ID: 1139446172

View in Genome Browser
Species Human (GRCh38)
Location 16:67000171-67000193
Sequence GAGTGTGGCCGAGGAGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139446172 Original CRISPR GAGTGTGGCCGAGGAGTAGG AGG Intronic
900208263 1:1440675-1440697 GCGTGACGCCGAGGACTAGGCGG - Exonic
901242949 1:7705251-7705273 GCGTTTGGCCGAGGAGTGGGTGG + Intronic
901908376 1:12433964-12433986 GTGTGTGGAGGAGGAGGAGGAGG + Intronic
902990693 1:20185560-20185582 CAGTGTGGCCCCGGAGTGGGAGG + Intergenic
904400457 1:30253481-30253503 GAGTGTGGTCAAGGAGAAGAAGG + Intergenic
904873223 1:33634844-33634866 GTGAGTGGCCAAGGAGCAGGAGG - Intronic
904880100 1:33690017-33690039 GAGTGTGGCTGGGGACGAGGAGG - Intronic
905222688 1:36459741-36459763 GAGGGTGGAAGAGGAGGAGGAGG + Intronic
905468228 1:38172032-38172054 GAGTGTGTCCCAGGAGCAGGTGG - Intergenic
905956558 1:42002217-42002239 GTGGGTGGCAGAGGAGGAGGAGG - Intronic
906952767 1:50348212-50348234 GGGTGTGGTAGAGGAATAGGTGG - Intergenic
907325115 1:53632782-53632804 GAGTGTGACTGAGGAGAAAGGGG + Intronic
909587080 1:77302035-77302057 GAGTGTGGTCCAGGAGTTCGAGG - Intronic
910213499 1:84817917-84817939 GAGAGTGAAGGAGGAGTAGGAGG - Intronic
915472892 1:156136370-156136392 GCGCGTGGCCGTGGAGGAGGTGG + Exonic
916754192 1:167753098-167753120 GAGTGTGGCAGAAGAAAAGGTGG + Intronic
918034236 1:180851352-180851374 GGGTGTGGTGGAGGAGTAGAGGG + Intronic
920658059 1:207891044-207891066 GAGTCTGGATGAGGAGGAGGGGG + Intronic
920688862 1:208130695-208130717 GAGAGTGGCCGGGGAGGAGTAGG - Intronic
921158902 1:212459013-212459035 GGGTGTGGCTGAGGGGGAGGAGG + Intergenic
921367025 1:214383706-214383728 GAGTGAGGAGGAGGAGGAGGAGG - Exonic
923542681 1:234899867-234899889 GATTGAGGCCAAGGAGAAGGCGG - Intergenic
924177359 1:241405723-241405745 CAGTGTGGCTGATGAGAAGGGGG + Intergenic
924308182 1:242713397-242713419 GAAGGTGGCCCAGGAGAAGGAGG + Intergenic
1063455352 10:6178797-6178819 GATTGGGGCCGAGGGGCAGGTGG - Intronic
1067148511 10:43710837-43710859 CAGTGTGGACCAGGGGTAGGTGG + Intergenic
1067747462 10:48946890-48946912 GATGATGGCCGAGGAGTAGTGGG - Exonic
1071235049 10:83635602-83635624 GAGTTTGGCCTAAGAGTAGGTGG - Intergenic
1071496728 10:86172928-86172950 GAGGGTGGGTGAGGTGTAGGTGG - Intronic
1072407507 10:95168768-95168790 GAGTGGGGCAGGGGAGCAGGAGG + Intergenic
1075697464 10:124447540-124447562 GACATTGGCCGCGGAGTAGGAGG + Exonic
1075729082 10:124625690-124625712 GAGGGTGGCTGAGAAGCAGGAGG - Intronic
1076165882 10:128282186-128282208 GCGTGTGGCCCAGGAGCAGCAGG - Intergenic
1076208843 10:128624839-128624861 AAGTGTGGGCGAGGGGAAGGAGG - Intergenic
