ID: 1139458727

View in Genome Browser
Species Human (GRCh38)
Location 16:67105369-67105391
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139458720_1139458727 -7 Left 1139458720 16:67105353-67105375 CCAGGATCTACGCACCCAGTACA No data
Right 1139458727 16:67105369-67105391 CAGTACACAGTGGTGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139458727 Original CRISPR CAGTACACAGTGGTGGGACA GGG Intergenic
No off target data available for this crispr