ID: 1139451351

View in Genome Browser
Species Human (GRCh38)
Location 16:67029844-67029866
Sequence TCACTTGTTGCGCGGGGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139451347_1139451351 -7 Left 1139451347 16:67029828-67029850 CCGGGGCGCGCGCGGGTCACTTG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1139451351 16:67029844-67029866 TCACTTGTTGCGCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1139451346_1139451351 -6 Left 1139451346 16:67029827-67029849 CCCGGGGCGCGCGCGGGTCACTT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1139451351 16:67029844-67029866 TCACTTGTTGCGCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1139451339_1139451351 20 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451351 16:67029844-67029866 TCACTTGTTGCGCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1139451337_1139451351 29 Left 1139451337 16:67029792-67029814 CCGCGACGGCCGCTCGGAAATCG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1139451351 16:67029844-67029866 TCACTTGTTGCGCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139451351 Original CRISPR TCACTTGTTGCGCGGGGCCG CGG Intronic