ID: 1139451353

View in Genome Browser
Species Human (GRCh38)
Location 16:67029853-67029875
Sequence GCGCGGGGCCGCGGCGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1219
Summary {0: 1, 1: 1, 2: 16, 3: 159, 4: 1042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139451339_1139451353 29 Left 1139451339 16:67029801-67029823 CCGCTCGGAAATCGTAAGTCGGC 0: 1
1: 0
2: 0
3: 0
4: 4
Right 1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG 0: 1
1: 1
2: 16
3: 159
4: 1042
1139451347_1139451353 2 Left 1139451347 16:67029828-67029850 CCGGGGCGCGCGCGGGTCACTTG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG 0: 1
1: 1
2: 16
3: 159
4: 1042
1139451346_1139451353 3 Left 1139451346 16:67029827-67029849 CCCGGGGCGCGCGCGGGTCACTT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG 0: 1
1: 1
2: 16
3: 159
4: 1042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139451353 Original CRISPR GCGCGGGGCCGCGGCGGCCC AGG Intronic