ID: 1139459495

View in Genome Browser
Species Human (GRCh38)
Location 16:67110327-67110349
Sequence AGGTGAGGAGCTGCGGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 396}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139459495_1139459502 1 Left 1139459495 16:67110327-67110349 CCTGCGCCCGCAGCTCCTCACCT 0: 1
1: 0
2: 2
3: 39
4: 396
Right 1139459502 16:67110351-67110373 TTTCGTCCTCTCGGCTCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 41
1139459495_1139459501 0 Left 1139459495 16:67110327-67110349 CCTGCGCCCGCAGCTCCTCACCT 0: 1
1: 0
2: 2
3: 39
4: 396
Right 1139459501 16:67110350-67110372 CTTTCGTCCTCTCGGCTCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 33
1139459495_1139459499 -8 Left 1139459495 16:67110327-67110349 CCTGCGCCCGCAGCTCCTCACCT 0: 1
1: 0
2: 2
3: 39
4: 396
Right 1139459499 16:67110342-67110364 CCTCACCTCTTTCGTCCTCTCGG 0: 1
1: 0
2: 1
3: 14
4: 194
1139459495_1139459504 8 Left 1139459495 16:67110327-67110349 CCTGCGCCCGCAGCTCCTCACCT 0: 1
1: 0
2: 2
3: 39
4: 396
Right 1139459504 16:67110358-67110380 CTCTCGGCTCGCTGGGCTCCAGG 0: 1
1: 0
2: 2
3: 15
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139459495 Original CRISPR AGGTGAGGAGCTGCGGGCGC AGG (reversed) Intronic
900244498 1:1631011-1631033 GGGTGACGAGCTGGGGGGGCGGG + Intergenic
901400919 1:9014725-9014747 TGGAGAGGAGCTGCCAGCGCAGG + Exonic
902747064 1:18481347-18481369 AGGTGAGGAGCGGGGCGGGCAGG + Exonic
903602609 1:24553696-24553718 AGGTGAGGAGGGGCTGGAGCTGG - Intergenic
903738350 1:25544157-25544179 AGGGGAGGAGGAGAGGGCGCAGG + Intronic
903846600 1:26282824-26282846 AGGTGAGGGCCTGGGGGCGTTGG - Intronic
904337865 1:29809845-29809867 AGGTGAGGAGGTGGGGGCTCAGG + Intergenic
904445946 1:30572997-30573019 GGGTGAGGAGCTGTGTGCTCTGG + Intergenic
904462056 1:30686090-30686112 AGGTGAGGAGGTGGGGGCTCAGG - Intergenic
904576172 1:31506405-31506427 AGGTGAGCTGGTACGGGCGCTGG + Intergenic
904872969 1:33633443-33633465 AGCTGAGGAGCCGCGAGTGCTGG + Exonic
905267224 1:36762889-36762911 AGGGGAGGAGCGGAGGGCCCGGG + Intergenic
906209095 1:44002435-44002457 GGGTGAGGAGCTGTGGGCAGAGG + Intronic
906214100 1:44029335-44029357 AGTGGAGGAGCTGTGGGAGCAGG + Intronic
906326623 1:44850236-44850258 AGGTGAGGTGCAGCGGGGTCTGG + Intergenic
906805759 1:48777419-48777441 GGGTGCGGGGCTGGGGGCGCGGG - Intronic
907118539 1:51990070-51990092 AGGTGAGGAGCTGAGGGGAGGGG - Intronic
907571415 1:55487544-55487566 ATGTGAGGAGCTGCAGGCCAAGG - Intergenic
907849017 1:58236121-58236143 AGGTGAGGAGGAGTGGGGGCGGG - Intronic
907880617 1:58546493-58546515 AGGGGAGGGGCGGGGGGCGCCGG - Intronic
908897506 1:68916937-68916959 AGGTGAGGAGCTGTGGATGAGGG - Intergenic
908901223 1:68958636-68958658 AGGTGTTGAGCTGAGGGCGTTGG + Intergenic
910860068 1:91734447-91734469 AGGTGAGAAGCTGAGGGTGTGGG - Intronic
911205655 1:95089679-95089701 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
912514554 1:110210039-110210061 GTGGGAGGAGCTGCGGGCCCGGG + Intergenic
913010625 1:114679671-114679693 AGGAGAGGAACTTCAGGCGCCGG + Exonic
914676194 1:149909171-149909193 AGGTGAGGAGATGGGTGGGCTGG - Exonic
915513651 1:156400668-156400690 AGGCGAGGTGCGGGGGGCGCGGG + Intergenic
916510695 1:165470092-165470114 GGGAGAGGAGCTGCAGGGGCTGG - Intergenic
917737240 1:177932515-177932537 GGGGGAGCAGCTGCGGGCGCTGG - Exonic
920313320 1:205061171-205061193 GTATGAGGAGCTGCGGGCACTGG + Intronic
920575039 1:207053206-207053228 AGGTGAGGACCTACGCGCGAGGG + Intronic
920921156 1:210298344-210298366 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
922809914 1:228409593-228409615 AGGTGAGGCACTGGGGGCTCTGG - Intronic
922823817 1:228503326-228503348 AGGTGAGGAGATGGAGGCTCAGG + Intergenic
923537655 1:234865323-234865345 AGGTGAGTAGCTGCAGGCCAGGG + Intergenic
924503022 1:244653740-244653762 AGCAGAGGAGCTGGGAGCGCAGG - Intronic
924763117 1:247007621-247007643 AGACGCGGCGCTGCGGGCGCGGG + Intronic
924776127 1:247115324-247115346 AGGTGAGGAGCAGCCAGCCCGGG + Intergenic
924778405 1:247126827-247126849 AGCCGCGGGGCTGCGGGCGCGGG - Intronic