1076358892 10:129872967-129872989 GAGTGGGGGCAAGGAGGAGGGGG - Intronic
1076989895 11:267445-267467 GAGGGGGGGCGAGGAGGAGGGGG + Intergenic
1077189831 11:1251285-1251307 GGGTGTGGCCGTGGAATTGGTGG - Exonic
1077908857 11:6557380-6557402 GAGTGAGGAGGAGGAGGAGGAGG + Exonic
1077961674 11:7082222-7082244 GAGTGTGGTATAGGAATAGGAGG + Intergenic
1081755420 11:45540895-45540917 GAGTTTGGCCCAGAAGTGGGGGG - Intergenic
1083573400 11:63771967-63771989 GAGTGAGGAGGAGGAGAAGGAGG + Intergenic
1084433453 11:69123995-69124017 GAATGTGGCTGAGGAGCTGGAGG + Intergenic
1084471763 11:69365755-69365777 GAGTGGGGAGGAGGAGGAGGCGG + Intronic
1087193808 11:95284656-95284678 GAGTGAGGACGAGGAGAAGAAGG + Intergenic
1088121798 11:106378838-106378860 GAGTGAGGGTGAGGAGGAGGAGG - Intergenic
1088595528 11:111437727-111437749 GAGTGTCGCCTAGGAGTGGAGGG - Intronic
1089523169 11:119079144-119079166 GAGTGTGGCTGTGGAGTTGTGGG - Exonic
1090064123 11:123488718-123488740 GAGTGTGACAGTGGAGGAGGAGG - Intergenic
1092242102 12:6841397-6841419 GAGCGTGGCCCAGGGGGAGGGGG + Intronic
1094203478 12:27816580-27816602 GAGTGTGGAGGAGGAGGTGGTGG + Intergenic
1095367489 12:41425343-41425365 AAGTATAGCCAAGGAGTAGGAGG + Intronic
1095392052 12:41719287-41719309 GTGTGTGGCGGGGGAGGAGGGGG - Intergenic
1096734545 12:53642360-53642382 AAGTGTGACCCAGGAGGAGGTGG + Intronic
1097074591 12:56383583-56383605 GAGGGTGGCCTTGGAGGAGGTGG - Intergenic
1098749536 12:74277131-74277153 GTGTGTGACCCAGGAGGAGGTGG + Intergenic
1101735815 12:107461979-107462001 GAGGGTGGCCCAGGAGGAGGTGG + Intronic
1102461440 12:113102121-113102143 GTGTGTGGCCTAGAAGTAGTAGG - Intronic
1105881370 13:24609088-24609110 GAATGGGGCAGAGTAGTAGGCGG + Intergenic
1106979201 13:35256791-35256813 GAGTGGGTGCCAGGAGTAGGGGG + Intronic
1107840240 13:44450253-44450275 GAGTGTGGCTATGGAATAGGAGG + Intronic
1108596191 13:51951688-51951710 GAGTGGGGATGAGGAGGAGGAGG + Intronic
1109784071 13:67151840-67151862 GAGTGTGGCCTAGAATTGGGTGG - Intronic
1110884536 13:80616869-80616891 GGGTATGGCCGAGGAGAAGGAGG + Intergenic
1113866198 13:113526977-113526999 GTGTGTGGTCCAGGAGCAGGAGG + Intronic
1113909922 13:113836844-113836866 GAGTGGGGGGGAGGAGGAGGGGG + Intronic
1114554119 14:23551695-23551717 GAGTGAGGGCGAGGAGGAGGAGG - Intronic
1114653368 14:24300634-24300656 GAGTGCTGCAGAGGAGGAGGAGG + Exonic
1115161631 14:30402957-30402979 GAGTGTTACTGGGGAGTAGGAGG + Intergenic
1117309670 14:54509422-54509444 GAGGGTGGAGGAGGAGGAGGAGG - Intergenic
1118733915 14:68688965-68688987 GAGCATGGCTGAGGAGGAGGGGG + Intronic
1119440368 14:74624153-74624175 GAGGGAGGCCGAAGAGCAGGTGG - Intergenic
