ID: 1139451339

View in Genome Browser
Species Human (GRCh38)
Location 16:67029801-67029823
Sequence GCCGACTTACGATTTCCGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 4}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139451339_1139451350 14 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451350 16:67029838-67029860 CGCGGGTCACTTGTTGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 18
1139451339_1139451349 13 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451349 16:67029837-67029859 GCGCGGGTCACTTGTTGCGCGGG 0: 1
1: 0
2: 1
3: 1
4: 21
1139451339_1139451344 -4 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451344 16:67029820-67029842 CGGCTGGCCCGGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 66
4: 368
1139451339_1139451352 23 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451352 16:67029847-67029869 CTTGTTGCGCGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 77
1139451339_1139451351 20 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451351 16:67029844-67029866 TCACTTGTTGCGCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1139451339_1139451348 12 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451348 16:67029836-67029858 CGCGCGGGTCACTTGTTGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 36
1139451339_1139451353 29 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG 0: 1
1: 1
2: 16
3: 159
4: 1042
1139451339_1139451345 -3 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451345 16:67029821-67029843 GGCTGGCCCGGGGCGCGCGCGGG 0: 1
1: 0
2: 3
3: 59
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139451339 Original CRISPR GCCGACTTACGATTTCCGAG CGG (reversed) Exonic