924783253 1:247171593-247171615 AGCCGCGGGGCTGCGGGCGCGGG + Intronic
1063629861 10:7723284-7723306 AGGAGAGGAGGTGGGGGAGCAGG + Intronic
1064724185 10:18260744-18260766 AGGCGAGCAGCCGCGGGAGCAGG + Intronic
1065754536 10:28919139-28919161 AGGTGAGGGGCTGTGTGTGCAGG - Intergenic
1066370420 10:34814855-34814877 AGGTGAGGGGCCGGGGGCGCGGG - Exonic
1066746161 10:38605177-38605199 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1068778787 10:60897452-60897474 AGCTGAGGAGCTGTGGGCCTTGG + Intronic
1069248597 10:66241637-66241659 ACGTGAGGAGGTGGGGGGGCTGG - Intronic
1069683072 10:70299140-70299162 AGGTGAGGACCTGGGGCAGCAGG + Exonic
1069962711 10:72087904-72087926 AGGTGTGGAGCTGGGGGTCCCGG + Intronic
1070327016 10:75396071-75396093 AGGTCCTGAGCTGCGGGCACCGG + Intergenic
1071530955 10:86389988-86390010 CAGGGAGGAGCTGCGGGCTCAGG + Intergenic
1071960438 10:90804507-90804529 AGGTGAGCAGGTGCAGGAGCTGG - Intronic
1072537976 10:96377693-96377715 AGGTGAGGAGGGCCGGGGGCAGG + Intronic
1072564938 10:96609691-96609713 AAGTGAGCAGCTGGGGGTGCGGG - Exonic
1074382571 10:112992417-112992439 AGGTGAGAATCTGTGGGCGTTGG + Intronic
1074500329 10:114017885-114017907 AGGTGAGGAGCATCTGGCTCGGG - Intergenic
1075187854 10:120278873-120278895 AGGTGGGAAGCTGGGGGAGCAGG + Intergenic
1076608135 10:131702598-131702620 AGGGCAGGTGCAGCGGGCGCTGG + Intergenic
1076880629 10:133237673-133237695 AGGGGCGGGGCTGCGGGCCCTGG - Exonic
1077484844 11:2833933-2833955 GGGTGAGGAGGTGGGGGAGCAGG - Intronic
1081644308 11:44779038-44779060 AAGTGAGGAGCTGTGGCCACTGG + Intronic
1081818228 11:45965532-45965554 AGCTGAGGAGCTGCGAGCATGGG + Exonic
1083777384 11:64900863-64900885 AGGTGAGGAGGAGCGGGTGCAGG - Exonic
1083896201 11:65620965-65620987 AGGTGAGGAGCAGCCGGGGAAGG + Exonic
1084358507 11:68654511-68654533 AGTTGAGGGGCTGTGGGGGCTGG - Intergenic
1084542949 11:69798610-69798632 ATGGGAGGAGCTGAGGGCCCAGG + Intergenic
1084860134 11:72012842-72012864 AGATCAGGAGCTGAGAGCGCGGG - Intronic
1087896304 11:103590254-103590276 AGGTGAGCAGGTGCAGGAGCTGG - Intergenic
1088481113 11:110296818-110296840 AGGTGGGTGGCTGCGGGCTCGGG + Intergenic
1090672304 11:128957245-128957267 AGGGGAGGAGTTGCGTGCACTGG + Intergenic
1092286128 12:7130188-7130210 AGCCGAGGAACTGCGGGGGCTGG - Exonic
1093711404 12:22333969-22333991 AGGGGAGGAGCCGCGAGGGCAGG + Intronic
1096180954 12:49550053-49550075 AGGTGAGCAGGTGCGGGGGTGGG - Intronic
1096369524 12:51057382-51057404 AGGTGAGGAGCTGGGCGCAGTGG - Intronic
1096389388 12:51217448-51217470 CGGCGGGGAGCTGCGGGAGCGGG - Intronic
1096524109 12:52200554-52200576 AGGTGAGGAGCAGAGGGAGTGGG + Intergenic
1096772509 12:53945021-53945043 AGGTGAGCAGCTACCGGCGCGGG + Exonic
1097218152 12:57430512-57430534 TGGAGAGAAGCTGGGGGCGCGGG - Intronic
1098264673 12:68706485-68706507 ATATGAGGAGCTGCAGACGCTGG + Intronic
1098545552 12:71707485-71707507 AGGTGAGCAGGTGCAGGAGCCGG + Intergenic
1099413456 12:82359365-82359387 AGGTGAGGGGCTGCAGGTGCAGG + Intronic
1100611551 12:96194965-96194987 GGGAGGGGAGCCGCGGGCGCAGG - Intronic
1103433105 12:120904352-120904374 AGGGGAGGAGGGGCGGGGGCGGG + Exonic
1104087742 12:125492153-125492175 AGGTGAGGAGCGGTGGGGGCGGG - Intronic
1104444637 12:128823479-128823501 CGGTGAGCAGCAGCGGGCGGCGG + Exonic
1104554818 12:129790114-129790136 AGGTGAGCAGATGCAGGAGCTGG + Intronic
1104641788 12:130471803-130471825 AGGAGAGGAGCTCCTGACGCTGG - Intronic
1104653803 12:130557932-130557954 AGGTGAGGAACCGGGGTCGCAGG - Intronic
1104697274 12:130872499-130872521 ACGTGGGGCGCTGGGGGCGCGGG + Intronic
1104773371 12:131378651-131378673 AGGAGAGGAGGGGCCGGCGCAGG + Intergenic
1104895429 12:132161470-132161492 AGCTGAGGAGCTGAGGGAGGAGG - Intergenic
1104895451 12:132161568-132161590 TGGGGAGGAGCTGAGGGCGGAGG - Intergenic
1104981529 12:132575037-132575059 AGGCTAGGAGCTGCGGGAGCGGG + Intronic
1105817732 13:24051919-24051941 TGGTGAGGAGCTGCAGGGGTGGG - Intronic
1106041234 13:26095970-26095992 AGGTGAGGAGTTGCTTGGGCAGG - Intergenic
