ID: 1139460889

View in Genome Browser
Species Human (GRCh38)
Location 16:67121493-67121515
Sequence TGCCTGGCCAAGAGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 300}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139460880_1139460889 14 Left 1139460880 16:67121456-67121478 CCTCCCAGAGTGCTGGGATTACA 0: 7837
1: 299856
2: 263617
3: 151465
4: 134888
Right 1139460889 16:67121493-67121515 TGCCTGGCCAAGAGTGGGCAGGG 0: 1
1: 0
2: 2
3: 29
4: 300
1139460882_1139460889 10 Left 1139460882 16:67121460-67121482 CCAGAGTGCTGGGATTACAAGCG 0: 95
1: 7739
2: 143084
3: 283426
4: 218793
Right 1139460889 16:67121493-67121515 TGCCTGGCCAAGAGTGGGCAGGG 0: 1
1: 0
2: 2
3: 29
4: 300
1139460878_1139460889 20 Left 1139460878 16:67121450-67121472 CCTCGACCTCCCAGAGTGCTGGG 0: 76
1: 6798
2: 133961
3: 273261
4: 207408
Right 1139460889 16:67121493-67121515 TGCCTGGCCAAGAGTGGGCAGGG 0: 1
1: 0
2: 2
3: 29
4: 300
1139460876_1139460889 23 Left 1139460876 16:67121447-67121469 CCGCCTCGACCTCCCAGAGTGCT 0: 60
1: 4957
2: 101576
3: 191040
4: 132744
Right 1139460889 16:67121493-67121515 TGCCTGGCCAAGAGTGGGCAGGG 0: 1
1: 0
2: 2
3: 29
4: 300
1139460881_1139460889 11 Left 1139460881 16:67121459-67121481 CCCAGAGTGCTGGGATTACAAGC 0: 210
1: 14380
2: 240141
3: 275005
4: 179434
Right 1139460889 16:67121493-67121515 TGCCTGGCCAAGAGTGGGCAGGG 0: 1
1: 0
2: 2
3: 29
4: 300
1139460875_1139460889 24 Left 1139460875 16:67121446-67121468 CCCGCCTCGACCTCCCAGAGTGC 0: 52
1: 4724
2: 99839
3: 234529
4: 234566
Right 1139460889 16:67121493-67121515 TGCCTGGCCAAGAGTGGGCAGGG 0: 1
1: 0
2: 2
3: 29
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139460889 Original CRISPR TGCCTGGCCAAGAGTGGGCA GGG Intronic
900105219 1:978185-978207 TCCCAGGCCAAGAGTGTGCAGGG - Intronic
901663209 1:10811944-10811966 TGCCTGGCACATAGTGGGCCTGG + Intergenic
901788008 1:11637429-11637451 TGCCTGGCCAAAAGTCCCCAGGG - Intergenic
902248382 1:15136960-15136982 AGCCTGGTCTAGAGTGGGTATGG + Intergenic
902827531 1:18987341-18987363 TGCTTGGCCTGGAGTGAGCAGGG - Intergenic
903029842 1:20455991-20456013 TCCCTGGGCCAGGGTGGGCATGG - Intergenic
903293503 1:22329298-22329320 TGGCTGGAGTAGAGTGGGCAAGG - Intergenic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
903575378 1:24336628-24336650 TGCCTTGCCAGGGGTGGGCAAGG - Exonic
904053538 1:27655662-27655684 TGCCAGGCCCAGAGTAGGCGCGG + Intergenic
904060728 1:27708127-27708149 TACCTGGCCAGGGCTGGGCACGG - Intergenic
904266966 1:29323745-29323767 TGGCAGGCCGAGAGTGGGGATGG + Exonic
906271995 1:44486717-44486739 TTCATGGCTAAGAGTGGGCTGGG + Intronic
907393654 1:54174946-54174968 TGCCTGGCCCATGGTGGGCCTGG - Intronic
907502080 1:54887930-54887952 TGCCTGGCACAGAGCGGGCCTGG - Intergenic
909994492 1:82262291-82262313 TGCCTGGCCAAAAGCCAGCAAGG - Intergenic
910448228 1:87320322-87320344 TCCCTGGCCAAAAGCTGGCAAGG - Intergenic
910571135 1:88704738-88704760 TGCCTGGGCTGGAGTGTGCAGGG - Intronic
914322411 1:146577925-146577947 TTCCAGGCCAAGTGTGGACATGG + Intergenic
915742073 1:158126408-158126430 TGTCTTGACATGAGTGGGCATGG - Intergenic
