: 1
2: 1
3: 6
4: 176
Right 1139441573 16:66970564-66970586 CTGGGGCCAAATCCCAGCCCTGG 0: 1
1: 0
2: 8
3: 65
4: 469
1139441565_1139441571 -1 Left 1139441565 16:66970525-66970547 CCCTAGAGCCTCAGCTGTCAGAT 0: 1
1: 1
2: 1
3: 6
4: 176
Right 1139441571 16:66970547-66970569 TGTGGAGCTAGATAGACCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 158
1139441565_1139441570 -2 Left 1139441565 16:66970525-66970547 CCCTAGAGCCTCAGCTGTCAGAT 0: 1
1: 1
2: 1
3: 6
4: 176
Right 1139441570 16:66970546-66970568 ATGTGGAGCTAGATAGACCTGGG 0: 1
1: 0
2: 2
3: 29
4: 207
1139441565_1139441569 -3 Left 1139441565 16:66970525-66970547 CCCTAGAGCCTCAGCTGTCAGAT 0: 1
1: 1
2: 1
3: 6
4: 176
Right 1139441569 16:66970545-66970567 GATGTGGAGCTAGATAGACCTGG 0: 1
1: 0
2: 2
3: 26
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139441565 Original CRISPR ATCTGACAGCTGAGGCTCTA GGG (reversed) Intronic
901868639 1:12124437-12124459 ATGAGACAACTGAGGCTCAAAGG - Intronic
902943325 1:19815888-19815910 ATACAACAGCTGTGGCTCTAAGG - Intergenic
904001080 1:27339157-27339179 AGCCCACAGCTAAGGCTCTACGG + Intergenic
905006464 1:34714002-34714024 ATCTGAGAGCTGGGGAGCTATGG - Intronic
906491657 1:46273445-46273467 ACCTGACAGCTGGGGCTCCAGGG - Exonic
906928495 1:50144967-50144989 ATTTGACACCTGAGGCTCCATGG - Exonic
912699690 1:111867945-111867967 ATCTGACCAATGAGGCTCTGTGG - Intronic
914449175 1:147775493-147775515 ATCTCCCAGCTGAGACTTTATGG - Intergenic
914976254 1:152366030-152366052 ATCTGCTACCTGAGGCTCCAGGG + Intergenic
915433299 1:155883727-155883749 GTCGGAAAGCTGAGTCTCTATGG + Exonic
917222516 1:172747192-172747214 ATCTGACAGCAGTGGCTGTCAGG - Intergenic
917724757 1:177817891-177817913 ATTTGACAGCTGAGGGTCTATGG - Intergenic
919284985 1:195545801-195545823 ATTTCACAGCTGAGGCTATGGGG + Intergenic
919609296 1:199725467-199725489 ATGTGACAGCTGAGGCTAAAAGG + Intergenic
919823915 1:201490413-201490435 TTCTTACAGCTGAAGCTCTCTGG + Intronic
923825350 1:237493892-237493914 ATGTGCCAGCTGTGGCGCTAAGG + Intronic
1063116975 10:3078698-3078720 ATGAGAAAGCTGAGGCTCTTAGG - Intronic
1063869981 10:10406397-10406419 ATCTGTGATCTGAGGCTCAATGG + Intergenic
1064299965 10:14114648-14114670 ATCTGATAGCTGGGGTTTTAGGG - Intronic
1065456858 10:25916067-25916089 ATCTGACATCTGAGTCTTTCTGG - Intergenic
1065561367 10:26967408-26967430 ATGTGACAGCTCAGCCTTTAAGG - Intergenic
1066641556 10:37559195-37559217 ATCAAAAAGCTGAGGCTGTATGG - Intergenic
1069080813 10:64086434-64086456 ATCTGACACCTAAGTCTCAAGGG - Intergenic
1069667623 10:70174075-70174097 GGCTGACAGCAGAGGCCCTAAGG + Intergenic
1070314532 10:75297184-75297206 ATCTGAGAGCTGAGTCTTGAAGG - Intergenic
1072438037 10:95431229-95431251 ATCTGAGAGCTGCTGCTGTAGGG - Intronic
1072571185 10:96658638-96658660 ATCTGACTGCTGAATGTCTATGG + Intronic