1106483667 13:30155073-30155095 TGGCGAGGACCTGCGGGAGCTGG - Intergenic
1108029250 13:46211860-46211882 AGGCGAGGCGAGGCGGGCGCCGG - Intronic
1108339747 13:49486881-49486903 AGGTGGAGAGCTGCGGTTGCAGG - Intronic
1113628482 13:111864007-111864029 AGGTGAGGGGCTTCTGGCCCAGG - Intergenic
1113876677 13:113598842-113598864 AGGTGATGAGCTGCAGGCGAGGG - Intronic
1113970023 13:114181527-114181549 GGGTGAGGAGCAGCCGGGGCTGG + Intergenic
1114557330 14:23569636-23569658 AGGTGAGGAGCTGGGAGAACAGG + Exonic
1115203118 14:30874590-30874612 AGGTGCGGAGCCCCGGGCGGCGG + Exonic
1116864189 14:50018074-50018096 CATTGAGGAGCTGAGGGCGCTGG + Intergenic
1117377429 14:55129247-55129269 CGAGGAGGTGCTGCGGGCGCCGG - Exonic
1117478418 14:56119109-56119131 ATGTGAGGCGCCGCGGTCGCGGG + Intronic
1118400308 14:65373572-65373594 AGGTGAGCAGATGCAGGAGCCGG - Intergenic
1120599618 14:86485658-86485680 AGGAGAGGAGCTGCTGCTGCAGG - Intergenic
1121577858 14:95002972-95002994 AGGTGAGGAGGTGCTGTCTCCGG - Intergenic
1122146368 14:99691276-99691298 AGGGGAGGAACTGCTGGGGCTGG - Intronic
1122436846 14:101706412-101706434 GAGTGAGAAGCTGCTGGCGCCGG + Intergenic
1122641758 14:103164167-103164189 AGGTGAGCAGGTGCAGGAGCCGG - Intergenic
1122770101 14:104094007-104094029 GGGTGAGGAGCTGCAGGGTCTGG + Intronic
1122823559 14:104359073-104359095 AGGAGGGGAGCTGGGGGCACAGG - Intergenic
1122904476 14:104795533-104795555 GGATGCGGAGCGGCGGGCGCCGG - Intronic
1123049858 14:105535967-105535989 AGGTGGGGAGCTGGGCGCGGTGG - Intergenic
1123469002 15:20536321-20536343 AGGTGAGCAGCTGCAGCCCCGGG - Exonic
1123649056 15:22464370-22464392 AGGTGAGCAGCTGCAGCCCCGGG + Exonic
1123695095 15:22873431-22873453 AGGGGAGGAGCTGTGGGGGAGGG - Intronic
1123729278 15:23131309-23131331 AGGTGAGCAGCTGCAGCCCCGGG - Exonic
1123747446 15:23328791-23328813 AGGTGAGCAGCTGCAGCCCCGGG - Intergenic
1124150857 15:27176802-27176824 GGGTGGGGAGCTGAGGGAGCTGG + Intronic
1124279807 15:28352643-28352665 AGGTGAGCAGCTGCAGCCCCGGG - Intergenic
1124302891 15:28558961-28558983 AGGTGAGCAGCTGCAGCCCCGGG + Intergenic
1126212164 15:46111857-46111879 AGGTGAGCAGGTGCAGGAGCTGG - Intergenic
1127551714 15:60045043-60045065 AGCTGAGGAGCACCGGGGGCTGG - Intronic
1129150603 15:73685196-73685218 TGGAGAGGAGATGCGGGCGACGG + Intronic
1129190971 15:73937445-73937467 TGGGGAGGAGCTGCGTGCGAGGG - Intronic
1129851706 15:78797429-78797451 AGGTGAGGAGCTGCCTGCTAAGG - Intronic
1130420853 15:83745562-83745584 AGGTGAGCAGGTGCAGGAGCCGG - Intronic
1131095679 15:89653031-89653053 AGGTCAGGAGCTGCAGGATCTGG - Intronic
1131119715 15:89814735-89814757 AGGGCGGGGGCTGCGGGCGCGGG - Intronic
1132584786 16:701389-701411 GTGTGAGGAGCAGCGGGGGCCGG - Intronic
1132649518 16:1014214-1014236 AGGAGGGGGGCTGCAGGCGCTGG - Intergenic
1132735798 16:1385281-1385303 GGGGGAGGAGCTGCCGGAGCCGG + Intronic
1132884891 16:2178332-2178354 TGGGGAGGACCCGCGGGCGCAGG + Exonic
1132897754 16:2237014-2237036 TGGGGAGGAGCGGCGGGTGCGGG - Intronic
1134057527 16:11180002-11180024 AGGTGAGGGGCCGCTGGCCCTGG - Exonic
1136382248 16:29901097-29901119 AGGTGGGGAGCTGGGGGGACAGG + Exonic
1136515383 16:30765058-30765080 AGGTGAGGAGCCGGGGGCTTTGG + Exonic
1136632896 16:31499472-31499494 AGGTGAGGAGGGGCGGGGACGGG - Exonic
1136736899 16:32474464-32474486 AGGTGAGGGGCCGAGGGGGCGGG + Intergenic
1136822223 16:33329524-33329546 AGGCGGGGAGCTCGGGGCGCGGG - Intergenic
1136828786 16:33386063-33386085 AGGCGGGGAGCTCGGGGCGCGGG - Intergenic
1136833852 16:33484845-33484867 AGGCGGGGAGCTCGGGGCGCGGG - Intergenic
1137700637 16:50495475-50495497 AGAAGAGGAGCTGAGGGTGCAGG + Intergenic
1137988682 16:53131150-53131172 TGGTGGGGAGATGCGGGGGCGGG + Intronic
1138730782 16:59192523-59192545 AGGTGTTAAGCTGCAGGCGCTGG + Intergenic
1139459495 16:67110327-67110349 AGGTGAGGAGCTGCGGGCGCAGG - Intronic
1139477106 16:67208291-67208313 AGGTGTGGGGCTGGGGGTGCGGG - Exonic
1140196236 16:72857974-72857996 GGCTGAGGAGCAGCGGGCCCTGG - Intronic
1140753754 16:78049020-78049042 GTATGAGGAGCTGCAGGCGCTGG - Intronic
1141538398 16:84699713-84699735 AGGTGAGGAGCCGGGCCCGCCGG + Intergenic