916493720 1:165326305-165326327 TGCCTTGCCTAGAGGGTGCAGGG - Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
916893758 1:169139479-169139501 TACCTGGCCAGGAGATGGCAGGG - Intronic
918217749 1:182407759-182407781 TGCCTGGCCAAGGAGGGGGACGG - Intergenic
919654148 1:200180990-200181012 TGCCTGGCATAGAGCAGGCACGG + Intergenic
920404219 1:205697076-205697098 TGCCTCCTCCAGAGTGGGCATGG - Intergenic
1062959474 10:1561869-1561891 TGCATGGGCAAGAGTGGGAGAGG - Intronic
1063875964 10:10478985-10479007 TGCCAGGAGAAGAGTGGGGATGG - Intergenic
1067058230 10:43064634-43064656 GGCCTTGCCAGGAGGGGGCAGGG + Intergenic
1068283539 10:54908199-54908221 AGCCTGGCCCAGAGTGGCAAGGG + Intronic
1069838944 10:71327262-71327284 TGCCTGGACAAATGTGGGGATGG + Intronic
1069840797 10:71338118-71338140 AGACTGGCCCAGGGTGGGCATGG - Intronic
1069847819 10:71384804-71384826 TGCCTGGCCCAGGCTGGGCATGG + Intergenic
1070918004 10:80167172-80167194 TGCCTGGGAAATAGGGGGCAGGG + Intronic
1071485877 10:86102485-86102507 TCCCTGTCAATGAGTGGGCATGG - Intronic
1072864335 10:99042275-99042297 TGTCTGGCCAAGGGTGGGGCAGG - Intronic
1072896585 10:99372407-99372429 TGCAAGAGCAAGAGTGGGCAAGG + Intronic
1072917724 10:99549667-99549689 TGCCCGGACAAGGTTGGGCATGG - Intergenic
1074646437 10:115458584-115458606 TGCCTGGCCAAGAATGTGGTTGG + Intronic
1074891935 10:117743085-117743107 TGCCTGGCCAAAGGCAGGCATGG + Intergenic
1075298884 10:121302703-121302725 ATCTTGGCCAAGAGAGGGCAGGG + Intergenic
1075481169 10:122783089-122783111 AGCCTGGCACAGTGTGGGCAAGG + Intergenic
1075876761 10:125813928-125813950 TACCTGGAGCAGAGTGGGCATGG - Intronic
1076308816 10:129487127-129487149 TTCTTTGTCAAGAGTGGGCATGG - Intronic
1076721584 10:132395684-132395706 AGCCTGGCAACCAGTGGGCAGGG + Intergenic
1077155229 11:1088147-1088169 GGGCTGGCCAGGAGGGGGCAGGG - Intergenic
1077269289 11:1667505-1667527 GACCTGGACAAGAGAGGGCAAGG - Intergenic
1077321733 11:1945941-1945963 GGCCTGGACAACAGTGGGGACGG + Intergenic
1077432253 11:2521751-2521773 GGCCTGTCCCCGAGTGGGCATGG + Intronic
1079615681 11:22489880-22489902 AGCCTGGCCCAGTGGGGGCAGGG + Intergenic
1079710996 11:23681109-23681131 TGGCTGCCCAAGAGTGGGAGTGG + Intergenic
1083109620 11:60392613-60392635 TGCCTGGCTAAGAGGAGACAGGG - Intronic
1084289612 11:68153433-68153455 TGAATGGCCAAGACTGGGAAAGG - Intergenic
1084790596 11:71473218-71473240 TGCGTGGCCCAGACAGGGCATGG + Intronic
1084935708 11:72585512-72585534 TGCCTGGCTGTGTGTGGGCATGG - Intronic
1085131318 11:74041446-74041468 TCCCTGGCCAAGAGTAGACAGGG - Intronic
1088345297 11:108817294-108817316 TGACTGGACTAGAGTGAGCAGGG - Intronic
1089008641 11:115114141-115114163 TGCAGGGCCAAGAGCAGGCAAGG + Intergenic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1090807823 11:130213375-130213397 TGCCTGGCTCAGGGTGAGCATGG + Intergenic
1091022472 11:132113207-132113229 TGCCTCGCTGAGACTGGGCACGG - Intronic
1202804751 11_KI270721v1_random:1254-1276 GGCCTGGACAACAGTGGGGACGG + Intergenic
1091848790 12:3678633-3678655 TGCATGGCCAGGAGTGAGGAAGG + Intronic
1092148445 12:6230796-6230818 TGCCTGGCCCACACTGGGCAAGG - Intronic