1122264153 14:100538937-100538959 CAGCGCGGCCGAGGAGGAGGAGG - Exonic
1122406615 14:101504712-101504734 GAGTGCGGCCGCGGGGGAGGAGG + Intergenic
1122543290 14:102509468-102509490 GCGTGTGCCGGAGGAGGAGGGGG + Intronic
1123013319 14:105360023-105360045 GTCTGTGGCCTAGGAGCAGGAGG + Intronic
1124642073 15:31402039-31402061 GAGCGTGCCCGAGGAGAAGTGGG + Intronic
1125139479 15:36387480-36387502 GAGTGAGGATGAGGAGCAGGAGG + Intergenic
1125532875 15:40425028-40425050 GAGTGGGTCAGAGGAGTACGGGG - Intronic
1129005164 15:72366748-72366770 GAGGGTGGTTGAGGAGGAGGAGG - Intronic
1129254206 15:74324964-74324986 TAGTGTGGAGGAGGAGGAGGTGG - Intronic
1129333847 15:74840987-74841009 GGGTGTGGTGGGGGAGTAGGAGG - Intronic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1131827291 15:96331600-96331622 GTGTGCAGCCGAGGAGTTGGCGG - Exonic
1132338933 15:101065962-101065984 GGGTGGGGATGAGGAGTAGGAGG - Exonic
1132387828 15:101413002-101413024 GAGTGAGGAGGAGGAGGAGGAGG + Intronic
1132697206 16:1207324-1207346 GAGGGCGGCCCAGGAGGAGGTGG - Exonic
1133014738 16:2934120-2934142 CAGGGGGGCCAAGGAGTAGGAGG - Intronic
1136143088 16:28299629-28299651 GAGTGGGGCTGAGGAGGGGGTGG - Intronic
1136712795 16:32253765-32253787 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136755121 16:32675664-32675686 GGGTGGGGCTGAGGAGGAGGCGG + Intronic
1136812992 16:33194705-33194727 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136819468 16:33304785-33304807 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136826031 16:33361320-33361342 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136831097 16:33460091-33460113 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1137291822 16:47056698-47056720 GAGTGTGGCAGAGGCTAAGGAGG - Intergenic
1138421608 16:56902774-56902796 AAGTGTGGAGGAGGAGGAGGAGG - Intronic
1139330229 16:66182850-66182872 GAGAGTGGCTGAGGAGTCAGGGG + Intergenic
1139446172 16:67000171-67000193 GAGTGTGGCCGAGGAGTAGGAGG + Intronic
1141314146 16:82944536-82944558 CAGTGTGGACCAGGAGTGGGAGG + Intronic
1141442242 16:84036959-84036981 GAGTGTGCCCGAGGGGTGGCTGG - Intronic
1141879186 16:86846618-86846640 GCCTGTGGCCGAGGAGGAGGAGG + Intergenic
1142209925 16:88804076-88804098 GACTGAGGCCGGGGAGTTGGGGG + Intronic
1202991569 16_KI270728v1_random:17675-17697 GGGTGGGGCTGAGGAGGAGGCGG - Intergenic
1203057263 16_KI270728v1_random:936003-936025 GGGTGGGGCTGAGGAGGAGGCGG + Intergenic
1143447746 17:7019060-7019082 GAGGGTGGTGGAGGAGCAGGAGG - Intergenic
1143714387 17:8756538-8756560 GATTGTGGCCAAGGCTTAGGTGG + Intronic
1145066016 17:19761953-19761975 CACTGAGGCCGAGGAGGAGGAGG - Intergenic