1141695071 16:85615213-85615235 AGGTGAGGGGCCCAGGGCGCAGG + Intronic
1142173284 16:88633917-88633939 GGGGGAGGAGCTGCGGGCAGAGG - Intergenic
1203011064 16_KI270728v1_random:239675-239697 AGGCGGGGAGCTCGGGGCGCGGG + Intergenic
1203016170 16_KI270728v1_random:355113-355135 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1203034505 16_KI270728v1_random:628271-628293 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1142485775 17:246956-246978 AGGTGTGGAGCTGAGGGCACAGG + Intronic
1142894317 17:2964277-2964299 GGGAGAGGAGCTGCGGGGGGTGG + Intronic
1143512838 17:7405478-7405500 GGGTGAGGCGCTGCGGGCGGGGG + Intronic
1143626078 17:8110759-8110781 AGGTGAGGAGGAGAGGACGCTGG - Intronic
1144032696 17:11336499-11336521 AGGTGAGGAGCTGCAGCAGGAGG - Intronic
1144046864 17:11461781-11461803 AGGTGGGGAGCTGTGGGCTCTGG + Intronic
1144649521 17:16998362-16998384 AGGTGAGCAGCAGAGGGGGCTGG - Intergenic
1144892126 17:18500210-18500232 AGCTCAGGAGCTGCAGGCTCAGG + Intergenic
1145140090 17:20444078-20444100 AGCTCAGGAGCTGCAGGCTCAGG - Intergenic
1146183180 17:30709810-30709832 AGGTGAGTGTCTGCGGGCCCAGG + Intergenic
1148166926 17:45490399-45490421 TGGTGAGGGGATGCGGGCGCGGG + Intronic
1150398105 17:64836803-64836825 TGGTGAGGGGATGCGGGCGCGGG + Intergenic
1151834561 17:76574338-76574360 AGGTGAGAGACAGCGGGCGCGGG + Intronic
1151912158 17:77090700-77090722 AGGTGAAGAGCTGGGCGCGGTGG + Intronic
1152017774 17:77762992-77763014 AGGGCAGGAGCTGGGGGTGCTGG + Intergenic
1152017957 17:77764272-77764294 AGGGCAGGAGCTGGGGGTGCTGG + Intergenic
1152528504 17:80903199-80903221 AGAGGAGGAGCTGGGGGCCCTGG + Intronic
1152634888 17:81426890-81426912 GGGGGAGGAGCTGGGGCCGCTGG - Exonic
1153843691 18:9029999-9030021 AGGTGAGTGGCTGCAGGAGCCGG + Intergenic
1154208074 18:12354778-12354800 AGGAGAGGAGCTGTGGGGGGTGG - Intronic
1157529453 18:48409205-48409227 AGGTGAGCGGCTTCGCGCGCCGG - Intronic
1158309136 18:56139954-56139976 AGCCGAGGGGCTGCGGGTGCTGG - Intergenic
1158546998 18:58405250-58405272 AGATGTGGAGCTGGGGGAGCTGG + Intergenic
1158552344 18:58446657-58446679 TGGGGAGGAGCTGAGGGCTCAGG + Intergenic
1159022078 18:63151501-63151523 AGATGAGGGGCTGGGGGCGAGGG + Intronic
1159904664 18:74078483-74078505 AGGTGAGGGGCAGCTGGCCCGGG - Intronic
1160107777 18:75994380-75994402 AGGTGAGGGGCTGCAGGAGACGG - Intergenic
1160406784 18:78651797-78651819 AGGTGGGGAGCTGGGGCCGCTGG + Intergenic
1160722559 19:603966-603988 AGGTGAGGTGGGGCGGGGGCGGG + Exonic
1160765597 19:806199-806221 CTGTGAGGAGAGGCGGGCGCTGG + Intronic
1160898222 19:1412801-1412823 AGGTGTCGAGCTGCAGGCCCTGG + Intronic
1161349484 19:3784161-3784183 AGCTGGGGCGCTGCGGGAGCGGG - Exonic
1161613737 19:5258036-5258058 AGGTGAGGAGTAGCGCACGCCGG + Exonic
1161744539 19:6047648-6047670 AAGTGAGGAGCTGCGGAAACAGG + Intronic
1162298208 19:9827942-9827964 GGGTGAGGAGCTGGTGGCGTCGG + Exonic
1162550074 19:11353761-11353783 AGACAAGGAGCTGGGGGCGCTGG - Intronic
1162799574 19:13103227-13103249 AGGAGAGGAGGTGGGGGCCCAGG - Intergenic
1162975614 19:14205964-14205986 AGGTGAGTGTCTGCGGGCCCAGG - Exonic
1163598205 19:18232776-18232798 AGGGGTGGAGCTGAGGGTGCTGG - Intronic
1163849333 19:19654522-19654544 AGGTGAGGGGCTGGGGCCTCAGG - Exonic
1165065341 19:33225381-33225403 AGGTCAGGGGCTGCTGGCCCAGG - Intronic
1165067484 19:33237448-33237470 AAGTGAGGAGATGGGAGCGCTGG - Intergenic
1165101354 19:33440410-33440432 AGGTCAGGAGCAGCGAGCCCAGG - Intronic
1166811630 19:45517887-45517909 GGGTGAGGGGCGGCGGGCGCAGG - Intronic
1167018012 19:46854265-46854287 TGGTGAGGAGCTGAGGTCTCTGG - Intergenic
1167609594 19:50500808-50500830 GGAGGAGGAGCTGGGGGCGCTGG - Intergenic
1167772715 19:51530961-51530983 TGGTGAGGAGATGGGGACGCAGG + Intronic
1168651535 19:58095552-58095574 AGGAGAGGGGCTGGGGGAGCTGG - Intronic
925461975 2:4071378-4071400 AGGAGTGGAGCTGCGGGCATGGG - Intergenic
925507459 2:4584221-4584243 AAGTGAGGAGGTGGGGGAGCAGG - Intergenic
925561571 2:5201807-5201829 AGGTGAGGAACTGCAGGCTATGG + Intergenic