1093317196 12:17666560-17666582 TGGGTGGCCATGAGTGGGCCTGG + Intergenic
1093337215 12:17920892-17920914 TGCCTGGCCAAGGGGAGTCAGGG + Intergenic
1093477745 12:19573966-19573988 TGCCTGGTGAAGAGTGGGGGTGG + Intronic
1096650701 12:53060740-53060762 TGCCTGGGAAACAGGGGGCAAGG - Exonic
1096745222 12:53722401-53722423 GGCCAGGCCTAGAGTGGGGAGGG - Intronic
1099184825 12:79505067-79505089 TGCCTGGTGAAGAGTGGGGGTGG - Intergenic
1099501099 12:83415219-83415241 TGCCAGGCCAGGAGAGGGCAGGG - Intergenic
1099573038 12:84348975-84348997 TGCCAGGCCAAGAGAGAGCAGGG - Intergenic
1099801406 12:87461431-87461453 TGCCAGGCCCAGAGAGAGCAAGG + Intergenic
1102486041 12:113258009-113258031 TGCCTGGGCATGGATGGGCAAGG + Intronic
1102737573 12:115176740-115176762 AGCCTGGCCAAGAATGTGTATGG - Intergenic
1103943998 12:124516316-124516338 TGCCTGGCCCAGGGCTGGCACGG + Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104312997 12:127671181-127671203 TCCCAGGCCAAGACTGGGCATGG + Intergenic
1106923390 13:34588573-34588595 TGCCCCGCCAGGCGTGGGCAGGG + Intergenic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1109973987 13:69807349-69807371 TGCCTAGCCAAGAAGGGACAGGG + Intronic
1113469173 13:110532154-110532176 TGCCAGGGCAAGAGTGGGGCTGG + Intronic
1114660467 14:24340241-24340263 TGCCAGGCCATGAGTGGAGATGG + Intergenic
1115949823 14:38708351-38708373 TACATGGCCAAGAGTGGACAAGG + Intergenic
1116710681 14:48364356-48364378 GGCTTGGCCATGAGTGTGCACGG + Intergenic
1117460620 14:55941158-55941180 TTCCTGGTCATGAGTGGCCAGGG + Intergenic
1118205436 14:63718569-63718591 TGCATGACAAAGAGAGGGCAGGG + Intronic
1119473283 14:74912301-74912323 GGCCTGGCCCAGCGTGGGCAGGG - Intronic
1119669846 14:76510069-76510091 TCCCTGGCCAAGACCAGGCAAGG - Intergenic
1119718432 14:76874912-76874934 TGCCTTGCCAAGTGGGGGCTTGG + Intergenic
1119961654 14:78864774-78864796 TGGCTGGACAAAAGTGGGCATGG + Intronic
1120703373 14:87723131-87723153 TGGCTGGAGAAGAGTGGGCAAGG + Intergenic
1120830365 14:88992612-88992634 TGCCTGGCAAGCACTGGGCAGGG + Intergenic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1125713277 15:41804338-41804360 TGCCTGGCAAAGGCTGGGCTAGG + Intronic
1126846292 15:52763451-52763473 TGCTTTGCCTATAGTGGGCAAGG + Intronic
1127306136 15:57707122-57707144 TGCCTGGCCAGGAAGAGGCACGG - Intronic
1127983651 15:64051893-64051915 TCCCTGGCACAGAGTGGGGAGGG - Intronic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1129582883 15:76831210-76831232 TGCCAGACCAGGAGAGGGCAGGG + Intronic
1130299398 15:82668374-82668396 TGTCTGGCCAAGAGAGGGGCAGG - Intronic
1130411623 15:83653478-83653500 TGCCTGGCCAGGAGTGCCTATGG + Intergenic
1131168187 15:90157998-90158020 CTCCTGGCCACGAGGGGGCATGG + Intergenic
1132599908 16:768776-768798 CGCCTGGCCAGGAGCAGGCACGG + Exonic
1132626243 16:892935-892957 AGCCCCGCCAAGAGTGGGAACGG + Intronic
1133420225 16:5639763-5639785 TGTCTGGCAAAGAGTGGGTGTGG + Intergenic
1133889889 16:9868877-9868899 TGCCAGGCAGAGAGTGGGAAGGG - Intronic
1134214471 16:12306345-12306367 TGCCTGGCCGAGGGAGGGTATGG + Intronic
1135295877 16:21278628-21278650 TGCCTGGGAAAGAATGGACAGGG + Intronic