1145936356 17:28717150-28717172 GGGTGTGGGCGAGGAGGAGGCGG - Intronic
1146637567 17:34517731-34517753 GAGTGAAGCAGAGGAGTAAGTGG - Intergenic
1147370477 17:39989229-39989251 CAGTGGGGCTGAGGAGCAGGAGG - Intronic
1147658591 17:42105083-42105105 GAGTGTGGCGGAGGAGGGGCTGG - Exonic
1149664792 17:58358016-58358038 GGCTGTGTCCGAGGAATAGGAGG + Exonic
1149991323 17:61385131-61385153 GAGCGTGGCTGAGGAGGCGGGGG - Intronic
1152041667 17:77907641-77907663 GAGTGCTGCGGAGGAGAAGGAGG + Intergenic
1152179955 17:78813272-78813294 GAGTGTGGCTGAGGTGTTTGAGG - Intronic
1152277627 17:79367352-79367374 GGATGTGGAGGAGGAGTAGGAGG - Intronic
1152355238 17:79803659-79803681 GCGTGTGGTCCAGGAGGAGGCGG - Intergenic
1152988032 18:337270-337292 GAGGGAGGCCAAGGAGCAGGAGG - Intronic
1153953624 18:10077146-10077168 GAGTGTGGCCTAGGAGTGTTGGG + Intergenic
1155365763 18:25047760-25047782 GTGTGTGGATAAGGAGTAGGTGG - Intergenic
1157276063 18:46311874-46311896 GGATGTGGCGGAGGAGGAGGAGG + Intergenic
1160875865 19:1295941-1295963 GGGTGGGGCCGGGGAGTGGGCGG + Intronic
1161086454 19:2337791-2337813 GAGTGTGGCCGTGGGGAGGGCGG + Intronic
1161939787 19:7395197-7395219 GAGAGTGGCAGAGGAGCTGGCGG + Intronic
1162386127 19:10361648-10361670 GGGTGTGTCCGTGGAGGAGGTGG - Intronic
1163029814 19:14536976-14536998 GGGCGGGGCCGAGGAGGAGGAGG + Intronic
1163314944 19:16535421-16535443 GTGTCTGGCCGAGGAGGCGGCGG + Intronic
1164667898 19:30053577-30053599 GTGTGTGTCCGCAGAGTAGGTGG + Intergenic
1164683454 19:30151193-30151215 GAGCTTGGCCGAGAAGTAGCTGG - Intergenic
1166567513 19:43774238-43774260 GCGTGAGGCCGAGCAGCAGGCGG + Exonic
1167258539 19:48444556-48444578 GAGGGTGGAAGAGGAGGAGGGGG - Exonic
1167360963 19:49030146-49030168 GAAGGTGGCCCAGGGGTAGGTGG + Intronic
1167363448 19:49042538-49042560 GAAGGTGGCCCAGGGGTAGGTGG + Intergenic
925217399 2:2109265-2109287 CAGTGTGTCCCAGGAGTAGCAGG + Intronic
926989082 2:18657744-18657766 CAGTGGGGCCGAGGTGCAGGTGG - Intergenic
927149805 2:20189070-20189092 GGGTGGGGCAGAGGATTAGGTGG - Intergenic
928022487 2:27715660-27715682 GAGAGAGGCCGGGGAGTAGGTGG + Exonic
930166812 2:48211141-48211163 GAGTCTGGCCCAGCTGTAGGAGG - Intergenic
932492847 2:72132629-72132651 GATGGGGGCCGAGGAGTGGGTGG + Intronic
932745465 2:74330283-74330305 GAGTGTGGTGTAGGTGTAGGTGG + Intronic
933639133 2:84740852-84740874 GAGAGTGCCCCAGTAGTAGGTGG - Intronic
934646885 2:96064066-96064088 GAAGGTGGCCGGGGAGGAGGTGG - Intergenic
934840283 2:97620148-97620170 GAAGGTGGCCGGGGAGGAGGTGG - Intergenic
935354702 2:102187599-102187621 GAGGATGGGCGAGGAGTAGGCGG - Intronic