925865065 2:8220099-8220121 AGATGAGGAGCTGCACCCGCTGG + Intergenic
926717801 2:15938998-15939020 AGGTGAAGAGGTGGGGGCGATGG + Intergenic
927970831 2:27305658-27305680 GGGTGAGCTGCTGCAGGCGCTGG + Exonic
929501427 2:42494111-42494133 AGCCGGGGAGGTGCGGGCGCGGG - Intergenic
929611242 2:43272210-43272232 AGGGGAGGAGCGGCAGGGGCTGG + Intronic
930096544 2:47570599-47570621 GGGTAAGGAGCCGCGGGAGCCGG - Exonic
930198259 2:48530027-48530049 AGGGGAGGAGGGGCGGGGGCGGG + Intronic
931614706 2:64144245-64144267 CGCTGAGGAGCCGCGGACGCAGG + Exonic
932347072 2:71002373-71002395 AGGAGAGGAGCTGCTAGCCCAGG - Intergenic
932621828 2:73269317-73269339 AGGTGCGGCGCCGCGGGCGACGG + Exonic
932779185 2:74549348-74549370 AGGTGAGGGGCCGCGGGCGCCGG - Exonic
933701131 2:85256097-85256119 AGGGGAGGAGGGGTGGGCGCAGG + Intronic
934098182 2:88626946-88626968 AGGTGAGGGGCTGCCGACCCGGG - Exonic
934188042 2:89763585-89763607 AGGTGAGGGGCCGAGGGGGCGGG + Intergenic
934308562 2:91844369-91844391 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
935112297 2:100104747-100104769 AGGGGAGGAGGGGCGGGCGCAGG - Intronic
936079742 2:109424026-109424048 AGGGAAGGAGCTGCAGGCCCTGG + Intronic
937078254 2:119122874-119122896 AGGTCAGGAGCTGTGGGATCTGG + Intergenic
937994238 2:127680919-127680941 AGGTGAGGAGCTCTGCGCCCAGG - Intronic
938150643 2:128879589-128879611 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
938950347 2:136249385-136249407 AGCTGGGGAGCTGTGGGCACAGG + Intergenic
941819098 2:169827366-169827388 AGGGGCGGGGCTGCGGGCGGAGG + Intergenic
946432696 2:219633978-219634000 GGGTGAGGAGGGCCGGGCGCCGG + Exonic
948238976 2:236412897-236412919 AGGAGAGGAGGTGGGGGCACTGG + Intronic
948347443 2:237310840-237310862 AGGTGGGGAGCTGAGGACCCAGG - Intergenic
949026481 2:241768651-241768673 ACGTGCGGTGCTGCGGGCGAGGG + Exonic
949069866 2:242018043-242018065 AGGGGAGGTGCTGGGGACGCAGG + Intergenic
949069875 2:242018063-242018085 AGGGGAGGGGCTGGGGACGCAGG + Intergenic
949069884 2:242018083-242018105 AGGGGAGGGGCTGGGGACGCAGG + Intergenic
1171173569 20:23035344-23035366 CGCTGAAGAGCTGCGGGCACCGG - Intergenic
1171458660 20:25286375-25286397 AGGAGAGGAGCAGAGGGCACGGG - Intronic
1171473605 20:25390795-25390817 ATGTGAGGAGCGGCGGGTTCCGG - Exonic
1171519999 20:25768545-25768567 AGCTGAGGAGATGCTGGCACAGG + Intronic
1171556920 20:26087948-26087970 AGCTGAGGAGATGCTGGCACAGG - Intergenic
1173847653 20:46198179-46198201 AGGTGAGGAGCTGAGAGCACTGG - Intronic
1175282642 20:57814365-57814387 TGCTGAGGAGGTGCGGGAGCAGG - Intergenic
1175775156 20:61648465-61648487 CTGTGAGGAGCTGCGGACCCGGG - Intronic
1176135618 20:63520893-63520915 AGGTGAGGGGCGCCGCGCGCGGG + Exonic
1176147173 20:63570765-63570787 GGCTGTGGAGCTGCGGGGGCAGG - Exonic
1176239155 20:64067913-64067935 GGGTGAGGGGCTGGGGGCGGGGG + Intronic
1176654132 21:9574832-9574854 AGCTGAGGAGATGCTGGCACAGG + Intergenic
1178351130 21:31873616-31873638 GGAGGAGGAGCTGCGAGCGCGGG + Exonic
1178489827 21:33042421-33042443 AGGTGAGGAGGTGGCGGCGGGGG + Intergenic
1178498879 21:33109772-33109794 GAGCGAGGACCTGCGGGCGCCGG - Intergenic
1179401632 21:41089872-41089894 AGGTGTGGAGCTGGGGGAGGTGG - Intergenic
1179966617 21:44810521-44810543 GGGTGCGGAGCTCCAGGCGCAGG + Intronic
1179985554 21:44918779-44918801 AGGTGAGAAGCTCCAGGCTCAGG + Intronic
1180059746 21:45378762-45378784 AGGTGAGGTGCTGGGAGGGCAGG - Intergenic
1180220711 21:46356223-46356245 GGGTGAGGGGCTGAGGCCGCGGG + Intronic
1180535648 22:16391448-16391470 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1180599658 22:17007832-17007854 ACGGGAGGAGCTGCGGGTGGAGG - Intronic
1180831917 22:18910905-18910927 CCGTGAGGAGCAGCGGGCGATGG + Exonic
1180874382 22:19168378-19168400 AGGTGAGTAGGTGGGGCCGCGGG - Intergenic
1181049596 22:20232269-20232291 AGGTGAAGGGCTGCAGGCGCTGG + Intergenic
1181067928 22:20315437-20315459 CCGTGAGGAGCAGCGGGCGATGG - Exonic
1181473922 22:23157108-23157130 ATGAGAGGAGCTGAGGGCCCAGG + Intronic
1182549563 22:31093513-31093535 ACTGGAGGAGCTGCGGGCGGTGG + Intronic
