ID: 1139459429

View in Genome Browser
Species Human (GRCh38)
Location 16:67110036-67110058
Sequence CGCTGCCGCCGGGGAGGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 688
Summary {0: 1, 1: 3, 2: 3, 3: 58, 4: 623}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139459422_1139459429 -10 Left 1139459422 16:67110023-67110045 CCGGTGCTGCTGCCGCTGCCGCC 0: 1
1: 4
2: 42
3: 265
4: 1450
Right 1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG 0: 1
1: 3
2: 3
3: 58
4: 623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139459429 Original CRISPR CGCTGCCGCCGGGGAGGAGG TGG Exonic
900180124 1:1307648-1307670 CGCGGCCGCCGGGGAGGGGCTGG - Intronic
900182836 1:1319970-1319992 CACTGCCTCCGGAGAGGAGAAGG + Intronic
900297120 1:1957438-1957460 CGGTGCAGGCGGGAAGGAGGCGG - Intronic
900947087 1:5837143-5837165 CGCTGCCGGTGGGCAGGAGGAGG - Intergenic
901498495 1:9636742-9636764 CCCTGAAGCCGGGTAGGAGGAGG - Intergenic
904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG + Intronic
904258935 1:29276238-29276260 CGCTTGAGCCTGGGAGGAGGAGG - Intronic
904837676 1:33349688-33349710 GGCTCCCGGCGGAGAGGAGGCGG - Intronic
905427456 1:37896577-37896599 CGCTCCGTCCGGGAAGGAGGTGG + Intronic
905482415 1:38270701-38270723 TGCTGCCGCCGGGAAGGGGTTGG - Intergenic
906054579 1:42905291-42905313 CGCTTCAGCCTGGGAGGTGGAGG - Intergenic
908672166 1:66559866-66559888 TGCTGGAGCCAGGGAGGAGGGGG + Intronic
910584314 1:88862456-88862478 CGCTTCAGCCTGGGAGGTGGAGG + Intronic
911423421 1:97675830-97675852 CGCTTCAACCGGGGAGGTGGAGG - Intronic
913979633 1:143497649-143497671 CCCTGGCGCCGGGGCGGCGGGGG - Intergenic
914913177 1:151802623-151802645 CGCTCCCTCCAGGTAGGAGGAGG + Exonic
915018718 1:152760357-152760379 AGCTGCAGCCGCCGAGGAGGAGG - Exonic
915246398 1:154558766-154558788 CGGGGCCGCCTAGGAGGAGGAGG - Intronic
915344890 1:155192448-155192470 GGCTGCTGCAGGGAAGGAGGCGG - Intronic
915498464 1:156297937-156297959 CGCTTCCACCCGGGAGGTGGAGG - Intergenic
915724517 1:158008134-158008156 CGCTGCCGGCTAGGAGCAGGAGG - Intronic
916841904 1:168609695-168609717 GCCTGCAGCAGGGGAGGAGGGGG + Intergenic
917345138 1:174021969-174021991 CGCTGCCGCGGAGGAGCAGAGGG + Intronic
918185053 1:182119672-182119694 CGCTTCAACCTGGGAGGAGGAGG + Intergenic
919851991 1:201679089-201679111 CGCTGCAGTCAGGCAGGAGGGGG - Intronic
920096304 1:203488434-203488456 CGCTTGAGCCGGGGAGGCGGAGG + Exonic
920216911 1:204367429-204367451 CGCAGCCGCGGGGCAGGATGTGG - Intronic
920220872 1:204399474-204399496 CGCTGGAGCCTGGGAGGCGGAGG + Intergenic
920311502 1:205051575-205051597 GGCTGCAGTCGGGGTGGAGGAGG + Intronic
920519435 1:206612502-206612524 CGTTGCCGCTGGGGAGGCCGCGG + Intergenic
921472658 1:215567523-215567545 CCCGGCCGCCGGGAAGGTGGGGG + Exonic
922498964 1:226083198-226083220 TGCTGCCCCCGAGGAGGAGTTGG - Intergenic
922606314 1:226891912-226891934 CCCTGCAGCCTGGGTGGAGGAGG + Intronic
922668674 1:227493028-227493050 CGCCACAGCCGAGGAGGAGGAGG - Intergenic
922670922 1:227508271-227508293 CGCCACAGCCGAGGAGGAGGAGG + Intergenic
922802670 1:228371435-228371457 CCCTGGCCCCGGGGAGCAGGCGG + Exonic
922936546 1:229427166-229427188 GGCTGCTGGCGGAGAGGAGGTGG - Intergenic
923318516 1:232805536-232805558 CGCTGCCGCAGTGGAGCAGGAGG + Exonic
924290024 1:242526300-242526322 CGCTGAAGCCTGGGAAGAGGAGG + Intergenic
924838226 1:247677157-247677179 CGCTGGAGCCTGGGAGGCGGAGG + Intergenic
1063394900 10:5677684-5677706 TGCTGCCGATGGGTAGGAGGAGG - Intergenic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1063672604 10:8111497-8111519 CGCTTACGCCCGGGAGGTGGAGG + Intergenic
1064052359 10:12069297-12069319 CGCGGCCGGTGGGGAGGAGGGGG + Intronic
1064230783 10:13528447-13528469 AGCGGCCGCCGGGGCGGCGGGGG - Intronic
1064422025 10:15198739-15198761 CGCTTCAGCCTGGGAGGTGGAGG - Intergenic
1065099760 10:22321381-22321403 GGCGGCGGCCGAGGAGGAGGAGG + Exonic
1066464871 10:35642235-35642257 TGCTCCCGCCGAGGAGGAGGCGG - Exonic
1066464872 10:35642238-35642260 CGCTGCTCCCGCCGAGGAGGAGG - Exonic
1066745937 10:38604262-38604284 GGCTGCCTGAGGGGAGGAGGTGG + Intergenic
1067204082 10:44198863-44198885 AGCTGCCGCTGGGGAGGCTGAGG + Intergenic
1067224163 10:44364521-44364543 CGCAGCAGCGTGGGAGGAGGGGG + Intergenic
1067405876 10:46023250-46023272 GGCTGGCGCCGGGCAGGAGCCGG - Intronic
1068783227 10:60943888-60943910 CGCTGGGGCCGGGGCGGTGGGGG + Intronic
1069761806 10:70816239-70816261 GGCTGCGGCCGGGGCGGGGGCGG + Intronic
1070448738 10:76535859-76535881 CGCTTGAGCCGGGGAGGCGGAGG - Intronic
1070800074 10:79240002-79240024 CGCTGCAGCCGGGAAGGCAGTGG - Intronic
1071033745 10:81217015-81217037 CGCTTGAGCCTGGGAGGAGGAGG - Intergenic
1071468973 10:85965923-85965945 CTCTGGAGCTGGGGAGGAGGTGG - Intronic
1071690877 10:87818292-87818314 CGCGGTCGCCGGCGCGGAGGGGG + Intronic
1071784091 10:88880165-88880187 CGCCGCCGCCACAGAGGAGGGGG + Exonic
1071847347 10:89534743-89534765 CGTTGGAGCCGGGGAGGCGGAGG + Intronic
1072336493 10:94402835-94402857 CGCGGCGGCCGGGGAGCAGCTGG + Exonic
1072611245 10:97018951-97018973 GGCAGAGGCCGGGGAGGAGGAGG - Intronic
1072679707 10:97498357-97498379 CGCTGCCGCGGCTGTGGAGGCGG - Exonic
1073144541 10:101271952-101271974 CGCTGCAACCCGGGAGGTGGAGG + Intergenic
1073196266 10:101694613-101694635 GGCGGCGGCCGGGGAGGAGGAGG - Exonic
1074078068 10:110147261-110147283 CGCTTGAACCGGGGAGGAGGAGG + Intergenic
1075415270 10:122258152-122258174 TGCAGCCCCTGGGGAGGAGGAGG - Intergenic
1075783894 10:125035116-125035138 AGATGCTGCCGGGGATGAGGTGG - Intronic
1075802109 10:125160258-125160280 CGCGGCCGCAGGTGAGGCGGGGG + Intronic
1075999957 10:126906056-126906078 CTTTCCCGGCGGGGAGGAGGGGG + Intronic
1076270037 10:129144349-129144371 CGCTGCAGCCAGGAAGGAAGGGG + Intergenic
1076683172 10:132185750-132185772 CGCTGCCGGGCGGCAGGAGGCGG + Intergenic
1076735848 10:132458628-132458650 CGCTGCGGGCTGGGCGGAGGGGG - Intergenic
1077022376 11:423589-423611 CGCTGGAGCCTGGGAGGTGGAGG - Intronic
1077090199 11:774966-774988 CGCCGCGGCCTGGGAGGAGTGGG - Intronic
1077326138 11:1964919-1964941 CCCTGCCGACGGGGAGGCGAGGG - Intronic
1077457373 11:2689055-2689077 ATGTGCCACCGGGGAGGAGGAGG - Intronic