936022103 2:109002625-109002647 GAGGGTGGCCGGGGAGCAGAGGG - Intergenic
936974763 2:118207901-118207923 GAGTGTGGCCAAGAAGGTGGAGG - Intergenic
937001741 2:118474059-118474081 GAGTCTAGGCGTGGAGTAGGGGG - Intergenic
937886073 2:126900795-126900817 TAGTGTGCCTGGGGAGTAGGGGG - Intronic
938043441 2:128095484-128095506 GAGAGTGGGGGAGGAGGAGGAGG - Intronic
938193369 2:129302494-129302516 GTGAGTGGATGAGGAGTAGGAGG - Intergenic
941229669 2:162895888-162895910 GAGTGTGGACAAGGAGATGGGGG - Intergenic
942251835 2:174053878-174053900 GAGTCTGGAAGAGAAGTAGGGGG + Intergenic
942339745 2:174931396-174931418 GAGTTTGGCACAGGAGTGGGAGG - Intronic
943608580 2:190005504-190005526 GAATGAGGCTGAGGAGAAGGTGG - Intronic
944550967 2:200844582-200844604 GAGTGTGGCCCAGGATGAGCTGG + Intergenic
945279586 2:208023693-208023715 GTGTGGGGTCGGGGAGTAGGGGG - Intronic
946195413 2:218029971-218029993 GGATGTGGACGAGGAGCAGGAGG - Intergenic
946354918 2:219178460-219178482 CAGTGAGGCAGAGGAGGAGGCGG + Exonic
947035623 2:225851120-225851142 CAGTGTGGCAGAGGTGGAGGAGG + Intergenic
947516259 2:230807484-230807506 GAGTCTGCCCAAGGAGCAGGTGG - Intronic
947918320 2:233848921-233848943 GCATGGGGCCGAGGAGCAGGGGG + Intronic
948755075 2:240154876-240154898 TAGTGTGGAAGGGGAGTAGGGGG + Intergenic
948862064 2:240757443-240757465 GAGCGTGGGGGAGGAGGAGGAGG - Exonic
949045607 2:241871473-241871495 GTGTGTGGCCGAGGGGCTGGTGG + Intronic
1169532812 20:6503864-6503886 GAGTGGGGAGGAGGAGGAGGTGG - Intergenic
1170755951 20:19207251-19207273 GAGTGTGGCAGAGGAGCCTGGGG - Intergenic
1172768061 20:37361534-37361556 GGGTGTGGGCGGGGAGGAGGGGG + Intronic
1173350411 20:42239996-42240018 CAGTGTAGCTGAGGAGGAGGTGG - Intronic
1175339934 20:58222230-58222252 GAGTGTGGAGGAGGAGGAGCGGG + Intronic
1175482536 20:59321650-59321672 GAGGGTGGCCAAAGAGAAGGGGG - Intronic
1176285314 21:5016238-5016260 GAGGGTGCCTGAGGAGGAGGAGG + Intergenic
1177073750 21:16545711-16545733 GAGTATGGCCTAGCAGTTGGTGG + Intergenic
1177639917 21:23833297-23833319 GAGTTTGGCTGTGCAGTAGGAGG - Intergenic
1178671605 21:34595960-34595982 GATTCTGGCCGAGGAGCAGAGGG + Intronic
1179410249 21:41156847-41156869 GAGTCTGGCCGGGGTGTGGGTGG - Intergenic
1179800807 21:43810752-43810774 TACTGTGGGTGAGGAGTAGGGGG + Intergenic
1179871867 21:44247237-44247259 GAGGGTGCCTGAGGAGGAGGAGG - Intronic
1180842557 22:18966102-18966124 GGGTGGGGCTGGGGAGTAGGAGG - Intergenic
1180917394 22:19498785-19498807 GAGCATGGCCTAGGAGTGGGTGG + Intronic
1180963083 22:19771189-19771211 GAGCCTGGCCAAGGAGCAGGTGG + Intronic
1182695718 22:32198267-32198289 GACTGTGGCCCAGGAATAGGGGG - Intronic