1183289574 22:36991456-36991478 AAGTGAGGAGCTGCGGGTGATGG - Intronic
1183418321 22:37695605-37695627 AGGTGAGGAACTGTGGGGGCAGG + Intronic
1184160090 22:42692746-42692768 TGTTGAGGAGCTGTGGGAGCAGG - Exonic
1184160200 22:42693186-42693208 GCGTGAGCAGCTGCGGGCCCTGG + Exonic
1184176953 22:42794076-42794098 AGGGGAGGAGCAGAGGGAGCCGG - Intergenic
1184265301 22:43343136-43343158 AGGTGGGGGGCGGCGGGCGCGGG - Intronic
1184437775 22:44490008-44490030 GGGTGAGGTGCTACGGACGCAGG + Intergenic
1184455891 22:44609217-44609239 AGGTGTGGAGTTGGGGGCTCTGG + Intergenic
1185171872 22:49299062-49299084 GCGTGAGGAGCTGCGGGCGGTGG - Intergenic
1203281995 22_KI270734v1_random:136176-136198 CCGTGAGGAGCAGCGGGCGATGG + Intergenic
950193927 3:10995789-10995811 AGGAGAGGGGCTGCTGGGGCGGG - Intronic
950568931 3:13788105-13788127 AGGGGAGGAGCTGGGGGCTGAGG - Intergenic
950645403 3:14373954-14373976 AGGTGTGGAGGTGTGGGGGCAGG - Intergenic
951931603 3:27973642-27973664 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
953330648 3:42050354-42050376 AGGTGAGGACCTGCAGGAGCTGG + Intronic
953925803 3:46981911-46981933 AGGTGAGGAGCTCCGGGAGGGGG - Exonic
955276996 3:57556296-57556318 AGCTGAGGAGCCGAGGCCGCCGG - Exonic
956214629 3:66835764-66835786 AGCTGAGGAACTGAGGGCCCCGG + Intergenic
956835100 3:73090083-73090105 AGGTGATGGGCTGCGGGAGGGGG - Intergenic
960702371 3:120451042-120451064 TGGGGAGGAGCTGGGGGGGCAGG - Exonic
961325638 3:126107684-126107706 AGGGGAGGAGCTCTGGGCACTGG + Intronic
961386315 3:126525161-126525183 AGGTCAGGAGACCCGGGCGCTGG - Intronic
961649052 3:128408407-128408429 TGGTGAGGAGCTGAGGGGGATGG + Exonic
961660001 3:128463558-128463580 TGGTGAGGAGCTGGGGGCGGGGG - Exonic
962687737 3:137863519-137863541 AGGTGAGCAGGTGCAGGAGCTGG - Intergenic
962826719 3:139105775-139105797 AGGTGAGAATCTGGGGGCTCGGG - Intronic
963133171 3:141876763-141876785 GCGAGAGGAGCTGCGGCCGCGGG - Exonic
963645284 3:147905826-147905848 ATGTGAGGAACTTCGGGCCCTGG + Intergenic
963858491 3:150281028-150281050 AGGTGAGGAGGTGCACGAGCTGG - Intergenic
966882242 3:184357161-184357183 GGGTGAGGAGCTGAGGGGGCTGG - Exonic
967218545 3:187229957-187229979 GGGTGAGGAGCTGGGAGCTCTGG - Intronic
967920353 3:194609677-194609699 GGGTGAGGAGGTGCGGGTGAGGG - Intronic
968479163 4:826221-826243 AGGGGCGGGGCCGCGGGCGCCGG + Intergenic
968598516 4:1497804-1497826 AGCTGAGCAGCTGCAGGAGCTGG + Intergenic
968703776 4:2068995-2069017 AGGAGAGGGGCTGCGGGGGCCGG + Exonic
968732058 4:2273854-2273876 AGGAGGGGAGCTGCGGGTGAGGG - Intronic
968804688 4:2764381-2764403 TGGAGAGGTGCTGGGGGCGCTGG - Intergenic
969588155 4:8106530-8106552 GGGCGAGGTGCTGCGGGTGCAGG - Exonic
969610139 4:8223152-8223174 GGGTGAGGAGCTGAGGGCGTGGG + Intronic
969870525 4:10101717-10101739 AGCTGAGAACCTGCGGGCCCAGG - Intronic
969979638 4:11141508-11141530 AGGTGAGGAGGTGAGGGTGTGGG - Intergenic
970332925 4:15003450-15003472 AGGGAGGGAGCTGCGGGAGCGGG - Exonic
974505967 4:62772335-62772357 AGGCGAGCAGGTGCGGGAGCTGG - Intergenic
977306428 4:95328912-95328934 AGGTGAGGGGGTGCAGGAGCTGG - Intronic
980178148 4:129371835-129371857 AGGTGAGGAGGTGAGGGGGCAGG + Intergenic
981782666 4:148444881-148444903 CGCTGCGGAGCGGCGGGCGCGGG - Intergenic
982786572 4:159543763-159543785 AGGTGAGGGGGTGCAGGAGCTGG + Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985675023 5:1226476-1226498 AGGGAAGGAGCTGAGGGCCCGGG - Intronic
985947093 5:3194237-3194259 GGCTGAGGAGCTGGGTGCGCAGG - Intergenic
985975687 5:3417689-3417711 AAGTGAGCAGCAGAGGGCGCCGG - Intergenic
986152459 5:5140214-5140236 AGGGGAGGAGGTGAGGGCGGGGG - Intergenic
986169305 5:5303080-5303102 AGGTGAGAAACAGCAGGCGCAGG + Intronic
986190792 5:5494722-5494744 GGGGGCGGAGCTGCGGGGGCGGG - Intergenic
986338852 5:6773819-6773841 GGGTGAGGAGCGGCGGGGGGAGG - Intergenic
987374113 5:17218104-17218126 GGGAGAGGAGCTGCGGGTGACGG + Intronic
988974761 5:36504016-36504038 AGGTCAGGAGCTGGGGGCAGGGG + Intergenic
989146953 5:38258621-38258643 AGGTGGGGGGCTGCGAGGGCTGG - Exonic
989156411 5:38348691-38348713 AGGAGAGGAGCTAGGGGTGCAGG + Intronic