1074007740 10:109445510-109445532 ACCTGTCTGCTGAGGCTCCAAGG + Intergenic
1074497565 10:113993092-113993114 AGTTGACCTCTGAGGCTCTATGG + Intergenic
1074597603 10:114881704-114881726 ATCTCCCTGCTGAGGCTCTGCGG - Intronic
1075057562 10:119230915-119230937 ATCTGGCAGCAGAAGCTGTAGGG + Intronic
1075063423 10:119272799-119272821 ATCTGACAGGTCAGGCCTTAAGG - Intronic
1075087132 10:119421295-119421317 TTCTGGCAGCTGAGTCTCTTGGG - Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075670746 10:124262663-124262685 ATCTGCCAGCTGAGGGGCTTTGG - Intergenic
1076112730 10:127873262-127873284 ATCTGATAGATGAGCCACTAAGG - Intergenic
1077010823 11:378564-378586 GTGTGACAGCTGAGGGTCCAAGG - Intronic
1077992490 11:7424361-7424383 CTCTGTCATCTGAGGCCCTATGG - Intronic
1079246003 11:18752786-18752808 AGCTGACAGCAGAGGCCCTGCGG + Intronic
1082109415 11:48257612-48257634 ACTAGACAGCTGAGGCTTTAAGG - Intergenic
1083443927 11:62694658-62694680 CTCTGGCAGCTCAAGCTCTAAGG + Exonic
1084320477 11:68370626-68370648 CCCTGACGGCTGAGTCTCTAGGG - Intronic
1085157227 11:74306884-74306906 GTCTGTGAGCTGAAGCTCTAGGG + Intronic
1085381644 11:76125086-76125108 ATCTGGCAGATGACCCTCTAGGG + Intronic
1087729140 11:101758718-101758740 ATCTGGCAGCAGAAGCTCTTGGG + Intronic
1089788061 11:120922225-120922247 ATCAGAAAACTGAGGCTCTGAGG + Intronic
1090145728 11:124320306-124320328 ATGGGACAGATGAGGCTCTCAGG - Intergenic
1091091480 11:132775523-132775545 ATCTGACACCTGAGCCTCCCTGG + Intronic
1095521831 12:43075847-43075869 ATTTGACACCAGAGGCTGTATGG + Intergenic
1096949052 12:55445509-55445531 ATCTGACAACACAGTCTCTAGGG - Intergenic
1099580944 12:84446306-84446328 ATTTTACAGCTGAGCCTCTGGGG + Intergenic
1101673388 12:106896871-106896893 CTCTGACAGTTGATGCACTAAGG + Intergenic
1101715937 12:107312109-107312131 ACCTCACAGCTGAGCCTCTGAGG + Intergenic
1104048085 12:125177522-125177544 ATGAGAAAACTGAGGCTCTAGGG - Intergenic
1104455172 12:128905078-128905100 ACCTGACAGCTGAGTGTTTAGGG - Intronic
1104913062 12:132249385-132249407 TTCTGACTGCTGAGTCTCTGGGG - Intronic
1108633451 13:52309695-52309717 ATTTTACAGCTGGGGCTCCAGGG + Intergenic
1110247137 13:73339608-73339630 ATTTGGAAACTGAGGCTCTAGGG + Intergenic
1110278613 13:73666599-73666621 AGCTGAGAGCTGCAGCTCTAGGG + Intergenic
1110534961 13:76640207-76640229 ATTTTACAGATGAGGCACTAAGG - Intergenic
1111283598 13:86060675-86060697 AGCTGACAACTGTGGCCCTATGG - Intergenic
1111855183 13:93628207-93628229 GTCTGCAAGCTGAGGCTCTGAGG - Intronic
1116904242 14:50389764-50389786 ATCTCACAGCTAAGGCCCTGCGG + Intronic
1117423394 14:55570883-55570905 ATCTGACAGTTGAGGCTTCCAGG - Intronic
1118633665 14:67728136-67728158 CTCTGACATCTGCGGATCTAGGG + Intronic
1119553994 14:75539673-75539695 GTCTTAGAGCTGAAGCTCTAGGG - Intronic
