ID: 1139461717

View in Genome Browser
Species Human (GRCh38)
Location 16:67127899-67127921
Sequence TTACCTTCCCCCAGTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139461717_1139461722 20 Left 1139461717 16:67127899-67127921 CCAGAAACACTGGGGGAAGGTAA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139461722 16:67127942-67127964 AAGCTGGAAGTAACCTAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 151
1139461717_1139461719 -10 Left 1139461717 16:67127899-67127921 CCAGAAACACTGGGGGAAGGTAA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139461719 16:67127912-67127934 GGGAAGGTAACGGTATTTCATGG 0: 1
1: 0
2: 0
3: 7
4: 88
1139461717_1139461720 4 Left 1139461717 16:67127899-67127921 CCAGAAACACTGGGGGAAGGTAA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139461720 16:67127926-67127948 ATTTCATGGTAATGAGAAGCTGG 0: 1
1: 0
2: 1
3: 21
4: 207
1139461717_1139461721 19 Left 1139461717 16:67127899-67127921 CCAGAAACACTGGGGGAAGGTAA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139461721 16:67127941-67127963 GAAGCTGGAAGTAACCTAAATGG 0: 1
1: 0
2: 2
3: 23
4: 199
1139461717_1139461723 30 Left 1139461717 16:67127899-67127921 CCAGAAACACTGGGGGAAGGTAA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139461723 16:67127952-67127974 TAACCTAAATGGGCAACAAAAGG 0: 1
1: 0
2: 2
3: 44
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139461717 Original CRISPR TTACCTTCCCCCAGTGTTTC TGG (reversed) Intronic
903397688 1:23014456-23014478 TTACCTTCCCCTAAAGTATCAGG - Intronic
907701093 1:56788969-56788991 TTACCTTCCCCCTGAGTCTTGGG + Exonic
909809829 1:79918817-79918839 TTTCCTTCCCTCTCTGTTTCTGG - Intergenic
913229951 1:116733565-116733587 TTGCCTTCCCCCCATATTTCAGG + Intergenic
913397210 1:118385151-118385173 ATAGCTTCTCCCAGTCTTTCTGG - Intergenic
914774676 1:150725863-150725885 TTAGCCTCCCAAAGTGTTTCAGG + Intergenic
919726320 1:200887192-200887214 TCACCTCCTGCCAGTGTTTCAGG + Intergenic
920351399 1:205340386-205340408 TAAACTTCACGCAGTGTTTCAGG - Intronic
923676700 1:236086674-236086696 TTTCCTTCCTCCAGTACTTCCGG - Intergenic
1063255645 10:4324578-4324600 TTCTCTACCCCCAGTGTGTCTGG - Intergenic
1063616894 10:7608076-7608098 ACCCCTTCCCCCAGTCTTTCAGG + Intronic
1067369925 10:45673223-45673245 TCACCGTCCCCTAATGTTTCTGG + Intergenic
1067467080 10:46509116-46509138 CTCCCTTCTCCCAGTGTTTCTGG - Intergenic
1067620106 10:47875489-47875511 CTCCCTTCTCCCAGTGTTTCTGG + Intergenic
1076051179 10:127334851-127334873 ATCCCTTCCCCCTGAGTTTCTGG + Intronic
1077373890 11:2196117-2196139 TCACCTCCCCCCAGTGTTCCTGG - Intergenic
1077929855 11:6719889-6719911 TGAGCTTCCTCCACTGTTTCTGG + Intergenic
1080192472 11:29568716-29568738 TTATCTTTCCCCTTTGTTTCTGG - Intergenic
1080697103 11:34612129-34612151 CTACATTCCACCAATGTTTCTGG - Intergenic
1080820013 11:35796690-35796712 TTTCCTCCCCCCAGTGCTGCTGG - Intronic
1081852284 11:46282025-46282047 TTTGCTTCCCCCAGTGTTGAGGG + Intronic
1083664762 11:64268399-64268421 TTCCCTTCCCCCAGAGTCACAGG - Intronic
1084318621 11:68360617-68360639 TGACCTTCCCTCAGTGCTTCTGG + Intronic
1085264845 11:75231129-75231151 TTGGCTTCCCCCAGTGGGTCTGG - Intergenic
1085857932 11:80196840-80196862 TTACCTTGTATCAGTGTTTCTGG - Intergenic