1184036249 22:41919738-41919760 AACTGTGACCGAGGAGCAGGGGG - Intergenic
1184149971 22:42632062-42632084 GACAGTGGCAGAGGAGGAGGGGG + Intronic
1184333427 22:43840081-43840103 GAGTGGGGCCAAGGGGAAGGGGG + Intronic
1184645363 22:45892137-45892159 GGGTGTGGCCAAGGAGATGGAGG - Intergenic
1184711978 22:46256099-46256121 CAGTGAGGCCGAGGAGTTTGGGG + Exonic
1184818899 22:46893774-46893796 CAGTGCTGCCGAGGAGGAGGAGG - Intronic
1185264735 22:49894986-49895008 GAGTGAAGCCCAGGAGGAGGAGG + Intergenic
1185395870 22:50587672-50587694 GGGTGAGGCCAAGGAGGAGGTGG + Intronic
949538491 3:5013766-5013788 GAATGAGGCAGAGGAGGAGGAGG - Intergenic
950136534 3:10585013-10585035 GGGTGTGGCAGGGGAGGAGGAGG - Intronic
950455589 3:13091018-13091040 GAGTGTGGGCGGTGAGGAGGAGG - Intergenic
950660114 3:14461929-14461951 GAGGGTGGCTGAGCAGCAGGGGG - Intronic
950902741 3:16512696-16512718 GGGTCTGGGCGAGGAGGAGGTGG - Intronic
951543581 3:23805873-23805895 GGGTGAGGGCGAGGAGGAGGAGG + Intergenic
951599910 3:24362287-24362309 GAGAGGGGAAGAGGAGTAGGAGG - Intronic
952312151 3:32199929-32199951 GAGTGAGGAAGAGGAATAGGAGG + Intergenic
953828665 3:46276766-46276788 GGGTGTGCCCGAGGGCTAGGAGG + Intergenic
954347237 3:50010377-50010399 AAGGGTGGCCGGGGAGTCGGGGG + Intronic
954752397 3:52821076-52821098 CAGTGTGGCAGAGCAGGAGGCGG - Exonic
955126912 3:56121940-56121962 GAGTGGGGCTGAGCTGTAGGTGG - Intronic
956752605 3:72355312-72355334 GAGTGTTGAGGAGGAGGAGGAGG - Intergenic
959013049 3:101100515-101100537 GAATGGGGCAGAGGAGCAGGTGG + Intergenic
960256145 3:115513233-115513255 GAGGCTGGGGGAGGAGTAGGAGG + Intergenic
960957721 3:123045975-123045997 AACTGTGGCCAAGGAGCAGGTGG - Intergenic
962164977 3:133038777-133038799 GGCTGGGGCCGAGGAGGAGGTGG + Intronic
962471166 3:135710651-135710673 GAATGTGGCAGAGGGGTGGGAGG - Intergenic
962498398 3:135965659-135965681 GGGTGGGGCCGAGGAGGAGGAGG + Exonic
964767208 3:160190603-160190625 GAGTGAGGAGGAGGAGGAGGAGG + Intergenic
967671384 3:192239495-192239517 GTCTGTGGCCCAGGAGTTGGGGG - Intronic
967904032 3:194486593-194486615 GAGGGAGGCCGCGGAGGAGGCGG - Intronic
968883883 4:3317139-3317161 GAGCCTGGCCCAGGAGGAGGAGG + Exonic
969297142 4:6276872-6276894 GACAGTGGCCAAGGAGCAGGAGG - Intronic
969448558 4:7259664-7259686 GGCTGTGCCCGAGGAGGAGGTGG + Intronic
971062135 4:22984193-22984215 GAGTTAGGCAAAGGAGTAGGAGG + Intergenic
972491928 4:39596051-39596073 GGGTGGGGTAGAGGAGTAGGAGG - Intronic
972583986 4:40419830-40419852 GAGTTAGGCAGATGAGTAGGGGG - Intergenic
974273315 4:59680831-59680853 GTGTGTGGTGGAGGAGTTGGGGG - Intergenic
975559878 4:75699040-75699062 AAGTGGGACAGAGGAGTAGGTGG - Intronic