990128460 5:52548696-52548718 AGGTGAGTAGGTGCAGGAGCTGG - Intergenic
990699396 5:58459669-58459691 AGGTGACAAGCGGAGGGCGCCGG - Exonic
991587509 5:68215645-68215667 AGGGGCGGAGCCGCGGGCTCTGG + Intergenic
995462726 5:112419924-112419946 AGGCGGGGACCTGCGGGCGGAGG + Intergenic
995735501 5:115296369-115296391 AGGCGAGGGGCTGCAGGCCCTGG - Intronic
997304208 5:132826207-132826229 GGGTGAGGAGCTCCGGGTGAGGG + Intronic
997919326 5:137963701-137963723 AGGTGAGCAGCTGGGGGAGTGGG + Intronic
999062845 5:148654245-148654267 GGGCCAGGGGCTGCGGGCGCAGG + Intronic
999399370 5:151252845-151252867 CGGGGCGGAGCTGCGCGCGCGGG - Intronic
1000205177 5:159051418-159051440 GGGTGGGGGGCTGCGGGAGCGGG - Intronic
1001425427 5:171619293-171619315 GGGTGAGGAGCTGTGCCCGCAGG + Intergenic
1002158342 5:177300321-177300343 AGGTGGGGGGCGGGGGGCGCAGG + Intergenic
1003912752 6:10757701-10757723 AGGTAAGGAGCTGGGCGCGGTGG + Intronic
1005873463 6:29994545-29994567 AGCTGAGGAGTTGCTGGAGCTGG - Intergenic
1007385527 6:41518012-41518034 AGGTGAGGAGCTGGGGGTAGTGG - Intergenic
1009992230 6:70858002-70858024 AGGCCAGGAGCTGCAGGCACAGG - Exonic
1016569039 6:145492276-145492298 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
1018253657 6:161896627-161896649 ACGGGAGGAGCTGGGGGAGCAGG + Intronic
1018282288 6:162199901-162199923 AGATGAGGAGCTGTGGGCCAGGG - Intronic
1018876636 6:167827236-167827258 AGGTGAGCACCGCCGGGCGCGGG + Exonic
1019105434 6:169663726-169663748 AGGTGAGGATGTGAGGGTGCTGG + Intronic
1019162981 6:170081204-170081226 AGGGGAGGAGCTGCAGCCGCAGG + Intergenic
1019170555 6:170131079-170131101 AGGTGAGCAGCAGCAGGGGCCGG - Intergenic
1019177140 6:170165710-170165732 AGGTGAGGAGGTGAGGGAACAGG - Intergenic
1019498479 7:1352514-1352536 TGGTGTGGAGCTGGGGGCGGGGG - Intergenic
1019625654 7:2014481-2014503 AGGTGAGGGGCCGCGGGCGTGGG - Exonic
1019684468 7:2373299-2373321 AAGTGAGGAGCTGAGGGCACAGG - Intronic
1021092763 7:16502404-16502426 AGGTGAACAGCTGCGGGAGCTGG - Intronic
1021360597 7:19708039-19708061 AGGTGTGGGGCGGGGGGCGCGGG - Intronic
1022936759 7:35186282-35186304 AGGCGGGGTGCTGCGCGCGCTGG - Intergenic
1023000157 7:35800653-35800675 AGTTTTGGAGCTGCGGGAGCCGG - Intergenic
1023367072 7:39475005-39475027 AGGCCAGGAGCTGTGGGGGCCGG - Intronic
1023673531 7:42605290-42605312 AGGTGGGGAGCAGAGGGCCCTGG + Intergenic
1024036288 7:45510045-45510067 AGGTGAACAGCTGCGTGCCCAGG + Intergenic
1024970693 7:55067041-55067063 AGGTGAGGAGCCGAGGATGCAGG - Intronic
1025280482 7:57623506-57623528 AGCTGAGGAGATGCTGGCACAGG + Intergenic
1025304249 7:57842001-57842023 AGCTGAGGAGATGCTGGCACAGG - Intergenic
1026941180 7:74289041-74289063 AGGTGAGATGCTGTTGGCGCTGG - Intergenic
1028622133 7:92836457-92836479 AGGTGAGGAGCTGTGCGCTCGGG - Intronic
1033071700 7:138209101-138209123 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
1035049402 7:155990055-155990077 AGCTGAAGAGCTGCTGGCCCTGG + Intergenic
1035171822 7:157021447-157021469 AGATGCGAAGCAGCGGGCGCCGG - Intergenic
1035717199 8:1763645-1763667 AGGGGCGGGGCGGCGGGCGCGGG - Intronic
1036618313 8:10405241-10405263 AGGTGGGGAGCTGCAGCTGCAGG + Intronic
1038328267 8:26588638-26588660 AGGGGAGGTGCTGCTGCCGCAGG + Intronic
1041244795 8:55879954-55879976 CGGCGAGGGGCTGCTGGCGCGGG - Exonic
1041257948 8:55995565-55995587 AGGTGAGGAGCAGGGAGCACTGG + Intronic
1041727832 8:61034098-61034120 AGGCCTGGAGCTGCGGGCCCAGG - Intergenic
1041989933 8:63974966-63974988 AGGGGAGGAGTTCCGGGGGCGGG - Intergenic
1042962896 8:74321605-74321627 AGGGGACGAGGGGCGGGCGCGGG - Intronic
1043388198 8:79768139-79768161 CGGGGAGGAGCCGCGGCCGCCGG - Intergenic
1044302919 8:90606466-90606488 AGGTGTGGAGCGGGAGGCGCGGG - Intergenic
1044995672 8:97835871-97835893 AGGAGGTGAGCAGCGGGCGCGGG + Intronic
1046467731 8:114628170-114628192 AGGTGAGGACCTGAGGACGTGGG + Intergenic
1047998529 8:130358425-130358447 CGCTGAGGAGCTGCCGCCGCCGG - Intronic
1048073025 8:131040917-131040939 AGGGGCGGAGCTGGGGGCGGGGG + Exonic
1049326178 8:142022663-142022685 AGGTGCGGAGCTCAGGCCGCGGG + Intergenic