1078393973 11:10962559-10962581 CGCTTGAACCGGGGAGGAGGAGG + Intergenic
1079431014 11:20388077-20388099 CGAGGCCGCCTGGGAGGATGAGG + Exonic
1080039743 11:27747183-27747205 CGCTTGAGCCCGGGAGGAGGAGG - Intergenic
1082029507 11:47594265-47594287 CGCTGCGGCAGGGGCGGCGGGGG + Exonic
1083900495 11:65641065-65641087 CGCTGCCGCTGCGCAGGAGTGGG - Exonic
1083901165 11:65644228-65644250 TGCTGCAGCCAGGGAGGGGGAGG + Intronic
1084028441 11:66467029-66467051 TGAGGCCGCCGGGGCGGAGGGGG + Intronic
1084177939 11:67433222-67433244 TCCAGCCCCCGGGGAGGAGGAGG + Intronic
1084309056 11:68305524-68305546 CACTTGCGCCCGGGAGGAGGAGG - Intergenic
1084566231 11:69930613-69930635 AGCTGCCACCGTGGAGGCGGTGG - Intergenic
1085104686 11:73831854-73831876 CGCTTGAGCCGGGGAGGTGGAGG + Intronic
1085263697 11:75223991-75224013 AGAGGCAGCCGGGGAGGAGGAGG + Intergenic
1085332817 11:75667721-75667743 CGCTGAGGCCCGGGAGCAGGAGG - Exonic
1088255447 11:107899314-107899336 CGCTTGAGCCGGGGAGGTGGAGG - Intronic
1089356737 11:117858857-117858879 CGCTTGAGCCTGGGAGGAGGAGG - Intronic
1089432698 11:118436673-118436695 CGCCACAGCCGGGGGGGAGGGGG - Exonic
1089771956 11:120809312-120809334 CTCTGCTGCCTGGGAGGAAGAGG + Intronic
1090126650 11:124093273-124093295 CGCTTGAGCCCGGGAGGAGGAGG + Intergenic
1090664397 11:128905288-128905310 CTCTGCGGCTGCGGAGGAGGCGG - Intronic
1091281520 11:134384279-134384301 CCCTGCAGCGGGGGAGGAGGAGG - Intronic
1202809118 11_KI270721v1_random:20098-20120 CCCTGCCGACGGGGAGGCGAGGG - Intergenic
1092131929 12:6118892-6118914 GGCTGCAGCTGGGGAGGAGCTGG - Intronic
1092151542 12:6252348-6252370 CGCTTGAGCCTGGGAGGAGGAGG - Intergenic
1092243813 12:6851930-6851952 CGCTCCCGCCCTGGAGGAGTGGG + Exonic
1092246758 12:6868107-6868129 CGCGGACGCCGGCGAGGAAGGGG - Intronic
1092385368 12:8032688-8032710 CGCGGAGGCCGGGGAGGAGCCGG + Exonic
1092499837 12:9034527-9034549 CGCTGGAACCGGGGAGGCGGAGG - Intergenic
1094682373 12:32677967-32677989 CACTTCAGCCTGGGAGGAGGAGG + Intergenic
1094719941 12:33052925-33052947 CGCCGCCGCCGGGCAGGCCGGGG + Intergenic
1095053104 12:37571722-37571744 CGCTTCAGCCTGGGAGGCGGAGG - Intergenic
1096397429 12:51276861-51276883 CGCTTCAGCCTGGGAGGTGGAGG - Intergenic
1096482473 12:51951788-51951810 CGCCGCTGCCGGCGAGCAGGAGG - Exonic
1096585269 12:52615812-52615834 CTCTGCCACAGGGAAGGAGGTGG - Intronic
1096674699 12:53220183-53220205 CGCTCCAGCAGGGGGGGAGGGGG + Intronic
1096700612 12:53380466-53380488 CGGGGCCTCCGAGGAGGAGGGGG + Intronic
1097234148 12:57528309-57528331 CGGGGCCGGAGGGGAGGAGGGGG + Exonic
1097566334 12:61273423-61273445 CGCTGCAACCTGGGAGGTGGAGG + Intergenic
1098017543 12:66121798-66121820 CGCTTCAGCCTGGGAGGTGGAGG + Exonic
1098587916 12:72176285-72176307 CGCTTGAGCCGGGGAGGTGGAGG + Intronic
1099909726 12:88814815-88814837 CGCTGGAACCCGGGAGGAGGAGG + Intergenic
1100832268 12:98527437-98527459 CGCTTCAGCCTGGGAGGTGGGGG + Intronic
1101148743 12:101865822-101865844 CGCTTCAACCGGGGAGGCGGAGG - Intergenic
1102003569 12:109573842-109573864 GGCGGCGGCCGGGGAGGCGGCGG + Exonic
1102256425 12:111418189-111418211 GGCCGCCGCCGGGGAGGCTGAGG - Exonic
1102362483 12:112300223-112300245 CGCTTCAGCCTGGGAGGTGGAGG + Intronic
1102434745 12:112912254-112912276 CGCTTGAGCCTGGGAGGAGGAGG + Intronic
1102997445 12:117361198-117361220 CGCGGGCGCCCGGGAGGAAGAGG - Intronic
1103321899 12:120097013-120097035 CGCCTTGGCCGGGGAGGAGGGGG + Exonic
1103509862 12:121467014-121467036 CGCTGCCGGCGGGGCGGCCGGGG - Intronic
1103521320 12:121538150-121538172 CGGGGCCGCCAGGGAGGCGGAGG + Intronic
1103541582 12:121669778-121669800 AGCTGCCCCCAGGGAGGGGGTGG + Intronic
1104810990 12:131620349-131620371 CTCTGCCGCCGCACAGGAGGGGG - Intergenic
1104862366 12:131930183-131930205 TGCGGCCGCCGGGGAAGCGGTGG + Intronic
1104897681 12:132172335-132172357 CTCAGCCGCCGGGTGGGAGGTGG - Intergenic
1105594589 13:21825118-21825140 CGTGGCTCCCGGGGAGGAGGGGG - Intergenic
1105745725 13:23375525-23375547 CGCGGCGGCCGAGGAGCAGGCGG + Intronic
1105763386 13:23533641-23533663 CGCTTCAGCCTGGGAGGCGGAGG + Intergenic
1106241576 13:27917739-27917761 CGCGGCTGTGGGGGAGGAGGAGG - Intergenic
1106269360 13:28138707-28138729 CGCCGCCGCCAGCGAGGAGGAGG - Exonic
1106907878 13:34427909-34427931 CACTGGGGCTGGGGAGGAGGTGG + Intergenic
1107134903 13:36933108-36933130 CGCTGGAGCCTGGGAGGTGGAGG + Intergenic
1107978683 13:45714030-45714052 CGGGCCCTCCGGGGAGGAGGAGG + Exonic
1108408311 13:50125449-50125471 CGCTGCGCCGGGGGAGGGGGCGG - Intronic
1111473425 13:88717055-88717077 CCCAGCCACCGGGGAGGATGAGG - Intergenic
1111951457 13:94712174-94712196 CGCTCCCGCCCCGGAGGAGGGGG + Exonic
1112652763 13:101416515-101416537 CGCCGCCGCCGGGCAGGCTGGGG + Intergenic
1113279568 13:108774005-108774027 CGCTTTCACCTGGGAGGAGGAGG + Intronic
1113494126 13:110714317-110714339 CGGACCCGCCGGGAAGGAGGCGG - Intronic
1113806024 13:113110357-113110379 CGATGCCGGCGAGGAGAAGGCGG - Intronic
1115028144 14:28766478-28766500 CGGAGCCGGCGGGGTGGAGGGGG + Intergenic
1115320828 14:32077394-32077416 CGCTGCCGTTGAGGAGGAGACGG + Exonic
1116657949 14:47674897-47674919 CGCAGACGCCGGGGAGGAGCAGG + Exonic
1117029292 14:51652077-51652099 CCCTGCCGGCGGGGCGGCGGCGG + Intronic
1117253600 14:53956867-53956889 AGGGGCCGCCGGGGAAGAGGAGG - Intronic
1118366579 14:65102052-65102074 CCCTCCCGCAAGGGAGGAGGTGG + Intronic
1118749603 14:68796084-68796106 CGCTTCCGACCGGGAGGCGGTGG + Intronic
1118837671 14:69488038-69488060 CCCTGCCCCTGGGGAGGAGAAGG - Intronic
1119340135 14:73869940-73869962 CGCTTGAGCCGGGGAGGCGGAGG + Intronic
1120501887 14:85307837-85307859 CGGTGCCTCCGGTGAGGAGCTGG + Intergenic
1121450235 14:94002370-94002392 CGCTGGAGCCTGGGAGGCGGAGG - Intergenic
1122264152 14:100538934-100538956 CGCGGCCGAGGAGGAGGAGGAGG - Exonic
1122615849 14:103017236-103017258 CGCTGGAGCCCGGGAGGTGGAGG + Intronic
1122711091 14:103658739-103658761 CGCTGGAGCCCGGGAGGTGGAGG - Intronic
1122747786 14:103909786-103909808 CGTTGCCGTCGGGGATGCGGCGG - Intergenic
1122860954 14:104582174-104582196 GGCAGCAGCCTGGGAGGAGGCGG + Intronic
1122947733 14:105020871-105020893 CGCTGGGTCCGGGGCGGAGGCGG - Intronic
