ID: 1139451345

View in Genome Browser
Species Human (GRCh38)
Location 16:67029821-67029843
Sequence GGCTGGCCCGGGGCGCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 450}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139451334_1139451345 18 Left 1139451334 16:67029780-67029802 CCAGAACGCCTGCCGCGACGGCC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1139451345 16:67029821-67029843 GGCTGGCCCGGGGCGCGCGCGGG 0: 1
1: 0
2: 3
3: 59
4: 450
1139451332_1139451345 30 Left 1139451332 16:67029768-67029790 CCAGGCACGCTTCCAGAACGCCT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1139451345 16:67029821-67029843 GGCTGGCCCGGGGCGCGCGCGGG 0: 1
1: 0
2: 3
3: 59
4: 450
1139451337_1139451345 6 Left 1139451337 16:67029792-67029814 CCGCGACGGCCGCTCGGAAATCG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1139451345 16:67029821-67029843 GGCTGGCCCGGGGCGCGCGCGGG 0: 1
1: 0
2: 3
3: 59
4: 450
1139451336_1139451345 10 Left 1139451336 16:67029788-67029810 CCTGCCGCGACGGCCGCTCGGAA 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1139451345 16:67029821-67029843 GGCTGGCCCGGGGCGCGCGCGGG 0: 1
1: 0
2: 3
3: 59
4: 450
1139451339_1139451345 -3 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451345 16:67029821-67029843 GGCTGGCCCGGGGCGCGCGCGGG 0: 1
1: 0
2: 3
3: 59
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139451345 Original CRISPR GGCTGGCCCGGGGCGCGCGC GGG Intronic