1049551528 8:143262063-143262085 AGGTGCAGAGGTGCGGGCGCGGG - Intronic
1050113829 9:2242682-2242704 AGCTGGGGAGGTGCGGGCGGGGG - Intergenic
1050829167 9:9989850-9989872 AGGTGAGCAGGTGCAGGAGCTGG - Intronic
1052438666 9:28464972-28464994 AGGTGAGAAGGTGCAGGAGCAGG + Intronic
1056691024 9:88808892-88808914 AGGTGATGGGGTGTGGGCGCTGG - Intergenic
1057230597 9:93319335-93319357 TGCTGAGGGGCTGCGGGTGCTGG + Intronic
1057390641 9:94639352-94639374 AGGTGCGGGGCTGCAGGTGCGGG + Intronic
1057390652 9:94639405-94639427 AGGTGCGGAGCTGCAGGTGCGGG + Intronic
1057623563 9:96657401-96657423 AGGTGAGGAATTGGGGGCACAGG - Intergenic
1057883103 9:98807959-98807981 GGGCGAGGAGCTGCGGCTGCAGG + Exonic
1058619113 9:106864198-106864220 AGGCGAGGAGCGGGGGGCACCGG + Intronic
1060519739 9:124287415-124287437 AGATGAGGAGATGGGGGCTCAGG - Intronic
1061163388 9:128909069-128909091 AGGTGAGGCGGTGCAGGTGCTGG - Exonic
1061539770 9:131271839-131271861 AGTTGAGGAATTGCGGGGGCCGG + Intronic
1062011545 9:134269718-134269740 AGGCAAGGAGCTGGGGGTGCTGG - Intergenic
1062277102 9:135736338-135736360 AGGGGAGGAGCCGCGAGGGCTGG - Intronic
1062412211 9:136431262-136431284 AGGTGAGGGCCTGGGGGGGCGGG - Intronic
1062412257 9:136431386-136431408 AGGTGAGGGCCTGGGGGGGCGGG - Intronic
1062412273 9:136431428-136431450 AGGTGAGGGCCTGGGGGGGCGGG - Intronic
1062412304 9:136431511-136431533 AGGTGAGGGCCTGGGGGGGCGGG - Intronic
1062412320 9:136431553-136431575 AGGTGAGGGCCTGGGGGGGCGGG - Intronic
1062412336 9:136431595-136431617 AGGTGAGGGCCTGGGGGGGCGGG - Intronic
1062412352 9:136431637-136431659 AGGTGAGGGCCTGGGGGGGCGGG - Intronic
1062412398 9:136431761-136431783 AGGTGAGGGCCTGGGGGGGCGGG - Intronic
1062412414 9:136431803-136431825 AGGTGAGGGCCTGGGGGGGCGGG - Exonic
1062567374 9:137169250-137169272 AGGTGAGCTGCTGGGGACGCGGG - Exonic
1062579254 9:137222280-137222302 GGGGGTGGCGCTGCGGGCGCGGG - Intergenic
1062612661 9:137382018-137382040 CGGGGAGGAGGTGAGGGCGCGGG + Intronic
1062612697 9:137382130-137382152 CGGGGAGGAGGTGAGGGCGCGGG + Intronic
1203631855 Un_KI270750v1:78290-78312 AGCTGAGGAGATGCTGGCACAGG + Intergenic
1185432153 X:17566-17588 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185432235 X:17758-17780 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185432317 X:17950-17972 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185432411 X:18174-18196 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185432493 X:18366-18388 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185441470 X:230281-230303 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185441523 X:230411-230433 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185441620 X:230636-230658 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185441686 X:230797-230819 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185441713 X:230863-230885 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185441781 X:231024-231046 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185441808 X:231090-231112 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185441890 X:231282-231304 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1185441972 X:231474-231496 AGGGGAGGAGCTGGGGGTTCTGG - Intergenic
1188621871 X:32235409-32235431 AGGTGAGCAGCAGCGGGCTAGGG - Intronic
1192450180 X:71239931-71239953 AGGCGAGGAGCTGTGGGCGCAGG - Exonic
1194620346 X:96163119-96163141 AGGTGAGCAGGTGCAGGAGCCGG - Intergenic
1197563055 X:128047794-128047816 TGGTGAGGAGCAGCAGGGGCAGG + Intergenic
1199337099 X:146630822-146630844 AGGTGAGCAGGTGCAGGAGCTGG - Intergenic
1200091401 X:153637788-153637810 AGGAGGGGAGCTGCTGGCTCAGG - Intergenic
1200124502 X:153806938-153806960 AGCTGAGGGGCTGCGGGCTGAGG - Intronic
1200128683 X:153829983-153830005 AGGCGCGGTGCGGCGGGCGCGGG - Intronic
1201637961 Y:16146260-16146282 AGGTGAGCAGGTGCAGGAGCTGG - Intergenic
1201731681 Y:17211148-17211170 AGGTGAGTAGTTGCAGGAGCTGG - Intergenic
1202604053 Y:26623901-26623923 AGATGAGGAGCTGCCAGAGCTGG - Intergenic