ID: 1139451346

View in Genome Browser
Species Human (GRCh38)
Location 16:67029827-67029849
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139451346_1139451361 25 Left 1139451346 16:67029827-67029849 CCCGGGGCGCGCGCGGGTCACTT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1139451361 16:67029875-67029897 GCCGGTTCCGGACGGCGGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 92
1139451346_1139451356 13 Left 1139451346 16:67029827-67029849 CCCGGGGCGCGCGCGGGTCACTT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1139451356 16:67029863-67029885 GCGGCGGCCCAGGCCGGTTCCGG 0: 1
1: 0
2: 1
3: 9
4: 136
1139451346_1139451359 20 Left 1139451346 16:67029827-67029849 CCCGGGGCGCGCGCGGGTCACTT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1139451359 16:67029870-67029892 CCCAGGCCGGTTCCGGACGGCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1139451346_1139451357 17 Left 1139451346 16:67029827-67029849 CCCGGGGCGCGCGCGGGTCACTT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1139451357 16:67029867-67029889 CGGCCCAGGCCGGTTCCGGACGG 0: 1
1: 0
2: 0
3: 3
4: 78
1139451346_1139451353 3 Left 1139451346 16:67029827-67029849 CCCGGGGCGCGCGCGGGTCACTT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG 0: 1
1: 1
2: 16
3: 159
4: 1042
1139451346_1139451354 7 Left 1139451346 16:67029827-67029849 CCCGGGGCGCGCGCGGGTCACTT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1139451354 16:67029857-67029879 GGGGCCGCGGCGGCCCAGGCCGG 0: 2
1: 3
2: 8
3: 99
4: 790
1139451346_1139451351 -6 Left 1139451346 16:67029827-67029849 CCCGGGGCGCGCGCGGGTCACTT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1139451351 16:67029844-67029866 TCACTTGTTGCGCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1139451346_1139451352 -3 Left 1139451346 16:67029827-67029849 CCCGGGGCGCGCGCGGGTCACTT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1139451352 16:67029847-67029869 CTTGTTGCGCGGGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139451346 Original CRISPR AAGTGACCCGCGCGCGCCCC GGG (reversed) Intronic