1122968447 14:105142877-105142899 CGCGGCCGTCAGGGAGGATGAGG - Exonic
1122975567 14:105169303-105169325 CCCTGCAGCCGGCGTGGAGGCGG - Intergenic
1123025806 14:105423301-105423323 CGCTTGGGCCGGGGAGGCGGAGG - Intronic
1123693744 15:22861816-22861838 CGCTTGGGCTGGGGAGGAGGAGG - Intronic
1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG + Intronic
1124922288 15:34038838-34038860 CGCGGAGGCCGAGGAGGAGGAGG - Exonic
1125197121 15:37059855-37059877 CGCTTGCGCCTGGGAGGTGGAGG + Intronic
1125594236 15:40874069-40874091 CGCCGCCGCGGGGGAGGGGTCGG + Exonic
1126340304 15:47634375-47634397 CACTGCCACCTGGGAGAAGGAGG + Intronic
1126502918 15:49366758-49366780 CGCTGCCTCCGTGGCGGGGGCGG + Intronic
1127608634 15:60615511-60615533 AGCAGCAGCCGGGGAGGAGAAGG + Intronic
1127857821 15:62967219-62967241 CCCTGTCCCCAGGGAGGAGGTGG + Intergenic
1127887397 15:63214373-63214395 CGCTGCAACCTGGGAGGCGGAGG - Intronic
1128078237 15:64841633-64841655 GGCTGCGGCGGGGGAGGAGAGGG - Intergenic
1128139077 15:65286387-65286409 GGCGGCCGCCAGGGAGGCGGCGG - Exonic
1128454867 15:67826843-67826865 CGCTGCGGGTGGGGTGGAGGTGG - Exonic
1128565837 15:68699989-68700011 CGCTGCAGCCTGGGAGGGGGTGG + Intronic
1128582398 15:68818952-68818974 GGCGGCCGCGGGAGAGGAGGGGG - Intronic
1128633944 15:69291072-69291094 TGCTGACTCCAGGGAGGAGGGGG - Intergenic
1129051313 15:72783891-72783913 TGTTGCCGCCCCGGAGGAGGTGG + Intronic
1129150160 15:73683712-73683734 CGCTCCAGCCTGGGAGGAGATGG - Intergenic
1129414609 15:75368340-75368362 GGCAGGGGCCGGGGAGGAGGGGG - Intronic
1129428482 15:75481465-75481487 CCGTGCCGTCCGGGAGGAGGTGG + Intronic
1129846484 15:78770077-78770099 CGCTGGAGCCTGGGAGGCGGAGG + Intronic
1130159193 15:81382219-81382241 CGCTTCAACCCGGGAGGAGGCGG - Intergenic
1131094810 15:89648492-89648514 GGCGGCCGCCGCGGAGGCGGTGG + Exonic
1131108525 15:89750405-89750427 GGCTGCCGGCGGGGAGCAGCAGG + Intronic
1131195480 15:90351816-90351838 TCCGGCCGCCGGGGATGAGGTGG + Intergenic
1131260469 15:90884921-90884943 GACTGCAGACGGGGAGGAGGTGG - Intronic
1131277408 15:90994040-90994062 CGCTGCGGGCGGGGAGGGTGGGG + Intronic
1131816441 15:96225980-96226002 TGCTGCTGCTGGGGAGAAGGTGG - Intergenic
1132398310 15:101489798-101489820 GGCGGGAGCCGGGGAGGAGGAGG + Exonic
1132547513 16:540200-540222 CTCTGCGGCCAGGGAGGAGGCGG - Intronic
1132712262 16:1274291-1274313 CGCTGGAGCCTGGGAGGCGGAGG - Intergenic
1132741073 16:1413804-1413826 CGCCGCTGCCTGGGCGGAGGTGG - Intronic
1132767426 16:1541569-1541591 CGCTGGCGTGGGGGTGGAGGTGG - Intronic
1132934582 16:2474219-2474241 AGCTGCCGGCGGGGACGGGGCGG - Intergenic
1133040170 16:3056481-3056503 CGCTGGAGCCCGGGAGGTGGAGG - Intronic
1133097582 16:3458002-3458024 CGCTGCCGGCAGGGAGCGGGAGG + Intronic
1133147823 16:3803251-3803273 GGCTGACGGCGGGGAGGGGGGGG + Intronic
1133293729 16:4739630-4739652 CGCTTCAGCCCGGGAGGTGGAGG - Intronic
1135218319 16:20591734-20591756 CGCTTGAACCGGGGAGGAGGAGG - Intergenic
1135250989 16:20900823-20900845 CGCGGCGGGCTGGGAGGAGGCGG - Intronic
1135404223 16:22186703-22186725 TGCTGCTGCAGGGAAGGAGGGGG - Exonic
1136112427 16:28072868-28072890 CGCTGGAGCCCTGGAGGAGGAGG + Intergenic
1136399809 16:30011096-30011118 CGCTGGGGCTGGGGAGGGGGCGG + Intronic
1136687377 16:32003242-32003264 CGCTGGAGGAGGGGAGGAGGAGG - Intergenic
1136737127 16:32475382-32475404 GGCTGCCTGAGGGGAGGAGGTGG - Intergenic
1138635192 16:58332757-58332779 CACTGGCACCGGGGAGGTGGAGG - Intronic
1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG + Exonic
1139951370 16:70673075-70673097 CGCTTGAGCCTGGGAGGAGGAGG + Intronic
1141054498 16:80803663-80803685 CGGGGGCGCGGGGGAGGAGGGGG - Intronic
1141499905 16:84436734-84436756 CGCTGGCGATGGGGAGGGGGAGG - Intronic
1141503996 16:84462817-84462839 CCCTGCCGGCGGGGAGGCGGTGG - Intronic
1141988274 16:87594071-87594093 CGCTGGCACAGGGGAGGAGGAGG + Intergenic
1142226948 16:88882116-88882138 CGCTGACAGCTGGGAGGAGGGGG + Intronic
1142264454 16:89057403-89057425 CGCGTCCACCTGGGAGGAGGAGG - Intergenic
1142264482 16:89057491-89057513 CGCGTCCACCTGGGAGGAGGAGG - Intergenic
1203015944 16_KI270728v1_random:354195-354217 GGCTGCCTGAGGGGAGGAGGTGG + Intergenic
1203034279 16_KI270728v1_random:627353-627375 GGCTGCCTGAGGGGAGGAGGTGG + Intergenic
1142645291 17:1307681-1307703 CGCTTGGGCCTGGGAGGAGGAGG + Intergenic
1142831188 17:2550304-2550326 CGCTTCAACCGGGGAGGTGGAGG - Intergenic
1142863405 17:2776812-2776834 CCCCGCCGCCCCGGAGGAGGAGG + Intergenic
1142863408 17:2776815-2776837 CGCCGCCCCGGAGGAGGAGGAGG + Intergenic
1142983628 17:3685464-3685486 TGCGGCCGCCGGGGAGAGGGTGG + Intronic
1143031751 17:3971786-3971808 CGCTGGAACCTGGGAGGAGGAGG + Intergenic
1143063292 17:4221971-4221993 CGATGCCGCCAAGGAGGTGGCGG + Intronic
1143448808 17:7023679-7023701 CGCTCCCTCCGGGGCGGCGGGGG - Exonic
1143487497 17:7262705-7262727 GACCGCCGCTGGGGAGGAGGCGG + Intronic
1143516626 17:7422465-7422487 CCCTGCCTCAGGGGAGGGGGAGG - Intergenic
1143590666 17:7884686-7884708 CGCCGCCGCCGAGGAGGAGGAGG + Intronic
1143590668 17:7884689-7884711 CGCCGCCGAGGAGGAGGAGGAGG + Intronic
1143592577 17:7894428-7894450 TGCAGTGGCCGGGGAGGAGGAGG + Exonic
1143783249 17:9240282-9240304 CGCGGCCGCCGTGGAGGGGCTGG + Exonic
1144598166 17:16589106-16589128 CGCTGACGGCGGGAAGGGGGTGG - Intergenic
1145066016 17:19761953-19761975 CACTGAGGCCGAGGAGGAGGAGG - Intergenic
1145214775 17:21043129-21043151 CGGTGCCGGCCGGGAGGGGGGGG - Intronic
1146187283 17:30732037-30732059 CGGTAACGCCGCGGAGGAGGAGG - Intergenic
1146332332 17:31937410-31937432 TGCCGCCGCGGAGGAGGAGGAGG - Exonic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1146400992 17:32499877-32499899 CGCTGGAGCCTGGGAGGCGGAGG + Intronic
1146888474 17:36488012-36488034 CGCTTGAGCCTGGGAGGAGGAGG + Intronic
1147179201 17:38674171-38674193 CACCGCCGCCGGCGAGGATGCGG - Exonic
1147314395 17:39612665-39612687 TGCGGCGGGCGGGGAGGAGGGGG - Intergenic
1147714579 17:42496750-42496772 TGCTTGCGCCCGGGAGGAGGAGG + Intronic
1147745876 17:42694253-42694275 CGCTTCAGCCCGGGAGGTGGAGG - Intronic
1147970960 17:44219049-44219071 CGCAGGCTCGGGGGAGGAGGCGG - Intronic