976410961 4:84713151-84713173 GAGTGTGGAGCAGGGGTAGGTGG - Exonic
978072549 4:104491344-104491366 GAGGATCGCCGAGGAGGAGGAGG + Exonic
978264728 4:106810201-106810223 GAGTGAGGAGGAGGAGGAGGAGG - Intergenic
979122857 4:116926049-116926071 GGGTGAGGCCGAGGACCAGGGGG - Intergenic
986955839 5:13148506-13148528 GAGTGTGACCCATGAGGAGGTGG - Intergenic
988233574 5:28509450-28509472 GAGTGTGACCCATGAGAAGGTGG - Intergenic
991663053 5:68969609-68969631 GAGTGTGGCGGAGGGAGAGGAGG - Intergenic
995964902 5:117893388-117893410 GAGTGAGGCTGAGGAATTGGAGG - Intergenic
997745829 5:136299373-136299395 GTGTGTGGTGGAGGAGGAGGAGG + Intronic
999193956 5:149769525-149769547 GGGCATGGCCGGGGAGTAGGGGG - Intronic
1001683806 5:173577586-173577608 GAGTGGGACAGAGGAGGAGGTGG + Intergenic
1002402255 5:178997228-178997250 GGGGGTGGCCGAGGAGTTAGAGG + Intergenic
1003464799 6:6368728-6368750 GAGTGGGGCTGAGGAGACGGAGG - Intergenic
1006105544 6:31714112-31714134 GAGGGAGGGGGAGGAGTAGGAGG - Intronic
1006304071 6:33208470-33208492 GGGTGTAGCGGAGGAGCAGGCGG + Intergenic
1006451487 6:34108137-34108159 GAGTGTGGCAGTGGTGGAGGTGG - Intronic
1006743770 6:36326963-36326985 GAGCTTGGCAGAGGAGGAGGAGG + Intronic
1006947084 6:37791735-37791757 GAGGGTGGCCAGGGTGTAGGAGG - Intergenic
1007626068 6:43247063-43247085 CAGTGTGGCGGAGGAGGAAGAGG + Intronic
1013866842 6:114708627-114708649 GAATTTGGCTGAGGAGCAGGAGG - Intergenic
1014814929 6:125924939-125924961 AAGTGTGGCCTAGAGGTAGGGGG + Intronic
1017531713 6:155299329-155299351 GAGTGTGGTGGTAGAGTAGGTGG - Intronic
1017818695 6:158033365-158033387 GAGTGTGGCTGAGGAACTGGGGG - Intronic
1018744347 6:166750431-166750453 GCGTGTGTCTGAGGAGGAGGAGG - Intronic
1019566096 7:1679750-1679772 GAGTGTGGCCAGGGGGCAGGGGG - Intergenic
1019932203 7:4230997-4231019 GAGTGAGGCAGGGGAGGAGGGGG + Intronic
1022163541 7:27735796-27735818 GATTGTGGTCAAAGAGTAGGAGG + Intergenic
1026475227 7:70729260-70729282 GAGAGAGGCAGAGGAGTAGTGGG - Intronic
1026974642 7:74489908-74489930 GAGTGGGGCAGAGGACTTGGAGG + Intronic
1028894826 7:96029339-96029361 AATTGTGGCCCAGGAGAAGGTGG + Intronic
1029812731 7:103065736-103065758 GAGTGTGGCTGAGGTATAGTGGG + Intronic
1033250391 7:139753453-139753475 GGGAGTGGACGAGGAGAAGGGGG + Intronic
1034323758 7:150210221-150210243 GAGTGTGGGCAAGGATTTGGGGG + Intergenic
1034769441 7:153759017-153759039 GAGTGTGGGCAAGGATTTGGGGG - Intergenic
1034895858 7:154875927-154875949 GAGTGTGGCTGAGAAGTTCGAGG + Exonic
1037118065 8:15249966-15249988 GAGTGTGGGTGGGGAGTTGGGGG + Intergenic
1037273908 8:17157119-17157141 GGGTGTGGCCGAGGCGGCGGCGG - Intronic
1037754585 8:21702776-21702798 GTGTGTGGCTGAGGCGTGGGGGG - Intronic