1119661378 14:76454506-76454528 ATGTGAGAGCTGTGGCTCCAAGG + Intronic
1119950898 14:78744088-78744110 ATCTGCCAGCTGAGTCACTTTGG - Intronic
1122575377 14:102738596-102738618 ATCTCATAGGTGAGGCTCCAAGG - Intergenic
1128749450 15:70138619-70138641 ATCTGAGAACTGCTGCTCTAGGG + Intergenic
1133331408 16:4976905-4976927 AGCCGGCAGCTGAGGCTCTTAGG + Intronic
1134241297 16:12508934-12508956 ATTTCACAGATGAGGCTCAAAGG - Intronic
1136670766 16:31854962-31854984 ATGTGTCACCTAAGGCTCTAGGG + Intergenic
1137649376 16:50106566-50106588 AGGTGACAGCTGGGGCTCGAGGG + Intergenic
1139441565 16:66970525-66970547 ATCTGACAGCTGAGGCTCTAGGG - Intronic
1139629801 16:68223246-68223268 ATCTGACAGGTCAGGCACAATGG + Intronic
1140689517 16:77468170-77468192 ATCACAGAGCTTAGGCTCTATGG - Intergenic
1143320895 17:6068400-6068422 ATTTGACAGATGAGGCTTTCAGG - Intronic
1143583081 17:7837548-7837570 ATCTGACAGCCCAAGCTCTAAGG - Intergenic
1146267290 17:31461150-31461172 ATCAGACAGGTGGGGCTATAAGG - Intronic
1149434367 17:56620581-56620603 ATTTTACAGATGAGGATCTAAGG + Intergenic
1150290671 17:63979673-63979695 ATGTGGCAGCTGAGGGTCTGGGG + Intergenic
1150323281 17:64234554-64234576 AGCTGACAGCTGAGGCTAACTGG + Intronic
1152163801 17:78687584-78687606 TTCTGAAAGCTGAGGCGCTGGGG + Intronic
1154390572 18:13933033-13933055 GTCTGAGAGCTGCTGCTCTAGGG - Intergenic
1155172036 18:23274255-23274277 ATGGGAGAGCTGAGGCTCAATGG + Intronic
1157130430 18:45002209-45002231 ATCTGAAAGCTGGGGTTCTAGGG - Intronic
1157911712 18:51622907-51622929 CTCTGACAGCTGCGGATCTCTGG + Intergenic
1158844758 18:61430010-61430032 TCCTGACAGCACAGGCTCTATGG + Intronic
1164025534 19:21348402-21348424 ATTTTACAGCTGAGCCTCTGGGG + Intergenic
1164381679 19:27741402-27741424 ATCTGACATCTGAAAGTCTAAGG - Intergenic
1165309704 19:35022753-35022775 AGCTGAGAGCTGAGGCTCAGAGG - Intronic
1167041627 19:47026248-47026270 ATCTTTGAGCTGAGGCTCCAAGG + Intronic
925456040 2:4017476-4017498 ATTTTACAGCTGGGCCTCTAGGG + Intergenic
926337151 2:11872384-11872406 TTCTGACCGCTGAGGCTGAAAGG + Intergenic
926929320 2:18021554-18021576 ATCTGACACCTGTGTGTCTAGGG + Intronic
927090092 2:19704033-19704055 AACTGACAGCTGGAGCCCTATGG - Intergenic
927955061 2:27202162-27202184 ATCTGACAAGTGGGGCTCCAAGG - Intronic
929766023 2:44844571-44844593 ATCAGGAAGCTGAGGCTCCAGGG + Intergenic
931430806 2:62207618-62207640 ATCTGACGCCTGATGATCTAGGG - Intronic
932748667 2:74356705-74356727 AGCTGAAAGCTGGGGCACTAAGG + Intronic
933719595 2:85389573-85389595 ATCTTACAGATGAGGAACTAAGG - Intronic
933950854 2:87328100-87328122 ATGTGGAAACTGAGGCTCTATGG - Intergenic
936328921 2:111530478-111530500 ATGTGGAAACTGAGGCTCTATGG + Intergenic
937245097 2:120487359-120487381 ATCTGGGAGCTGAAGCTGTAGGG - Intergenic
937246587 2:120497746-120497768 CTCTGACAGCTGGGACTCCATGG + Intergenic
