ID: 1139451011

View in Genome Browser
Species Human (GRCh38)
Location 16:67028452-67028474
Sequence ATGTGGGTCTAGCACACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139451011_1139451017 25 Left 1139451011 16:67028452-67028474 CCCACTGTGTGCTAGACCCACAT No data
Right 1139451017 16:67028500-67028522 ACCTAGGAGTGTCTGCATTTTGG No data
1139451011_1139451016 9 Left 1139451011 16:67028452-67028474 CCCACTGTGTGCTAGACCCACAT No data
Right 1139451016 16:67028484-67028506 CACGCTAACACTGCAAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139451011 Original CRISPR ATGTGGGTCTAGCACACAGT GGG (reversed) Intergenic
No off target data available for this crispr