1038186132 8:25276554-25276576 GAGTGGGGCCGAGGAGAGAGTGG + Intronic
1038754874 8:30331115-30331137 GAGTGCTGCCCAGGAGTGGGTGG + Intergenic
1039573723 8:38606762-38606784 GATTGTGGCCTAGGAGTAATAGG - Intergenic
1039772201 8:40698782-40698804 GTGTGTGTCCCAGGAGCAGGAGG + Intronic
1040071942 8:43195674-43195696 GGGTGTGGATGAGGAGGAGGAGG + Intronic
1042164219 8:65930117-65930139 GACTGTCACCGAGGAATAGGCGG - Intergenic
1043804928 8:84659639-84659661 GATAGTGGACTAGGAGTAGGTGG + Intronic
1045086104 8:98687517-98687539 GTCTGTGGCCCAGGAGTTGGGGG + Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049412309 8:142478721-142478743 GAGTGTGGCCATGGGGTAGCGGG + Intronic
1049811427 8:144575247-144575269 GAGTGTGGCCGAAGTGTACAGGG - Intronic
1052107804 9:24541714-24541736 GAGTGTGGAGTAGCAGTAGGGGG + Intergenic
1053654153 9:40198040-40198062 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1053904542 9:42827216-42827238 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054366267 9:64344256-64344278 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054530442 9:66178299-66178321 GAGGGTGGCCAGGGAGAAGGGGG - Intergenic
1054673898 9:67833986-67834008 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1055019609 9:71655744-71655766 GAGTGAGGAGGAGGAGGAGGAGG - Intergenic
1056759999 9:89407721-89407743 GAGTGTGGATGAGGAGCAGTTGG - Intronic
1057053809 9:91946449-91946471 GGGTGTGGAAGAGGAGGAGGAGG + Intronic
1057139720 9:92719063-92719085 GAGTGTGGCCCAGGATGAGCTGG - Exonic
1057379702 9:94556270-94556292 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1057875435 9:98750177-98750199 GAGTTGGGTGGAGGAGTAGGCGG - Intronic
1059327076 9:113510515-113510537 GAGTCTGGTCGTGGAGGAGGGGG + Intronic
1059682844 9:116603403-116603425 CAGTGTGGCCCAGGAGTGGGTGG + Intronic
1059712407 9:116881121-116881143 GAATGTGGAAGAGGAGGAGGAGG + Intronic
1060894762 9:127210535-127210557 TAGTGTGGCCGAGGAGGCTGGGG + Intronic
1060918521 9:127405008-127405030 GAGGCTGGGCGAGGAGTGGGAGG + Intronic
1061403972 9:130383542-130383564 GTGTGTGGCCGAGAACCAGGCGG + Intronic
1061710099 9:132481416-132481438 GAGTGAGTTCGAGGATTAGGCGG - Intronic
1187984800 X:24798397-24798419 GAGTAGGGCTGAGGAGGAGGAGG - Intronic
1195449901 X:104999293-104999315 GAGTGTGGGGTAGGAGTGGGAGG + Intronic
1195687198 X:107597823-107597845 GAGTGAGGAGGAGGAGGAGGAGG + Exonic
1196396169 X:115263631-115263653 GAGAGTGAGCCAGGAGTAGGAGG + Intergenic
1199818870 X:151424641-151424663 GAGTGGGGGGGAGGAGAAGGAGG + Intergenic
1200098323 X:153674414-153674436 CAGTGTGGCCGGGGAAGAGGTGG - Intronic