937887766 2:126911685-126911707 TTCTGAGAGCTGGGGCCCTATGG - Intergenic
938979362 2:136511062-136511084 GTCTGACAGCTCAGTGTCTATGG + Intergenic
939751766 2:146056504-146056526 ATCTGTCAGATGAGGGTCTTAGG + Intergenic
939815697 2:146894351-146894373 ATATGACAGCTGTGTCTCTTAGG + Intergenic
944204611 2:197144389-197144411 GTCTGGCAGCTGAGCCTTTAGGG - Intronic
944539100 2:200739902-200739924 AACTGACAGATGAGGATCCAGGG + Intergenic
946502050 2:220259859-220259881 AGCTGTCAGCTGAGGGCCTAGGG + Intergenic
946516445 2:220416878-220416900 CTCTGACAGGTGTGGCTCAAAGG - Intergenic
947163135 2:227234678-227234700 ATCTAACTGCAGAGGCTCAATGG + Intronic
948736466 2:240010197-240010219 ATCTGACAGCTCAAGCCGTATGG - Intronic
1174508228 20:51030900-51030922 GGATGACAGCTGAGGCTCCAAGG - Intergenic
1175507900 20:59499192-59499214 ATCTGAAAGCGGAGGCTACAAGG + Intergenic
1177081767 21:16648323-16648345 ATCTCACAGCTAAGTCTCAAAGG + Intergenic
1181325232 22:22039806-22039828 GTCTGGCAGTTGAGGCTCTTTGG - Intergenic
1181991363 22:26839390-26839412 AGCTGACAGCTGAGGGTCATAGG - Intergenic
951663528 3:25096766-25096788 ATCTGTCAGTTGAGGCTCCTGGG + Intergenic
952856048 3:37771644-37771666 ATCTGTCAGCTGAGGCCACAAGG + Intronic
953283611 3:41582530-41582552 AGCTGGCAGCATAGGCTCTATGG - Intronic
955546149 3:60032735-60032757 ATTAGACAGCTGCGGGTCTATGG - Intronic
956382330 3:68678041-68678063 ATCAGAAAACTGAGGCTGTAAGG - Intergenic
959979345 3:112497794-112497816 ATCTGGCCACTGAGGTTCTATGG - Intronic
961828486 3:129611388-129611410 ACATGGGAGCTGAGGCTCTAGGG - Intergenic
962997786 3:140648712-140648734 ATATGGCAGCTCAGGCTCTCAGG - Intergenic
963320821 3:143807439-143807461 ATATGAAAACTGAGGCACTAAGG + Intronic
963921858 3:150913345-150913367 TCCTGGCAGCTGTGGCTCTAAGG + Intronic
964629800 3:158798201-158798223 AGCTGGCTGCTGATGCTCTATGG - Intronic
966586286 3:181629237-181629259 ATCAGACATTTGAGGCTCAAGGG - Intergenic
967101170 3:186216878-186216900 ATCTGAGAGCTGAGAGGCTAGGG + Intronic
968428145 4:536443-536465 AGCAGAAAGCTGAGGCTCTGCGG + Intronic
969238577 4:5885302-5885324 ATGAGACAGCTGAGGCTCAGAGG + Intronic
970424696 4:15935254-15935276 CTCTGACAGCTGAGTCTACAGGG - Intergenic
972419315 4:38871548-38871570 ATCTTACAGCTGAGTTTCTGGGG + Intronic
980841969 4:138274197-138274219 GTCTGACAGCTGAAGATCAAGGG - Intergenic
981117715 4:141011425-141011447 TTCTGACAGCTGTGTTTCTAAGG - Intronic
984183009 4:176508328-176508350 ACCTGACAGCTGAGACATTAGGG - Intergenic
984548753 4:181136152-181136174 ATCTTCCACCTGAGGCTCTCAGG - Intergenic
988721204 5:33881057-33881079 GTCTACCAGCTGAGACTCTAGGG + Intronic
992564149 5:77981461-77981483 ATCTGATACCTGATGATCTAAGG - Intergenic
995139605 5:108720656-108720678 ATGTGCCATCTAAGGCTCTAAGG + Intergenic
996748791 5:126868714-126868736 ACCTGACAGCTCAGGGACTAAGG + Exonic
