ID: 1139451344

View in Genome Browser
Species Human (GRCh38)
Location 16:67029820-67029842
Sequence CGGCTGGCCCGGGGCGCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 0, 3: 66, 4: 368}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139451334_1139451344 17 Left 1139451334 16:67029780-67029802 CCAGAACGCCTGCCGCGACGGCC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1139451344 16:67029820-67029842 CGGCTGGCCCGGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 66
4: 368
1139451336_1139451344 9 Left 1139451336 16:67029788-67029810 CCTGCCGCGACGGCCGCTCGGAA 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1139451344 16:67029820-67029842 CGGCTGGCCCGGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 66
4: 368
1139451337_1139451344 5 Left 1139451337 16:67029792-67029814 CCGCGACGGCCGCTCGGAAATCG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1139451344 16:67029820-67029842 CGGCTGGCCCGGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 66
4: 368
1139451332_1139451344 29 Left 1139451332 16:67029768-67029790 CCAGGCACGCTTCCAGAACGCCT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1139451344 16:67029820-67029842 CGGCTGGCCCGGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 66
4: 368
1139451339_1139451344 -4 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451344 16:67029820-67029842 CGGCTGGCCCGGGGCGCGCGCGG 0: 1
1: 0
2: 0
3: 66
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139451344 Original CRISPR CGGCTGGCCCGGGGCGCGCG CGG Intronic