ID: 1139449578

View in Genome Browser
Species Human (GRCh38)
Location 16:67018736-67018758
Sequence AAGAAAAAAGAAAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139449574_1139449578 27 Left 1139449574 16:67018686-67018708 CCTGGGTGACAGAGTAGGACTCC 0: 12
1: 1114
2: 26309
3: 83260
4: 148394
Right 1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG No data
1139449575_1139449578 6 Left 1139449575 16:67018707-67018729 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139449578 Original CRISPR AAGAAAAAAGAAAAGGAGGC AGG Intergenic
No off target data available for this crispr