1147971297 17:44220070-44220092 TGCCGCCGCCGGGGAAGGGGGGG + Intronic
1148206044 17:45780866-45780888 CGCTGGAACCTGGGAGGAGGAGG - Intergenic
1148437165 17:47693964-47693986 CGGAGCAGCCGGGGAGGAGGAGG + Intergenic
1149512684 17:57256423-57256445 CACGTGCGCCGGGGAGGAGGGGG + Intronic
1149753102 17:59164793-59164815 CGCTTCAACCTGGGAGGAGGAGG + Intronic
1150207348 17:63419109-63419131 CCATGCAGCTGGGGAGGAGGAGG - Intronic
1151203578 17:72488138-72488160 AGGTGGCGCCGGTGAGGAGGGGG - Intergenic
1151540320 17:74761523-74761545 CTCTGCAGCAGGGGAGGAAGAGG - Intronic
1151564796 17:74892086-74892108 AGCTGACCCCGGGGAGCAGGGGG + Intronic
1152036418 17:77875823-77875845 CAGTGAAGCCGGGGAGGAGGGGG + Intergenic
1152037057 17:77880070-77880092 CGCTGCCGGGCGGCAGGAGGCGG + Intergenic
1152222215 17:79075072-79075094 GGCGGCGGCCGGGAAGGAGGTGG + Exonic
1152234822 17:79133102-79133124 TTCTGCCTCCAGGGAGGAGGGGG + Intronic
1152343912 17:79740112-79740134 CGCTGGAGCCCGGGAGGTGGAGG + Intronic
1152565118 17:81096914-81096936 CGCTCCAGCTGTGGAGGAGGAGG + Intronic
1155157637 18:23170878-23170900 CGCTGGAGCCTGGGAGGCGGAGG - Intronic
1156275933 18:35582279-35582301 CGCTGCCCCCGAGGAGGACCCGG + Intronic
1156448568 18:37253990-37254012 CGCTGCCGGCGGGGAGGGGTCGG + Intronic
1156723562 18:40100412-40100434 CGCTGGAACCGGGGAGGTGGAGG - Intergenic
1157222652 18:45838700-45838722 CGCGGCTGCAGGGGAGAAGGCGG - Exonic
1157447531 18:47756444-47756466 GGCTGGGGCCGTGGAGGAGGGGG - Intergenic
1157798759 18:50601248-50601270 CGCTGGAGCCTGGGAGGTGGAGG + Intronic
1158893655 18:61894525-61894547 GGCTGTGGGCGGGGAGGAGGGGG - Intergenic
1158964505 18:62611287-62611309 TGCTGGAGCCGGGGAGTAGGCGG - Intergenic
1159812180 18:73029413-73029435 CGCTGGAACCGGGGAGGTGGAGG + Intergenic
1160024929 18:75209227-75209249 CGCCGGCGCCGGGGAGGCGGGGG - Exonic
1160159079 18:76457631-76457653 CCCTGACGCCGGGGAGGTCGAGG + Intronic
1160680102 19:408490-408512 CCCTGCCGGCGGGGTGGGGGTGG + Intronic
1160760903 19:783793-783815 CGCTTCCACCTGGGAGGCGGAGG - Intergenic
1160948776 19:1655757-1655779 CTCTGGGGCCGGGCAGGAGGAGG + Intergenic
1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG + Exonic
1160967777 19:1754116-1754138 CGCTGCGGCGGGGGTGGCGGGGG - Exonic
1161015263 19:1980032-1980054 CGGTGCCTTCGGGGAGGTGGGGG + Intronic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161073482 19:2273863-2273885 CGCTGCGGCCGGGCAGACGGCGG - Intronic
1161075363 19:2282575-2282597 TGCTGCCGCAGGAGGGGAGGTGG - Intronic
1161400650 19:4065349-4065371 CGCTGCGGCCGGGGCGGGGGAGG - Intronic
1161426379 19:4205762-4205784 CGCTGGAACCGGGGAGGCGGAGG + Intronic
1161454575 19:4363597-4363619 CGCTGCAGCAGGGGAGGTGGAGG - Intronic
1161723853 19:5917528-5917550 CGCTGCCGGTGGGGTGGGGGCGG + Exonic
1161977695 19:7615496-7615518 GGCTCCAGCCGAGGAGGAGGTGG + Exonic
1162034676 19:7932557-7932579 GGCTGCGGCGGGGGAGGTGGTGG + Intronic
1162056298 19:8066048-8066070 CCCTGCAGCTGGGGCGGAGGCGG - Exonic
1162144443 19:8605253-8605275 CGCTGCCTCCGGGGAGGAGGTGG + Exonic
1162315609 19:9936483-9936505 CCCGGCCGCCGGCGAGGCGGGGG - Exonic
1162588271 19:11574887-11574909 CGCTGCAGCAGGGCAGGAAGGGG - Exonic
1162748995 19:12816769-12816791 CGCTGGAGCCCGGGAGGTGGAGG - Intronic
1162894554 19:13757530-13757552 GGATGCCGCCGGGGTGGGGGTGG + Intronic
1162916627 19:13877735-13877757 GGCCACCGCCGAGGAGGAGGAGG + Exonic
1162925882 19:13930360-13930382 CGCTGCAGCTGGGGGAGAGGAGG - Exonic
1163113316 19:15174655-15174677 CGCTGGAACCGGGGAGGTGGAGG - Intronic
1163459018 19:17425146-17425168 AGCTGCAGCCCTGGAGGAGGGGG + Exonic
1163609738 19:18294669-18294691 CCCTGCCCCCTGTGAGGAGGCGG + Intergenic
1163765423 19:19160888-19160910 CTAGGCCCCCGGGGAGGAGGCGG - Intronic
1163793214 19:19320430-19320452 GGCGGCCGCCTGAGAGGAGGCGG + Intronic
1164186155 19:22871541-22871563 AGCTGCCCCCGGGAGGGAGGTGG - Intergenic
1164574282 19:29396625-29396647 CCCTGTCCCTGGGGAGGAGGAGG - Intergenic
1164588360 19:29491790-29491812 ACCTGCCGCAGGGGAGGAGGTGG + Intergenic
1164840086 19:31386741-31386763 CTCTGCTGCGAGGGAGGAGGAGG + Intergenic
1165058728 19:33194739-33194761 CGGAGCCGCGGGGCAGGAGGCGG + Exonic
1165426669 19:35749719-35749741 CGCTGGAGCCGGGGAGGCGGAGG + Intronic
1165706602 19:37980604-37980626 GGCTGAGGCCAGGGAGGAGGGGG + Intronic
1165751705 19:38264406-38264428 CCCTGGTGCCGGGGAAGAGGCGG - Intronic
1165803182 19:38565369-38565391 CGCTGGCGCGGGGGCGGCGGCGG + Exonic
1165803237 19:38565588-38565610 CGCTGGAGACGAGGAGGAGGCGG + Exonic
1165861665 19:38912256-38912278 CGCCGCGGGCGGGGAGGGGGCGG - Intergenic
1165924957 19:39320964-39320986 CGCCGCCGCAAGGGGGGAGGGGG + Intergenic
1166106692 19:40601246-40601268 CGCGGCCGCCGGGGAGGGAGTGG + Intronic
1166520770 19:43478829-43478851 CGCTTGAGCCGGGGAGGTGGAGG + Intronic
1167005852 19:46775995-46776017 CGCTGGAGCCTGGGAGGTGGAGG + Intronic
1167457900 19:49607622-49607644 CGCTTCAGCCTGGGAGGTGGAGG + Intronic
1167466050 19:49651613-49651635 CCCGGCCGCCGGGGCGGAAGAGG - Exonic
1167532647 19:50027769-50027791 CGCTTCAACCGGGGAGGTGGAGG - Intronic
1167642411 19:50688967-50688989 CGCTGCAGACAGGGAGGAGCCGG + Exonic
1167897454 19:52593418-52593440 CGCTCCCTCCGGGAGGGAGGTGG - Intergenic
1168114273 19:54212469-54212491 CGCTGGCACCTGGGAGGTGGAGG - Intronic
1168173693 19:54607934-54607956 CCCTGTCCCCGGTGAGGAGGAGG - Intronic
1168216267 19:54928134-54928156 CGCTTCAGCCTGGGAGGCGGAGG + Intronic
1168219896 19:54953050-54953072 CGCTTGAGCCGGGGAGGCGGAGG + Intronic
1168523310 19:57069633-57069655 CGCTGGAACCAGGGAGGAGGAGG - Intergenic
1168538543 19:57191779-57191801 CGTTGCCACCGAGGAGGCGGCGG + Exonic
1168643348 19:58044521-58044543 CGCGGCCGCCGCGGAGAAGGAGG + Intronic
925068774 2:950634-950656 CGCTCCCGCGGGGGTGGATGGGG - Intergenic
925361865 2:3285380-3285402 CGCTGCAGCTGGGCAGGCGGTGG - Intronic
925388419 2:3479404-3479426 GGCTGTCGCCGGCAAGGAGGGGG + Exonic
925492743 2:4413038-4413060 GGCTGCCGCAGGGGGAGAGGAGG - Intergenic
925980023 2:9169145-9169167 GGCAGCAGCTGGGGAGGAGGCGG + Intergenic
926397517 2:12459076-12459098 CGCTTGAGCCAGGGAGGAGGAGG + Intergenic