1135626470 16:23999339-23999361 TGCCTGGCTCAGACTGGGCTTGG - Intronic
1135938986 16:26804424-26804446 TACCTGGCCAACCCTGGGCAAGG + Intergenic
1136478004 16:30525370-30525392 GGCCGGGCCAGGGGTGGGCAGGG - Exonic
1137624810 16:49900873-49900895 TGCCCTGCAAAGAGTGTGCAGGG + Intergenic
1138061712 16:53898254-53898276 ATCCTGGGCAAGAGTGGGCTGGG - Intronic
1138741697 16:59318029-59318051 TCCCTGGCCAAGACCTGGCAAGG - Intergenic
1139460889 16:67121493-67121515 TGCCTGGCCAAGAGTGGGCAGGG + Intronic
1139573654 16:67828257-67828279 AGCCTGGCCACTACTGGGCAGGG + Exonic
1139662835 16:68433502-68433524 TCCCTGTACAAGAGTGGGCGAGG + Intronic
1139695138 16:68668872-68668894 TGCCTGGCCCAGAGTAAGTAAGG - Intronic
1140011212 16:71133244-71133266 TTCCAGGCCAAGTGTGGACATGG - Intronic
1141171988 16:81697328-81697350 TGCCTGGCCAAGGAAGGGCTTGG - Intronic
1141382410 16:83588192-83588214 TGGCTGTCCAAGAGTGTGCAGGG - Intronic
1142382457 16:89740753-89740775 TGCCTGGCCCACAGTGGGAGAGG + Intronic
1142510492 17:389688-389710 CGCCTGGTCAAGAGTGGGAAGGG - Intergenic
1142862497 17:2771324-2771346 TGCTGGGGGAAGAGTGGGCAGGG - Intergenic
1142903267 17:3026474-3026496 TGCCTGCCCAAGGGTGGACGGGG - Intronic
1142993982 17:3750363-3750385 CGCCTGGCCCAGAGTGCCCACGG + Exonic
1143646397 17:8232938-8232960 TGCTTGGCCAGGAGCAGGCAGGG + Exonic
1144265284 17:13562638-13562660 TGCCTGGCCAGGGTTGGGGATGG - Intronic
1144307994 17:13986725-13986747 TCCTTGGGCATGAGTGGGCAAGG - Intergenic
1145252974 17:21306414-21306436 TGCCAGGCCCTGAGAGGGCACGG - Intronic
1145323601 17:21781502-21781524 TGCCAGGCCCCGAGAGGGCATGG + Intergenic
1145816244 17:27797073-27797095 TGCTTGGCCAGGAGTGGGCTGGG - Intronic
1147617535 17:41838545-41838567 TGCCTGGACCAGAGTTGGCCAGG - Intronic
1147918263 17:43901193-43901215 TGGCTGACCAAGGGTGGGTAGGG - Intronic
1148320387 17:46746358-46746380 TGCTGTGCCAAGAATGGGCAAGG - Intronic
1148866744 17:50632777-50632799 TGCCTGGCCAACTGTGGGGCTGG + Intergenic
1150477633 17:65487017-65487039 TGCTTGGCCTGCAGTGGGCATGG - Intergenic
1152107643 17:78340504-78340526 CACCTGGCAGAGAGTGGGCATGG + Intergenic
1152262030 17:79272524-79272546 TGCGTGGCCCCGCGTGGGCAGGG - Intronic
1152629563 17:81404443-81404465 GGCCTGGGCCAGAGTGGGGAGGG + Intronic
1152739414 17:82012485-82012507 TGCCTGGCCCCGGGTGGGAAAGG + Intronic
1152740998 17:82018280-82018302 TGCGTCTCCAAGGGTGGGCAGGG + Intergenic
1152795258 17:82303347-82303369 TGCCTGGCCATCCGTGGCCATGG - Intergenic
1154051982 18:10969761-10969783 CTCCTGGCCAAGAGAGGGCATGG + Intronic
1161209119 19:3057123-3057145 GGCCAGGCCAAGGGTGGGTAAGG + Intronic
1161768015 19:6217426-6217448 AGCCTGCCCCAGAGTGGGGAGGG - Intronic
1162057301 19:8072196-8072218 TGCCTGGGCCAGGATGGGCAGGG + Exonic
1163685772 19:18710939-18710961 TGACTGGCCAAGCCTGGGCATGG - Intronic
1163722106 19:18903236-18903258 AGCCTGTCCCAGAGTGGGGACGG - Intronic
1163848700 19:19651656-19651678 AGCCTGGCCCACAGTGGGGAAGG - Intronic
1164324129 19:24177873-24177895 TCCCTGGCCCAGAGTGAGGATGG - Intergenic
1164754094 19:30677438-30677460 TGGATGGCCAAGGGTGGCCAGGG - Intronic
1165093926 19:33400498-33400520 TGCCTGGGCCGGTGTGGGCAGGG + Intronic
