ID: 1139451311

View in Genome Browser
Species Human (GRCh38)
Location 16:67029657-67029679
Sequence CGCTGGGAGGGCGGGCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 463}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139451298_1139451311 9 Left 1139451298 16:67029625-67029647 CCCGCAGCCTCTGCTTGCCCTTA 0: 1
1: 0
2: 3
3: 27
4: 555
Right 1139451311 16:67029657-67029679 CGCTGGGAGGGCGGGCGCGCGGG 0: 1
1: 0
2: 6
3: 69
4: 463
1139451296_1139451311 24 Left 1139451296 16:67029610-67029632 CCGGGGCGGCCATCGCCCGCAGC 0: 1
1: 0
2: 1
3: 14
4: 131
Right 1139451311 16:67029657-67029679 CGCTGGGAGGGCGGGCGCGCGGG 0: 1
1: 0
2: 6
3: 69
4: 463
1139451301_1139451311 2 Left 1139451301 16:67029632-67029654 CCTCTGCTTGCCCTTATCGGCGC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1139451311 16:67029657-67029679 CGCTGGGAGGGCGGGCGCGCGGG 0: 1
1: 0
2: 6
3: 69
4: 463
1139451305_1139451311 -9 Left 1139451305 16:67029643-67029665 CCTTATCGGCGCTGCGCTGGGAG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1139451311 16:67029657-67029679 CGCTGGGAGGGCGGGCGCGCGGG 0: 1
1: 0
2: 6
3: 69
4: 463
1139451297_1139451311 15 Left 1139451297 16:67029619-67029641 CCATCGCCCGCAGCCTCTGCTTG 0: 1
1: 0
2: 0
3: 20
4: 256
Right 1139451311 16:67029657-67029679 CGCTGGGAGGGCGGGCGCGCGGG 0: 1
1: 0
2: 6
3: 69
4: 463
1139451299_1139451311 8 Left 1139451299 16:67029626-67029648 CCGCAGCCTCTGCTTGCCCTTAT 0: 1
1: 0
2: 1
3: 33
4: 378
Right 1139451311 16:67029657-67029679 CGCTGGGAGGGCGGGCGCGCGGG 0: 1
1: 0
2: 6
3: 69
4: 463
1139451304_1139451311 -8 Left 1139451304 16:67029642-67029664 CCCTTATCGGCGCTGCGCTGGGA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1139451311 16:67029657-67029679 CGCTGGGAGGGCGGGCGCGCGGG 0: 1
1: 0
2: 6
3: 69
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139451311 Original CRISPR CGCTGGGAGGGCGGGCGCGC GGG Intronic