927151918 2:20201103-20201125 CTCTGCAGCCGGGTGGGAGGAGG + Exonic
927511997 2:23649713-23649735 CGCTGCCGATGGGGATGAGAGGG + Intronic
927887594 2:26728234-26728256 CGCTGCCGCCGTGGATGAGGCGG - Exonic
927938127 2:27086679-27086701 CGCCTCCGCCGCGGAGGAGCAGG - Intergenic
928022493 2:27715698-27715720 GGCAGCCGCTGGGGAGGACGCGG - Exonic
928143577 2:28751841-28751863 CGGTGCCGAGGAGGAGGAGGTGG + Exonic
928526211 2:32143818-32143840 CGCTTCAGCCCGGGAGGTGGAGG + Intronic
928527570 2:32158039-32158061 CGCTTAAGCCCGGGAGGAGGAGG + Intergenic
928569055 2:32584447-32584469 CGCTTCAACCGGGGAGGCGGAGG + Intronic
928904548 2:36356030-36356052 CCCTCCCTCCCGGGAGGAGGAGG + Exonic
929218015 2:39436776-39436798 CGCTGGCGCCAGGGAGCAGTCGG - Intronic
929983186 2:46699480-46699502 CGCGGGGGCCGGGGAGCAGGCGG - Intronic
931677805 2:64715040-64715062 CGCTTGGGCCGGGGAGGTGGAGG + Intronic
932772508 2:74508250-74508272 CCCTGCTGCCGGGGATGGGGGGG + Exonic
933886079 2:86720287-86720309 CGCCGCCGACTGGGGGGAGGGGG - Exonic
934188262 2:89764500-89764522 GGCTGCCTGAGGGGAGGAGGTGG - Intergenic
934212079 2:89989458-89989480 CGCTTCAACCTGGGAGGAGGAGG + Intergenic
934308340 2:91843454-91843476 GGCTGCCTGAGGGGAGGAGGTGG + Intergenic
935027184 2:99288650-99288672 CGCTGGAGCCTGGGAGGCGGAGG - Intronic
935117040 2:100145651-100145673 CGCTGGAGCCTGGGAGGCGGAGG + Intergenic
935211330 2:100941477-100941499 CGCTTGAGCCTGGGAGGAGGAGG + Intronic
935560789 2:104557517-104557539 CGCTGGAACCGGGGAGGTGGAGG + Intergenic
936446537 2:112600190-112600212 CTCTGCCGCCGACCAGGAGGTGG + Intergenic
937283488 2:120736072-120736094 CCCTACCGCCGGCGAGCAGGCGG - Intronic
938043049 2:128091601-128091623 CGCTTCCGCGGGGGTGGCGGCGG + Intronic
938365213 2:130728463-130728485 CCCTTCCTCTGGGGAGGAGGAGG - Intergenic
938881687 2:135596080-135596102 CGCTGGAGCCTGGGAGGCGGAGG - Intronic
939629164 2:144513853-144513875 CACTGACGCTGGAGAGGAGGGGG - Intronic
940265158 2:151828450-151828472 CGCAGCCGCCCGAGAGGAGCTGG - Exonic
941009783 2:160286401-160286423 CGCTGCAGCCCGGGAGGCAGAGG - Intronic
941603061 2:167563789-167563811 CGCTCCCTCCGGGGGGGAGGTGG - Intergenic
941686837 2:168456295-168456317 AGCAGCGGCCGCGGAGGAGGCGG + Exonic
941819175 2:169827708-169827730 GGCTGCCGGCGGCGAGGACGCGG + Exonic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942448369 2:176092967-176092989 CGCCGCCACCGATGAGGAGGAGG - Exonic
943645940 2:190408216-190408238 GGCCGGGGCCGGGGAGGAGGAGG + Intergenic
944819547 2:203416377-203416399 CGCTGGAACCGGGGAGGTGGAGG - Intronic
944831182 2:203535183-203535205 CGCCGCGCCTGGGGAGGAGGCGG - Exonic
945450735 2:209992213-209992235 AGCAGCCGCTGGGGAGGAAGAGG + Exonic
946109166 2:217398993-217399015 CACTGCCGCAGGAGAGGAAGTGG + Intronic
946180174 2:217944135-217944157 GGCTGGCTCCGGGAAGGAGGCGG - Intronic
946927423 2:224639557-224639579 CGCTCCAGCCTGGGAGGTGGAGG - Intergenic
947289296 2:228554251-228554273 CGCTGGAGCCCGGGAGGTGGAGG + Intergenic
947714719 2:232333746-232333768 CGCTGCCGACGGTGAGGCTGTGG + Intronic
947938578 2:234028229-234028251 CGCTTGAGCCTGGGAGGAGGAGG - Intergenic
948157965 2:235799933-235799955 CGCTGCCCTCGGGGTGGAGGTGG + Intronic
948309286 2:236972853-236972875 AGCTGCCCCCGGTCAGGAGGAGG - Intergenic
1168838312 20:892510-892532 CGCTGGAGCCTGGGAGGTGGAGG + Intronic
1168878213 20:1185425-1185447 GGCGGCCGCTGGGGAGGCGGGGG + Intronic
1169664522 20:8019500-8019522 CGCTGCCGCCGGAGCAGAGCCGG - Exonic
1172278265 20:33692824-33692846 CGCTTGAGCCTGGGAGGAGGAGG + Intergenic
1172596112 20:36152415-36152437 CCCTGCCCCAGGGGAGGAGTGGG + Intronic
1172903648 20:38352669-38352691 CGCTGTAGCCTGGGAGGCGGAGG + Intronic
1172951100 20:38724072-38724094 CGCCGCCGCAGGGTGGGAGGGGG - Intergenic
1173203603 20:40972981-40973003 CGCTGAAGCCTGGGAGGCGGAGG - Intergenic
1173790410 20:45824401-45824423 CGCTGCCTGCGGGCAGCAGGTGG + Exonic
1173839837 20:46150235-46150257 CGCTTCAACCGGGGAGGCGGAGG - Intergenic
1173944903 20:46942847-46942869 CGCTTGAACCGGGGAGGAGGAGG - Intronic
1174317522 20:49713913-49713935 CGCAGCGGCGGGGGCGGAGGCGG + Intergenic
1174487572 20:50870976-50870998 GCCTGCGGCCCGGGAGGAGGGGG + Intronic
1174607039 20:51768462-51768484 CGCCGCCCCGGGGGAGGAGGCGG + Exonic
1174660786 20:52211012-52211034 CGCTTGAGCCTGGGAGGAGGAGG + Intergenic
1175199266 20:57266648-57266670 CGCTGGGGCCTGGGCGGAGGAGG + Intergenic
1175359708 20:58399214-58399236 CGCTTCAGCTGGGGAGGTGGAGG + Intronic
1175562304 20:59940427-59940449 CGCTGCGGCAGGGGAGCTGGAGG - Intronic
1175847477 20:62066127-62066149 CGCGGGCGCCGGGGCGGTGGCGG + Intergenic
1175940451 20:62535336-62535358 TGCTGCTGGTGGGGAGGAGGCGG + Intergenic
1175981289 20:62739973-62739995 CCCTGCAGCTGGGGACGAGGCGG - Intronic
1176061266 20:63173942-63173964 CACTGGGGCCAGGGAGGAGGGGG + Intergenic
1176093420 20:63328939-63328961 CGCTGCTGCCTCAGAGGAGGAGG - Intronic
1176234947 20:64049721-64049743 GGGAGCCCCCGGGGAGGAGGCGG - Intergenic
1176549276 21:8214458-8214480 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1176555808 21:8253547-8253569 CGCGCCCGCCCGCGAGGAGGCGG - Intergenic
1176557169 21:8258681-8258703 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1176566845 21:8392367-8392389 CGCGCCCGCCCGCGAGGAGGCGG - Intergenic
1176568208 21:8397496-8397518 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1176574745 21:8436581-8436603 CGCGCCCGCCCGCGAGGAGGCGG - Intergenic
1176576111 21:8441716-8441738 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1176611359 21:8987874-8987896 CGCGCCCGCCCGCGAGGAGGCGG - Intergenic
1178513832 21:33229899-33229921 CGCCGCCGCCGGCGCGGGGGCGG - Intronic
1178534927 21:33403409-33403431 CGCTGCTGCTCGGGAAGAGGCGG + Exonic
1178700149 21:34826519-34826541 CGCTTGAGCCGGGGAGGTGGAGG - Intronic
1178992450 21:37367039-37367061 TGCCGCCGCCGGCGAGCAGGCGG + Intronic
1179238321 21:39566630-39566652 GGCTGCAGCCGGGGGAGAGGGGG - Intronic
1179605625 21:42513753-42513775 CGCGGCGGCCGGGGAGGGGGAGG + Intronic
1179626878 21:42653910-42653932 CGCTGTCACCCGGGGGGAGGAGG - Intronic
1179679177 21:43005856-43005878 CACAGCTGCCTGGGAGGAGGTGG - Intronic