1166117363 19:40663956-40663978 TGCCTGGCCCTGTGTTGGCACGG + Intergenic
1167100998 19:47404291-47404313 TTCATGGCCAAGTGTGGGTAGGG - Intronic
1167542073 19:50095386-50095408 TGCCTGGCCTAGAGTCGGCATGG - Intergenic
1167587701 19:50384266-50384288 CGCCTGCCCAAGTGCGGGCAAGG - Intronic
1168139417 19:54375276-54375298 TGCCGTGCCAAGACTGGTCAAGG + Intergenic
1168158569 19:54492821-54492843 TGCCATGCCAAGACTGGTCAAGG - Intergenic
925656474 2:6155411-6155433 TGCAAGGACAAGAGTTGGCAGGG + Intergenic
925824502 2:7834098-7834120 TACATGGCCAAAAGAGGGCAAGG - Intergenic
926547013 2:14255049-14255071 TGGGTGGCCAACAGTGGGCCTGG + Intergenic
927100079 2:19781353-19781375 TGCCTGGACAAGAACAGGCATGG - Intergenic
931474115 2:62570671-62570693 AGGCTGGCCAGGAGTGAGCAGGG - Intergenic
932212673 2:69945435-69945457 TGCATGGAACAGAGTGGGCAGGG - Intergenic
932463778 2:71899939-71899961 AGCATGGCCAAGAGTGGTCCTGG + Intergenic
932894156 2:75622516-75622538 TGCATGGCAAAGTTTGGGCAAGG - Intergenic
933110706 2:78397021-78397043 TGCCTGGCAGTGAGTGAGCAGGG - Intergenic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
936059430 2:109284689-109284711 TGCCTGGCCTAGACTGGGAAGGG - Intronic
936513494 2:113167330-113167352 TGACTGGCCACGGGCGGGCAAGG + Intronic
937414300 2:121702166-121702188 TGCATGGCCAATGCTGGGCACGG + Intergenic
938240509 2:129739221-129739243 TGCCGGGCCAAGGCTGGGCTTGG - Intergenic
938288142 2:130135763-130135785 CACCTGGCCCAGAGGGGGCAGGG + Intergenic
938716452 2:134026753-134026775 TGCCTGGCAAATACTGGGGAAGG + Intergenic
938900120 2:135792534-135792556 TGCCCTGCCAACAGTGCGCAGGG - Intronic
939828607 2:147045803-147045825 TGGCTGGGTAAGACTGGGCATGG - Intergenic
941163360 2:162059765-162059787 TGCCTGGCAAATACTGGGAATGG - Intronic
941997228 2:171612040-171612062 TGCCTGGCCAAGGAAGGACAAGG + Intergenic
943742400 2:191424327-191424349 TGCCTAGCATAGAGTAGGCATGG - Exonic
946932283 2:224682182-224682204 TGCCTGGCAAACAGTGTACATGG + Intergenic
947335666 2:229080114-229080136 TGCCTGGCCAGGAGGAGACATGG + Intronic
948586768 2:239024663-239024685 TCCCTGGCCCAGAGTAGCCAGGG + Intergenic
948899642 2:240949813-240949835 CGCCTGGCCAGGGCTGGGCAAGG + Intronic
1170478530 20:16742343-16742365 AGCATGGCCAGGACTGGGCATGG - Exonic
1170688161 20:18587897-18587919 CGCCAGGCCGAGAGTGGGCGTGG + Exonic
1173629118 20:44496898-44496920 TGCCTGCCAAAGAGTAGCCATGG - Intronic
1173681224 20:44883805-44883827 TGCCTGTTCTAGACTGGGCATGG - Intergenic
1173865472 20:46309667-46309689 TTCATGGCAAAGAGGGGGCAGGG + Intergenic
1174409042 20:50321806-50321828 TGCCTGGCACACAGTGAGCATGG - Intergenic
1175291909 20:57881621-57881643 TGCCTGGCTCAGAGTAGGTATGG - Intergenic
1175496136 20:59415598-59415620 TGCCTGGCAAGTAGTTGGCAAGG + Intergenic
1175668569 20:60881429-60881451 GGCCTGTCCGAGGGTGGGCAGGG - Intergenic
1175814625 20:61877083-61877105 TGCCTGGCCCAGGGAGGCCAGGG - Intronic
1175933368 20:62503803-62503825 TGTCTGCCCAAGAGTGGGGGAGG - Intergenic
1178076509 21:29017803-29017825 TTCTTGGCCAAGAGTGTTCAAGG + Intronic
1178522383 21:33297318-33297340 TGCCTGGTCAACAGCAGGCAGGG - Intergenic