998202352 5:140135205-140135227 ATCTCAGAGATGAGGCTCTGGGG + Intergenic
1001972085 5:175964710-175964732 ATTTGACAGATGAGGATCTGAGG - Intronic
1002245355 5:177879067-177879089 ATTTGACAGATGAGGATCTGAGG + Intergenic
1002575789 5:180172933-180172955 GTCTGCCAGCTGAGGCCCTGAGG + Intronic
1002932618 6:1644793-1644815 CTCTGACAGCTTTGGCTCTCAGG + Intronic
1006740529 6:36305025-36305047 AGCTTACAGCTGAGCCTCAATGG + Intronic
1008385307 6:50882554-50882576 ATCCTACAGAAGAGGCTCTAAGG - Intergenic
1010397055 6:75404681-75404703 ATGAGAAAGCTGAGGCTTTAGGG + Intronic
1013522618 6:110946902-110946924 ATTTGGCAGCTGTGGGTCTAGGG - Intergenic
1015920168 6:138258389-138258411 ATGGGAAAGCTGAGGCTCTGGGG + Intronic
1016996779 6:149966514-149966536 AGCTCACACCTGAGGCTTTAAGG - Intronic
1017120105 6:151016240-151016262 ATTTGACAGCTGACGCTTTCAGG + Intronic
1019702898 7:2482644-2482666 ATGTGGCAACTGAGGCTCAAAGG + Intergenic
1019707464 7:2503339-2503361 ATGTGTCAGCTGAGGGTCTCTGG - Intergenic
1022529347 7:31057405-31057427 ATCTCACTGGTGAGGCTCTGAGG - Intronic
1023959180 7:44912515-44912537 TTCTAACAGCTGGGGCTCTCAGG + Intergenic
1030123538 7:106133731-106133753 AGCTGGCAGCCGAGGGTCTATGG + Intergenic
1033466502 7:141595028-141595050 ATTAGCCAGCTGAGGCTATAAGG - Intronic
1034203515 7:149296666-149296688 ATCTGACAGCTGAGGATCTAGGG - Intronic
1037276760 8:17188684-17188706 ATCTGAGAGCTGCGGCACTGGGG - Intronic
1037368125 8:18144567-18144589 ATCTGACTGCTGAGCTTCTAAGG - Intergenic
1040694315 8:49977950-49977972 ATATGAAAACTGAGGCTCCAAGG - Intronic
1042294071 8:67201366-67201388 TGCTGACAGCTGAGGCTTTGGGG - Intronic
1042909667 8:73813575-73813597 ATCTGGCAGGTTAGGCCCTAAGG - Intronic
1043925099 8:86027773-86027795 ATTTCACAGATGAGGCTTTAAGG + Intronic
1048087999 8:131205023-131205045 ATCTCACAGATGAGGCTCAGAGG + Intergenic
1048774207 8:137927273-137927295 ATCTGGTATCTGAGGCTATATGG - Intergenic
1049005692 8:139854308-139854330 GTCTGTGAGCTGAGGCTCCAGGG - Intronic
1049293008 8:141813801-141813823 ATCTCACAGATGAGGGTCTTGGG - Intergenic
1051372322 9:16369176-16369198 ATCTGACAGCAGAGGCGCATAGG - Intergenic
1052857673 9:33417234-33417256 AGCTGACAGCTGTGGCTTCAAGG + Intergenic
1053303765 9:36969669-36969691 CTCTGCCAGCTGAGCCTGTAAGG + Intronic
1056082767 9:83114014-83114036 ATTTTACAGCTGGGTCTCTAGGG - Intergenic
1056654314 9:88496658-88496680 ATCTGACATCTGTGGTTCTGTGG + Intergenic
1057897861 9:98924242-98924264 ATCTGACAGCTGAGTGTCCTTGG - Intergenic
1061034615 9:128106731-128106753 ATCTGCCTGCTGAGCCTCTGGGG - Intronic
1189003314 X:36968476-36968498 ATCTGACAGCAGAGCCACTTAGG - Intergenic
1197614617 X:128677375-128677397 ATCTGAAAACTGAGGCTCAGAGG - Intergenic
1198991411 X:142519040-142519062 ATTTGACAGCTGAGGAACTTGGG - Intergenic