1179785695 21:43728537-43728559 CCCTGCCTCCCCGGAGGAGGAGG + Intronic
1179995997 21:44974647-44974669 CGCTGCAGCCCAGGAGGCGGAGG - Intronic
1180041204 21:45281160-45281182 CGCTTCTGCCGGGGAGCAGGGGG - Intronic
1180191058 21:46162668-46162690 CGCTTGAGCCGGGGAGGCGGAGG - Intronic
1180535428 22:16390534-16390556 GGCTGCCTGAGGGGAGGAGGTGG + Intergenic
1180831069 22:18906386-18906408 CGCGGGCGCCTTGGAGGAGGTGG + Exonic
1180949936 22:19716396-19716418 CGGTGCTGCCTGTGAGGAGGTGG - Intronic
1181068773 22:20319955-20319977 CGCGGCCGCCTTGGAGGAGGTGG - Exonic
1181081510 22:20418696-20418718 CGCTGGAGCCCGGGAGGCGGAGG + Intergenic
1181491502 22:23263141-23263163 GGCGGCAGCCAGGGAGGAGGAGG + Intronic
1181618391 22:24070895-24070917 GGCTGCCGCCAAGGAGGAGTGGG + Exonic
1181719547 22:24763382-24763404 CGCTGGAGCCCGGGAGGCGGAGG - Intronic
1181998640 22:26902893-26902915 TGCTGGAACCGGGGAGGAGGAGG - Intergenic
1182231005 22:28837536-28837558 CGCTTCAGCCTGGGAGGTGGAGG - Intergenic
1182321340 22:29480104-29480126 GGGGGCCGCAGGGGAGGAGGCGG + Intergenic
1183586362 22:38755496-38755518 GGCAGCCTCCCGGGAGGAGGAGG - Intronic
1183670741 22:39270900-39270922 CGCTGCTGCCGGGCAGTGGGGGG + Intergenic
1183828515 22:40406039-40406061 CAAAGCCGCTGGGGAGGAGGTGG - Intronic
1183908192 22:41058950-41058972 CGCTTGAGCCGGGGAGGTGGAGG - Intergenic
1184146345 22:42613675-42613697 CGCTGGAACCGGGGAGGCGGAGG + Intronic
1184533736 22:45072499-45072521 AGCTGCGGCGGGGGAGGAGGCGG - Intergenic
1184562055 22:45269137-45269159 CGGTTCGGCCGGGGAGGGGGCGG - Intergenic
1184756976 22:46522207-46522229 CGCTTCAGCCTGGGAGGTGGAGG - Intronic
1184818899 22:46893774-46893796 CAGTGCTGCCGAGGAGGAGGAGG - Intronic
1185229467 22:49671864-49671886 CGCTGGAGCCAGGGCGGAGGGGG + Intergenic
1203252793 22_KI270733v1_random:125632-125654 CGCGCCCGCCCGCGAGGAGGCGG - Intergenic
1203254161 22_KI270733v1_random:130774-130796 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1203260849 22_KI270733v1_random:170718-170740 CGCGCCCGCCCGCGAGGAGGCGG - Intergenic
1203262217 22_KI270733v1_random:175853-175875 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1203281156 22_KI270734v1_random:131657-131679 CGCGGGCGCCTTGGAGGAGGTGG + Intergenic
950692847 3:14674074-14674096 CGCTGGAGCCTGGGAGGTGGAGG + Intergenic
951031984 3:17892930-17892952 GGCTGCGGCTGGGGAGGAGATGG - Intronic
952372915 3:32740373-32740395 CGCTTCAACCGGGGAGGCGGAGG + Intronic
952509063 3:34036005-34036027 AGCTGCAGGCGGGCAGGAGGAGG + Intergenic
952944803 3:38472188-38472210 CTCTGCTGCTGGGGAGGTGGTGG + Intronic
954034046 3:47840991-47841013 AGCTGCCGCCAGGAAGTAGGGGG - Exonic
954202104 3:49029506-49029528 CGCTGCGGCGGGGGCGGAGCTGG + Intergenic
954338491 3:49934681-49934703 CGCTTGAGCCGGGGAGGCGGAGG + Intergenic
954356174 3:50084820-50084842 CGCTCCCTCCGGGAGGGAGGTGG - Intronic
954408681 3:50359528-50359550 CGCTGCCGCCGGGGACGCGCAGG - Exonic
954566632 3:51605534-51605556 CGCTGCAACCTGGGAGGTGGAGG - Intronic
954717908 3:52535664-52535686 GGCTTGAGCCGGGGAGGAGGGGG + Intronic
955165015 3:56502479-56502501 CGCTGGAACCGGGGAGGCGGAGG - Intergenic
955197860 3:56821878-56821900 CGCTGGAACCGGGGAGGTGGAGG + Intronic
955398904 3:58577247-58577269 CGGTGCCGTTCGGGAGGAGGTGG - Intronic
956728700 3:72177488-72177510 CTCTGCGGCTGGGGAGGAGGAGG - Intergenic
956948236 3:74249266-74249288 TGCTGACGCCTGGGAGGCGGAGG - Intergenic
957554634 3:81750762-81750784 CGCTTGGACCGGGGAGGAGGAGG - Intronic
960132804 3:114075590-114075612 CGCTTGAGCCGAGGAGGAGGAGG - Intronic
961208549 3:125107592-125107614 CGCTGCCTCCTGGGAGGGGCAGG - Exonic
962164977 3:133038777-133038799 GGCTGGGGCCGAGGAGGAGGTGG + Intronic
962520748 3:136195853-136195875 CGCCGCCGGCGGGCGGGAGGGGG + Intronic
962534836 3:136318258-136318280 TGCTTGAGCCGGGGAGGAGGAGG + Intronic
965427552 3:168546326-168546348 CGCTTCAGCCAGGGAGGTGGAGG - Intergenic
965606815 3:170505802-170505824 CGCTGCAACCTGGGAGGTGGAGG + Intronic
967034107 3:185634833-185634855 CGCTTCAGCCCGGGAGGCGGAGG + Intergenic
967184709 3:186934476-186934498 CGCTGGAGCCTGGGAGGTGGAGG + Intronic
967232469 3:187353212-187353234 CGCTGCCTCCAGGGCTGAGGTGG + Intergenic
967858277 3:194134355-194134377 GGCGGGCGCCCGGGAGGAGGCGG - Intergenic
967904097 3:194486786-194486808 CGCCGCGGGCGCGGAGGAGGAGG - Intronic
967904099 3:194486789-194486811 CGCCGCCGCGGGCGCGGAGGAGG - Intronic
968324173 3:197797774-197797796 CGCTTGTGCCGGGGAGGTGGAGG + Intronic
968653215 4:1767993-1768015 CGCTGGCTGCCGGGAGGAGGCGG - Intergenic
968671778 4:1855989-1856011 CGCGGCCGCCGCGGAGAAGGAGG - Exonic
968701148 4:2058922-2058944 GGCGGCCGCGGAGGAGGAGGAGG + Intergenic
968705916 4:2077438-2077460 GGCTGCCCCCAGGGAGGGGGAGG + Intronic
969328160 4:6455895-6455917 CGTTGCAGCCTGGGAGCAGGTGG - Intronic
969685988 4:8674598-8674620 CGGTGTGGCCGGGGAGGTGGTGG - Intergenic
970202895 4:13627526-13627548 GGCTGCGGCGGGGGAGGCGGCGG + Exonic
970324534 4:14909751-14909773 GGTGGCCGCCGGGGAGGAGTAGG - Intergenic
970421031 4:15905973-15905995 GGCTGGAGCAGGGGAGGAGGTGG + Intergenic
971457931 4:26861319-26861341 CGCCGCGGCGGGAGAGGAGGCGG - Exonic
972288432 4:37669339-37669361 CGCTCCCTCCGGGAGGGAGGTGG + Intronic
975701935 4:77075489-77075511 CTCTGCCGGGGAGGAGGAGGAGG - Exonic
976380485 4:84393100-84393122 CACTGCCTCCAGAGAGGAGGAGG + Intergenic
976389706 4:84496345-84496367 CGCTGCAGCCGAGGGGGAGAGGG + Intronic
976600826 4:86935765-86935787 CGTAGCCTCCGGGGAGGAGTTGG + Intronic
977176886 4:93829202-93829224 CGCTGCGCCCCGGGACGAGGTGG + Exonic
977582600 4:98742159-98742181 CGCTGGAACCCGGGAGGAGGAGG - Intergenic
977636666 4:99306087-99306109 CGCTGGAGCCTGGGAGGCGGAGG - Exonic
979205557 4:118033596-118033618 GGCTCCCGCCCGGGAGGCGGTGG + Intronic
979215374 4:118157504-118157526 CGCTGCTACCTGGGAGGCGGAGG - Intronic
979577922 4:122317246-122317268 CGCTTGAGCCCGGGAGGAGGAGG + Intronic
979908059 4:126322635-126322657 CGCTTCAGCCCGGGAGGCGGAGG - Intergenic
980920856 4:139084241-139084263 AGCGGCGGCAGGGGAGGAGGCGG + Intronic
982380573 4:154743873-154743895 CGCTAGCGGCGGGGAGGACGCGG - Intronic