1178638922 21:34330217-34330239 TGACTGGCCAGCAGAGGGCAGGG + Intergenic
1179121440 21:38549898-38549920 TGCATGGCCAAGGGAAGGCAGGG - Intronic
1179594048 21:42430506-42430528 TGTGTGGCCAAGAGGGAGCAGGG + Intronic
1180899388 22:19359597-19359619 TGGCTGGCCAAGAGAGGAGAGGG + Intronic
1180998333 22:19976487-19976509 GGCAGAGCCAAGAGTGGGCAGGG - Intronic
1181496828 22:23291991-23292013 GGCCTGGAGAAGAGTGGGCTGGG - Intronic
1183357795 22:37368782-37368804 TGCTGGGCCAGGAATGGGCAGGG + Exonic
1183597495 22:38821567-38821589 GGCCAGGCCCAGAGAGGGCAGGG + Exonic
1183617795 22:38955662-38955684 TCCCTTGCCAAGGGTGGACAGGG - Intronic
1183619714 22:38965346-38965368 TCCCTGGCCAAGGATGGACAGGG - Intronic
1183951721 22:41356333-41356355 TGCATGTCCAGGACTGGGCAGGG - Exonic
1184334173 22:43843692-43843714 TGGCTTGCCCAGAGAGGGCATGG + Intronic
1184335962 22:43853426-43853448 GACGTGGCCCAGAGTGGGCAGGG - Intronic
1184374064 22:44100517-44100539 CTCCTGGCCAGGAGTGGCCAGGG - Intronic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185331274 22:50253057-50253079 TGCATGGCCCAGAGCAGGCAGGG + Exonic
950177387 3:10884634-10884656 TGCCAGCCCAGGACTGGGCAGGG - Intronic
950193965 3:10995964-10995986 TGCCTGGAGAATGGTGGGCAGGG + Intronic
950197730 3:11021052-11021074 GGCCTGGCACAGAGTGGTCAAGG + Intronic
950221331 3:11198579-11198601 TGCCTGACAGAGACTGGGCACGG + Intronic
951843410 3:27059515-27059537 TTCCTGGTCAAGAGTGGAAAAGG - Intergenic
954412451 3:50376732-50376754 TGCTTGGCCCTGAGTGGGCAGGG - Intronic
955088789 3:55729224-55729246 TGGCTGGCGTAGAGTGAGCAAGG - Intronic
962455940 3:135565675-135565697 TTACTGGCCAGGGGTGGGCACGG - Intergenic
963046923 3:141109468-141109490 TGGCTGGCCCAGGGTGGGTATGG - Intronic
963141491 3:141949557-141949579 TGCCTGGCCCTCAGTGGGTAGGG - Intergenic
967228193 3:187312984-187313006 GGCCTGGACAAGAGATGGCATGG - Intergenic
968645319 4:1737752-1737774 GGCTTGGCCAACAGTGGGCAGGG + Intronic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
969056184 4:4404340-4404362 TGGCTGGCAAACAGTGGGCACGG - Intronic
969231546 4:5835267-5835289 TGCATGGCCAAGAGTGGCCTTGG - Intronic
971013395 4:22463433-22463455 TGCCTGGGCACGGGTGAGCATGG - Intronic
973534387 4:51866922-51866944 TGCCTGGCCAAGTGGGTGGAAGG - Intronic
979144527 4:117225618-117225640 TTCCAGGCCAAGAGCTGGCAAGG - Intergenic
979284740 4:118909637-118909659 AGCCTTCCCAAGCGTGGGCAGGG - Intronic
980180472 4:129394378-129394400 TGACTGGCCAAATGTGTGCATGG - Intergenic
980253615 4:130349324-130349346 TGGCTGGCCATGGGTGGCCATGG + Intergenic
980597686 4:134976013-134976035 TGCCTGGAAAAGAGTGGGTCTGG - Intergenic
981646944 4:147009687-147009709 TGCCATGCAAAGTGTGGGCACGG - Intergenic
981832415 4:149017576-149017598 TGCCTGGGCATCACTGGGCAAGG + Intergenic
981969289 4:150647396-150647418 TGCCTAGACTAGAGTGTGCAAGG + Intronic
982258256 4:153470818-153470840 TGCTTGGCCAAGGGTGGGGCTGG - Intronic
982802597 4:159723021-159723043 TGGGTGGCCATGAGTGGGCCTGG + Intergenic
984638730 4:182141594-182141616 CGCCTGGCATAGAGTGCGCAGGG + Intergenic
984701399 4:182820813-182820835 TGCCTGGCATAGAGGGGGAAGGG + Intergenic
