ID: 1139451350

View in Genome Browser
Species Human (GRCh38)
Location 16:67029838-67029860
Sequence CGCGGGTCACTTGTTGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 18}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139451339_1139451350 14 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451350 16:67029838-67029860 CGCGGGTCACTTGTTGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 18
1139451336_1139451350 27 Left 1139451336 16:67029788-67029810 CCTGCCGCGACGGCCGCTCGGAA 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1139451350 16:67029838-67029860 CGCGGGTCACTTGTTGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 18
1139451337_1139451350 23 Left 1139451337 16:67029792-67029814 CCGCGACGGCCGCTCGGAAATCG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1139451350 16:67029838-67029860 CGCGGGTCACTTGTTGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139451350 Original CRISPR CGCGGGTCACTTGTTGCGCG GGG Intronic