982822262 4:159955896-159955918 AGCTGCAGCCGGGTAGGGGGAGG - Intergenic
984216773 4:176923004-176923026 CGCTTCCACCCGGGAGGTGGAGG - Intergenic
984462828 4:180058562-180058584 GGCTGCTGCCGGGGAGAAGCGGG - Intergenic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
986171701 5:5319664-5319686 CTCGGCCGCTGGGGAGGAGGAGG - Exonic
986249638 5:6044500-6044522 GGGAGCCGCAGGGGAGGAGGTGG + Intergenic
986758433 5:10858381-10858403 CCCTGCCGCAGGAGAGGATGTGG - Intergenic
988191722 5:27945708-27945730 CGCTTGAGCCGGGGAGGTGGAGG + Intergenic
988577912 5:32444522-32444544 GGCAGGCTCCGGGGAGGAGGCGG - Intronic
988586093 5:32508751-32508773 CGCTTGAACCGGGGAGGAGGAGG + Intergenic
988796310 5:34656334-34656356 CCCCGCAGCGGGGGAGGAGGAGG + Intronic
989584733 5:43066011-43066033 CGCTTCAGCCCGGGAGGCGGAGG + Intronic
990254974 5:53958124-53958146 CGCTTGAGCCTGGGAGGAGGAGG + Intronic
993170511 5:84413170-84413192 CGCTTCAGCCTGGGAGGCGGAGG + Intergenic
993214475 5:85002093-85002115 CGCTTGCACCTGGGAGGAGGAGG - Intergenic
995037969 5:107556660-107556682 CGCTTCAACCGGGGAGGCGGGGG + Intronic
995052714 5:107724699-107724721 CGATGACGCGCGGGAGGAGGAGG + Intergenic
995890757 5:116948005-116948027 GTCTATCGCCGGGGAGGAGGTGG - Intergenic
996558194 5:124800258-124800280 CGCTTCAGCCTGGGAGGCGGAGG + Intergenic
997505229 5:134411815-134411837 GGCTGCCGCAGTGGAGGAGCTGG - Exonic
997653008 5:135536026-135536048 GGCTGCCGCGGGGGCGGAGGTGG - Intergenic
998109745 5:139492120-139492142 CGCTGCAACCCGGGAGGCGGAGG + Intergenic
998435906 5:142108766-142108788 CGCGGCCCCTGGGGAAGAGGCGG - Exonic
999322617 5:150624750-150624772 CGGTGGCGGCGGCGAGGAGGGGG + Intronic
999322688 5:150624982-150625004 CGGCGCCGCCCAGGAGGAGGTGG + Intronic
1001659905 5:173383614-173383636 TGCTGGCTCCTGGGAGGAGGTGG + Intergenic
1002600820 5:180353166-180353188 CGCGGACGGCGTGGAGGAGGCGG + Intronic
1002914109 6:1515340-1515362 AGCGGCGGCAGGGGAGGAGGTGG + Intergenic
1002914121 6:1515407-1515429 AGCGGCGGCAGGGGAGGAGGTGG + Intergenic
1003234274 6:4281942-4281964 GACTGCCGCGGGGGAGCAGGTGG - Intergenic
1003871159 6:10404432-10404454 CGCTTGCGCCGGGGCGGTGGCGG - Intronic
1004618941 6:17316445-17316467 CGCTGCAACCCGGGAGGTGGAGG - Intergenic
1004910354 6:20277184-20277206 CGCTTGAACCGGGGAGGAGGAGG - Intergenic
1005063489 6:21797304-21797326 CGCTCCCTCCGGGCGGGAGGTGG - Intergenic
1005303775 6:24495062-24495084 CGCCGGCGCGGGGGCGGAGGCGG - Exonic
1005578800 6:27214268-27214290 CGCTTGAGCCGGGGAGGCGGAGG - Intergenic
1006033263 6:31193211-31193233 CGCTGGAGCCCGGGAGGTGGAGG - Intergenic
1006642874 6:35497540-35497562 CGCAGCCGCCAGGGCGGAGCCGG - Intergenic
1007533550 6:42564290-42564312 CGGTAGCGCTGGGGAGGAGGAGG + Exonic
1007785234 6:44276027-44276049 CGCTGCGGCGGGGCAGGCGGCGG + Exonic
1007902044 6:45422026-45422048 GGCGGCCGCCGCGGAGGCGGCGG + Intronic
1009437624 6:63636071-63636093 CGCCGCCGAAGAGGAGGAGGAGG - Exonic
1009437626 6:63636074-63636096 TGCCGCCGCCGAAGAGGAGGAGG - Exonic
1009437627 6:63636077-63636099 CGCTGCCGCCGCCGAAGAGGAGG - Exonic
1010229438 6:73521615-73521637 CGCGGAAGCCGGGGCGGAGGAGG - Intronic
1011517130 6:88166586-88166608 CGCGGCGGCGGAGGAGGAGGAGG - Intergenic
1013507592 6:110815339-110815361 CGCCGTCGCGGAGGAGGAGGAGG - Intronic
1013507594 6:110815342-110815364 CGCCGCCGTCGCGGAGGAGGAGG - Intronic
1013507596 6:110815345-110815367 CGCCGCCGCCGTCGCGGAGGAGG - Intronic
1013596826 6:111668097-111668119 TGCTGGCGCTGGGAAGGAGGAGG + Intronic
1013619422 6:111873333-111873355 GGCTGCCGCGGGCGAGGAGGAGG - Exonic
1016648159 6:146434251-146434273 TGCTGCTGCTGGAGAGGAGGGGG - Exonic
1016658087 6:146543784-146543806 CGCGGCCGCCGGGGGCGCGGCGG + Exonic
1016923498 6:149317972-149317994 GGCGGCGGCCGAGGAGGAGGAGG + Intronic
1016936981 6:149454904-149454926 CCCTGCAGCCGTGGAGGTGGAGG - Intronic
1016947290 6:149546573-149546595 CGCTGGAGCCCGGGAGGTGGAGG - Intergenic
1017100207 6:150842795-150842817 CGCTGGAACCGGGGAGGTGGAGG - Exonic
1017117588 6:150993402-150993424 CGCTTGAGCCTGGGAGGAGGAGG - Intronic
1017672067 6:156778039-156778061 TGCCGCCGCGGAGGAGGAGGAGG - Exonic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1018229050 6:161657930-161657952 CGCTGGAACCCGGGAGGAGGAGG + Intronic
1018890106 6:167976993-167977015 CGATGCCGGCGGGGAGCGGGCGG + Intergenic
1019262393 7:88764-88786 GGCTGCAGCCGCGGAGGTGGGGG - Intergenic
1019390275 7:782915-782937 TGATGCCGCCGGAGGGGAGGTGG - Intronic
1019531172 7:1504202-1504224 CGCGGACGCCGGGCTGGAGGCGG + Intronic
1019564352 7:1672049-1672071 TGCTGCGGCCGAGGAGGAGGGGG - Intergenic
1019568237 7:1695302-1695324 AGCTGCAGCCCTGGAGGAGGAGG - Intronic
1021821401 7:24501085-24501107 CACTGCAGCCTGGCAGGAGGTGG + Intergenic
1022109608 7:27220426-27220448 CACTCACCCCGGGGAGGAGGGGG - Intergenic
1022427781 7:30284946-30284968 AGCGGCCGCCCGAGAGGAGGCGG + Exonic
1022697866 7:32728165-32728187 AGCGGCCGCCGGAGAGGAGGCGG + Intergenic
1023340506 7:39214329-39214351 TGCTGGGGCAGGGGAGGAGGAGG - Intronic
1023417972 7:39950143-39950165 CGTCGACGCCGAGGAGGAGGCGG + Exonic
1023842260 7:44104282-44104304 CCCCACCCCCGGGGAGGAGGAGG - Intergenic
1024533188 7:50409896-50409918 GCCTGCGGCCAGGGAGGAGGGGG - Intergenic
1025615707 7:63114421-63114443 CGCTGCCGCGGCGGCGGCGGCGG + Intergenic
1026949589 7:74338478-74338500 AGCTGCGGCCGGGGAGGAGGAGG - Exonic
1027001429 7:74657389-74657411 CGCGGCCGCCCGGGTGGGGGAGG - Intergenic
1027134882 7:75617156-75617178 CGCTTGAGCCGGGGAGGCGGAGG - Intronic
1028121435 7:87059758-87059780 CGCTGGAGCTGGGGAGCAGGTGG + Intergenic
1028194427 7:87889361-87889383 CGCTTGAGCCCGGGAGGAGGAGG - Intronic
1029440877 7:100586052-100586074 CGCCGCCGGGGGTGAGGAGGCGG - Exonic
1030624676 7:111831566-111831588 CGCTTCAGCCAGGGAGGTGGAGG - Intronic
1030739045 7:113086518-113086540 CGCTGCGACAGGGGAGGACGCGG - Intronic
1031469035 7:122147116-122147138 CGCTTGCACCCGGGAGGAGGAGG + Intergenic
1032045676 7:128605524-128605546 CGCTTCAGCCTGGGAGGTGGAGG - Intergenic
1032174351 7:129611689-129611711 CGCCGCCGCCGAGGAGGGGGAGG - Intergenic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1034401413 7:150864041-150864063 CGGGGCCTCAGGGGAGGAGGGGG - Intergenic