985209071 4:187572579-187572601 ACCCTGGATAAGAGTGGGCAGGG + Intergenic
985475580 5:77082-77104 TGCCTGGGCAAGAGGGGACAGGG + Intergenic
988688643 5:33549804-33549826 TCCCTTCCCAGGAGTGGGCATGG + Intronic
990042548 5:51390735-51390757 AGGCTGGCCAAGATTGGGCCAGG + Intronic
990992593 5:61700394-61700416 TGCCTGGCCACGAGTGTGCGTGG + Intronic
992668611 5:79036166-79036188 TGCATGGCACATAGTGGGCAAGG + Intronic
996276779 5:121676282-121676304 GGGCTGGGCAATAGTGGGCAGGG - Intergenic
996702342 5:126463054-126463076 TGCCTGACCAAGATGGGTCAGGG + Intronic
997310662 5:132878204-132878226 TGCCTGGGCCAGACTGGGCTGGG - Exonic
997581143 5:135017898-135017920 TGCATTGCCAAAAGTGGACAAGG - Intergenic
1000576051 5:162976295-162976317 TACCTGGGCCAGTGTGGGCAGGG + Intergenic
1000971830 5:167723316-167723338 TGACTGCACAAGAGTGAGCAAGG - Intronic
1004620424 6:17326224-17326246 AGTCTGGCCTGGAGTGGGCAAGG + Intergenic
1005199356 6:23325709-23325731 TGCCTGGCCAACAATCAGCAAGG + Intergenic
1006518031 6:34555492-34555514 TGCCAGGCCACCAGTGGGCAGGG - Intronic
1006582043 6:35082852-35082874 TGCCTGGCCGAGAAGGAGCAGGG - Intronic
1006717315 6:36128869-36128891 TGCCTGGGCAAGAGAGGGGTTGG + Intronic
1006917135 6:37601976-37601998 AGCTGGGCCAAGAGTGAGCAGGG + Intergenic
1007104037 6:39271121-39271143 TGCCTGGCACAGAGCAGGCACGG - Intergenic
1007229793 6:40340182-40340204 TGCCTGGGCATGTGTGGGGAAGG - Intergenic
1007281076 6:40713019-40713041 TGCCTGGGCAACAGAGAGCAAGG - Intergenic
1007716594 6:43859692-43859714 TGCCTGGCCAACATGGGACATGG + Intergenic
1009301424 6:62027774-62027796 TGCCGTGCCTAGAGAGGGCATGG + Intronic
1012377094 6:98575146-98575168 TGTCAGGCCTTGAGTGGGCATGG + Intergenic
1012860177 6:104550154-104550176 TGCCTGGCCAAGCCAGGACATGG + Intergenic
1013455346 6:110324834-110324856 TGCCTGGCACAGAGTGGCTAAGG - Intronic
1013784049 6:113759468-113759490 TGCCTGACCAGGAGAGAGCATGG - Intergenic
1014085881 6:117343207-117343229 TGGCTGGCCAAGATTGGACTTGG - Intronic
1016310958 6:142733025-142733047 TGCCTTCCCTAAAGTGGGCAGGG - Intergenic
1017498400 6:155001594-155001616 TGCCTGGAGAGGAGTGGGCCAGG - Intronic
1017727147 6:157283693-157283715 TGTCAGGCGAAGGGTGGGCAAGG + Intergenic
1017735060 6:157355183-157355205 TGCTGCTCCAAGAGTGGGCAGGG + Intergenic
1018808665 6:167281376-167281398 TCCCTGGCCAGGAGTGAGAATGG + Intronic
1023839422 7:44088070-44088092 GGCCTGGGCAGCAGTGGGCAGGG + Intergenic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1026370170 7:69691168-69691190 TGGGTGGCCATGAGTGGGCCTGG + Intronic
1027050035 7:75016129-75016151 TGCCAGGCCCTGAGTGGGGAGGG - Intronic
1029122711 7:98279431-98279453 AGACTGGCCAGGAGTGGCCAAGG - Intronic
1029162615 7:98563400-98563422 TCCCTGTCCAGGAGTGTGCAGGG + Intergenic
1029383003 7:100225539-100225561 TGCCAGGCCCTGAGTGGGGAGGG + Intronic
1029737494 7:102472820-102472842 TGCCAGCCCAAGCCTGGGCAGGG - Intronic
1030198829 7:106881059-106881081 TGCCTGGCCCAGAGAAGGAAAGG - Intronic
1033423697 7:141224643-141224665 AGCCTGGCCCAGAGTTGGCTTGG - Intronic
1034455866 7:151169424-151169446 TGCCCGGCCAAGACAGAGCAGGG + Intronic
1035777843 8:2203331-2203353 TACCTGGGCAAGAGTGGCAAGGG - Intergenic
1037994199 8:23340883-23340905 TGCCTGGCCATGCCTGGCCAAGG + Intronic
1039028936 8:33288536-33288558 TGCCTTGTCAAGAGTCAGCAGGG - Intergenic
1039102078 8:33951587-33951609 TGCCTGGCCAAGGAGGGACAGGG - Intergenic
1039457346 8:37716253-37716275 TGCCAGGCACAGACTGGGCATGG - Intergenic
1039669517 8:39580747-39580769 TGCCTGGAACAGAGAGGGCAGGG - Intergenic
1039884653 8:41648105-41648127 TGGCTGGCCCCGAGAGGGCACGG - Intronic
1043160803 8:76844232-76844254 TGCCTGGTTCAGAGAGGGCAAGG + Intronic
1044536215 8:93358998-93359020 GGCCTGGCAAAGAGTGGCCTGGG - Intergenic
1044559303 8:93596839-93596861 TGCCTGGCATATGGTGGGCATGG - Intergenic
1045998827 8:108395547-108395569 TCCATGGCCAAGAGGGGGCCTGG - Intronic
1046938479 8:119908189-119908211 TGGCTGGCCAAGAGAGGGCATGG + Intronic
1047605266 8:126468176-126468198 TGCCTGGCCCATAGCGGGTATGG + Intergenic
1047618982 8:126587083-126587105 TGGCTGGAGAAGAGAGGGCAGGG + Intergenic
1049254839 8:141608308-141608330 AGCCTGGACAACAGTGGGAAGGG - Intergenic
1049591356 8:143464417-143464439 TGCCGGGCCAAGGGTTGGCCAGG - Intronic
1050599262 9:7234193-7234215 TGGCTTGCCCAGAGGGGGCATGG - Intergenic
1051091193 9:13410740-13410762 TCACTGGCCAAAAGTTGGCAAGG + Intergenic
1051225334 9:14892806-14892828 TGCCTGGGGCAGAGTGGGGAAGG - Intronic
1052990865 9:34518779-34518801 TCCCTGGATCAGAGTGGGCAGGG - Intronic
1052990885 9:34518864-34518886 TCCCTGGATCAGAGTGGGCAGGG - Intronic
1052990905 9:34518949-34518971 TCCCTGGATCAGAGTGGGCAGGG - Intronic
1054758301 9:68980961-68980983 TGCCTGGCCAACAGTGAGTTAGG - Intronic
1056076125 9:83042440-83042462 TGCCCAGCCAGGAGTGGGCATGG - Intronic
1056306925 9:85299666-85299688 TGCATATCCAAGAGAGGGCAAGG + Intergenic
1058903518 9:109462141-109462163 CGCCTGGCAGAGAGTGGGAATGG - Intronic
1059064305 9:111066433-111066455 TGCCAGGCCAAGGCAGGGCAGGG - Intergenic
1060803209 9:126557617-126557639 TGCCTGGCCAGGAGTGGCTTTGG + Intergenic
1061622284 9:131818462-131818484 TGCCGTGCCCAGAGCGGGCATGG + Intergenic
1185431682 X:14872-14894 TCCCCGGCCATGAGTGGACACGG - Intergenic
1187391581 X:18889705-18889727 TGCCTGGCCCTCAGTGGGCATGG + Intergenic
1188113980 X:26222226-26222248 TCCTTGGCCTGGAGTGGGCAGGG + Intergenic
1188434893 X:30148641-30148663 TGGCCGGCCATGAGTGGGCCTGG - Intergenic
1188941325 X:36241376-36241398 TGCCAGGCCAAGAGAGAGCAAGG + Intronic
1189312921 X:40032743-40032765 TGCCCGGCCAAGAATGGCCTGGG + Intergenic
1190511323 X:51176667-51176689 TGCCTGGCCACCATTGAGCAGGG + Intergenic
1190756667 X:53407379-53407401 TGGCTTGCCCAGATTGGGCATGG + Intronic
1191223642 X:58017030-58017052 TGCTTGGTTAAGAGTGGGCCGGG - Intergenic
1192313809 X:70036736-70036758 TACCTGGCCTAGAAAGGGCAAGG + Exonic
1192810950 X:74546944-74546966 TGGCTGGCCAAGGCTGGTCATGG - Intergenic
1194201573 X:90958487-90958509 TACCTGGTGAAGAGGGGGCATGG - Intergenic
1195683487 X:107565609-107565631 TGCCTGGGCCAGAGAGGTCAAGG + Intronic
1197896140 X:131317592-131317614 TAGCAGGCCAAGAGTGGGGAAGG - Intronic
1199747789 X:150784931-150784953 TGCAGGGCGGAGAGTGGGCAGGG + Intronic
1200547413 Y:4533942-4533964 TACCTGGTGAAGAGGGGGCATGG - Intergenic