1034470512 7:151252033-151252055 CGCGGCGGCCGGGGAGGCGGCGG + Intronic
1034999632 7:155602667-155602689 CGCTTGCACCCGGGAGGAGGAGG + Intergenic
1035238881 7:157517396-157517418 AGCTGCCGACAGGGAGAAGGCGG + Intergenic
1035341621 7:158166299-158166321 CGCGGCGGCCGGGGGGGAGGAGG - Intronic
1037487776 8:19364587-19364609 GGCTGCCTCTGGGGGGGAGGGGG - Intronic
1037928882 8:22865640-22865662 GGATGCTGCCCGGGAGGAGGAGG + Intronic
1038003509 8:23410518-23410540 CGCTGCTTCCTCGGAGGAGGCGG - Intronic
1038632940 8:29262940-29262962 CTGGGCCGCCGGGGCGGAGGCGG - Intronic
1038828551 8:31033181-31033203 GGCGGCGGCGGGGGAGGAGGCGG - Exonic
1038949263 8:32396530-32396552 CGCTTCAGCCTGGGAGGTGGAGG - Intronic
1039595600 8:38787654-38787676 CGGGGCCGCCGGCGAGGACGAGG + Exonic
1039868795 8:41528672-41528694 CGCTGGAGCCCGGGAGGCGGAGG + Intergenic
1039926028 8:41933121-41933143 GGCTGCTGCTGGGGAGGGGGTGG + Exonic
1040039147 8:42897920-42897942 CGGCGCGGCCGGGGAGGGGGAGG + Intronic
1040065599 8:43141303-43141325 CGCCGCCGCCTGGGAGGGGCCGG + Intronic
1041533208 8:58895102-58895124 CGCTTCAACCGGGGAGGGGGAGG + Intronic
1041906445 8:63038617-63038639 CGCAGCAGACGGGGAGGAGCTGG - Intronic
1042040198 8:64581351-64581373 CGCTGGCGCCGCCGTGGAGGTGG - Exonic
1042750656 8:72154269-72154291 AGCTGGGGCCAGGGAGGAGGAGG - Intergenic
1044660683 8:94590931-94590953 CCGTGCCGTCCGGGAGGAGGTGG + Intergenic
1044700474 8:94961503-94961525 CGCTGGAGCCCGGGAGGCGGAGG - Intronic
1044707972 8:95026382-95026404 CGCTTCAGCCTGGGAGGTGGAGG + Intronic
1045287491 8:100804474-100804496 TCCTGCCTCCTGGGAGGAGGTGG - Intergenic
1046103905 8:109644691-109644713 CGCTGCCGCCGTCCAGGAGGAGG + Exonic
1046296726 8:112229510-112229532 CGCTTGAGCCGGGGAGGTGGAGG - Intronic
1047205756 8:122802145-122802167 CGCTGGAACCGGGGAGGTGGAGG - Intronic
1047998401 8:130357958-130357980 CGCTGCCGCCGCGCAGCTGGAGG - Intronic
1048979242 8:139694303-139694325 AGCTGCCTCCTGGGTGGAGGAGG + Intronic
1049218425 8:141418067-141418089 CAGCCCCGCCGGGGAGGAGGTGG + Intronic
1049569097 8:143360021-143360043 CGGTGCTGCCGGGAAGGGGGCGG + Intergenic
1049585387 8:143430479-143430501 CGCCGCCCGCGGGGAGCAGGGGG - Intergenic
1049788488 8:144462534-144462556 GGCGGCCGCCGGGCAGGCGGCGG - Intronic
1049798963 8:144509048-144509070 CGCGGCCGCAGGGAAGGGGGCGG - Intergenic
1049877684 8:145036297-145036319 CGCTTCAGCCTGGGAGGTGGAGG - Intergenic
1050472388 9:6007445-6007467 CGTTGCCACCGCGGAGGAGGAGG - Exonic
1051587332 9:18740558-18740580 CGCTGGAACCGGGGAGGTGGAGG - Intronic
1053338779 9:37303745-37303767 CGCTTGCGCCTGGGAGGCGGAGG - Intronic
1053892715 9:42710813-42710835 CGCTGCTGCTGGGGTGGGGGTGG + Intergenic
1056241786 9:84655116-84655138 CGCTTGAGCCTGGGAGGAGGAGG - Intergenic
1056787913 9:89605823-89605845 CGTGGGCGCCGGCGAGGAGGCGG + Exonic
1058591973 9:106574930-106574952 CGCTTGAGCCTGGGAGGAGGAGG + Intergenic
1059062688 9:111050064-111050086 CGCTGGAGCCCGGGAGGTGGAGG + Intergenic
1059234491 9:112750680-112750702 CGCGGCCGCCCGGGAGGGGGCGG - Intergenic
1059392559 9:114008323-114008345 CACTGCGCCCGGGCAGGAGGCGG - Exonic
1059423994 9:114209549-114209571 CACTGCCACCAGGGAGGAAGAGG + Intronic
1059438809 9:114291251-114291273 CAGTGCCGCGTGGGAGGAGGGGG + Intronic
1059510896 9:114845554-114845576 CGCTGCCGCTGTGGTGGTGGTGG - Intergenic
1060662460 9:125412296-125412318 CTCTGCCCACAGGGAGGAGGTGG + Intergenic
1061056609 9:128226014-128226036 TCCTGCACCCGGGGAGGAGGTGG - Intronic
1061248480 9:129413571-129413593 CGTGGGCACCGGGGAGGAGGGGG + Intergenic
1061419012 9:130463324-130463346 CACTGATGCCGAGGAGGAGGAGG - Intronic
1061429894 9:130524192-130524214 CCCTGCCTCAGGGGAGAAGGAGG + Intergenic
1061522379 9:131126629-131126651 CGCTTGAGCCGGGGAGGTGGAGG - Intronic
1061559699 9:131394418-131394440 CGCGCCCGGCGGGAAGGAGGCGG - Intronic
1061623115 9:131824421-131824443 CGCTGCCTTCTGGGAGGAGCTGG + Intergenic
1061858634 9:133456647-133456669 CGCTGCGGGCGGCCAGGAGGTGG + Exonic
1061975335 9:134065589-134065611 CGTTGCTGCCTGGGAGGTGGGGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062134017 9:134915231-134915253 CGCTGCTGCCAGGGAGGATCCGG + Intronic
1062174397 9:135152982-135153004 GGCTGCCGATGGGGTGGAGGCGG + Intergenic
1062324957 9:136008363-136008385 AGCTGCCGCCTGGCAGGTGGTGG - Exonic
1062383370 9:136298356-136298378 CTCTGCCGATGGGGAGGAGATGG + Intronic
1062676968 9:137752363-137752385 CGTGGACACCGGGGAGGAGGAGG + Exonic
1203469196 Un_GL000220v1:108783-108805 CGCGCCCGCCCGCGAGGAGGCGG - Intergenic
1203470562 Un_GL000220v1:113918-113940 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1203477017 Un_GL000220v1:152755-152777 CGCGCCCGCCCGCGAGGAGGCGG - Intergenic
1203478383 Un_GL000220v1:157890-157912 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1185513858 X:683658-683680 TGTTTCCTCCGGGGAGGAGGTGG + Intergenic
1186087848 X:6010610-6010632 CGCTGGAGCCTGGGAGGCGGAGG - Intronic
1186192298 X:7077442-7077464 CTCCGCCCCTGGGGAGGAGGAGG + Exonic
1186638130 X:11427754-11427776 CGCTGCCGCTGCGGAGCCGGTGG + Intronic
1187334499 X:18370397-18370419 CGCTTGAGCCTGGGAGGAGGAGG + Intergenic
1187752725 X:22485220-22485242 CGCTTGAACCGGGGAGGAGGAGG + Intergenic
1187909925 X:24102180-24102202 CGCTTCAGCCTGGGAGGTGGAGG - Intergenic
1188270776 X:28137838-28137860 CGCTTCAACCTGGGAGGAGGAGG - Intergenic
1189308615 X:40005452-40005474 CGCTGCCGCCGGGAAAGTGCCGG + Intergenic
1190008041 X:46758886-46758908 CGCCGCCGCCCCAGAGGAGGAGG + Exonic
1193819819 X:86148313-86148335 GGCTGCCGCTGGTGAGGAGGTGG - Intergenic
1196031114 X:111096442-111096464 GGCTACCGCGGGGGAGGGGGTGG + Intronic
1198055787 X:132993478-132993500 CGCTTGAGCCTGGGAGGAGGAGG - Intergenic
1198872876 X:141194176-141194198 AGCAGCCACCGGGGTGGAGGGGG + Intergenic
1200100655 X:153687995-153688017 CGCCGCCGCCGGGAAGGAGAGGG + Intronic
1200111557 X:153743385-153743407 GGCTGCCTGAGGGGAGGAGGTGG + Intronic
1200216591 X:154370768-154370790 CGCTGCGGCCCGGAAGGGGGTGG + Intronic
1201063507 Y:10068962-10068984 GGCGGCCTTCGGGGAGGAGGTGG - Intergenic