1086738410 11:90336772-90336794 TTAGCTTTCCCCAGTGAATCAGG + Intergenic
1090639758 11:128720487-128720509 TCCCCACCCCCCAGTGTTTCTGG - Intronic
1090959863 11:131546664-131546686 TTACATTCCCCCAGTGGTCCAGG - Intronic
1091126965 11:133109137-133109159 TTACCTGCTCCCACTGTGTCTGG + Intronic
1092601504 12:10071337-10071359 TCACCTTCGCCTAATGTTTCAGG + Exonic
1094089556 12:26633068-26633090 TTCCTTTCCCTCAGTGTCTCAGG + Intronic
1095777743 12:46028083-46028105 TTACCATCTCCCAGTCTTTCTGG + Intergenic
1098085304 12:66836141-66836163 TTACCCTCCTGCTGTGTTTCAGG + Intergenic
1101062569 12:100987467-100987489 AGACCTTCCTCCTGTGTTTCAGG + Intronic
1101242920 12:102856227-102856249 TTCCCTTCCCCAAGAGATTCAGG - Intronic
1102889139 12:116544543-116544565 CTTCCTTCTCCCCGTGTTTCTGG + Intergenic
1103065712 12:117895620-117895642 TTATATTCCCCCAGTGATGCAGG - Intronic
1105256894 13:18749773-18749795 ATACCGCCCCCCACTGTTTCAGG + Intergenic
1109056617 13:57557899-57557921 TTTCTTTCCCCCGGTGTTCCAGG + Intergenic
1111476061 13:88749444-88749466 TTTCCTTTCACCAGTGTGTCAGG + Intergenic
1116741809 14:48764906-48764928 TTACATTCCCACAGTGTATGAGG - Intergenic
1122684790 14:103496785-103496807 TCACCTTCCCCCAAAGTGTCAGG - Intronic
1123829580 15:24120834-24120856 TTCCCTTCCCCTATTGTTGCAGG + Intergenic
1123844481 15:24284230-24284252 TTCCCTTCCCCTATTGTTGCAGG + Intergenic
1123859575 15:24450500-24450522 TTCCCTTCCCCTATTGTTGCAGG + Intergenic
1124836284 15:33198795-33198817 ATTCCTTCCCCCAGTGTATAGGG - Intergenic
1126341563 15:47646160-47646182 TAACCTTGCCTCAGTCTTTCTGG + Intronic
1126895523 15:53253140-53253162 GTACTTTCCCCCTGGGTTTCAGG - Intergenic
1127820965 15:62655697-62655719 TTTCCTTCCTCTTGTGTTTCAGG + Intronic
1127821204 15:62657749-62657771 TTTCCTTCCTCTTGTGTTTCAGG + Exonic
1129064440 15:72889326-72889348 GTCCCTTCCCCCAGTGTATAGGG - Intergenic
1134066441 16:11231570-11231592 TTCCCTTCCCTCCTTGTTTCAGG + Intergenic
1134664620 16:16009850-16009872 ATTCCTGGCCCCAGTGTTTCTGG + Exonic
1137384796 16:48031474-48031496 TTACCTTCCCCCAGTATAATGGG + Intergenic
1138480182 16:57297566-57297588 TTACAGTCCCCCAGCGTTTTTGG + Intergenic
1138553642 16:57760172-57760194 TTCCCTGCCCCCACTGCTTCAGG + Intronic
1139461717 16:67127899-67127921 TTACCTTCCCCCAGTGTTTCTGG - Intronic
1139914532 16:70419872-70419894 TTGCCTGGCCCCAGTGGTTCTGG - Intronic
1140790607 16:78387627-78387649 TTTCCTTAGCTCAGTGTTTCAGG - Intronic
1142166554 16:88593239-88593261 TCACCTGCCCCCAGTGATCCTGG + Intronic
1145078963 17:19878839-19878861 TCACCTTCCCCCAGTTTGCCTGG + Intergenic
1147804889 17:43124415-43124437 TTAGCTTTCTCCAATGTTTCTGG + Intronic
1148204847 17:45773834-45773856 TTACCATCCACCAGTCCTTCTGG + Intergenic
1149292795 17:55233698-55233720 TTCCCTTCCCCCACATTTTCTGG - Intergenic
1150893283 17:69179579-69179601 TTTCTTTTCCCCAGTGTTTTGGG - Intronic
1151287755 17:73125627-73125649 GTATCTTCCCCCAGTGGTTGAGG + Intergenic
1152274000 17:79343549-79343571 TTTTCTTCCTCCAGTGTTTTTGG - Intronic
1152904648 17:82963571-82963593 ACACCCTCCACCAGTGTTTCAGG + Intronic
1153928365 18:9855729-9855751 TTTCCTTCTCCCTGTGTTTAAGG + Intronic
1157574395 18:48733867-48733889 CTCCCTTCCCCCAGTCTCTCAGG + Intronic
1159356946 18:67348501-67348523 TCACATTCCCCTAGTGTCTCAGG + Intergenic
1159758526 18:72395597-72395619 TTTCCTTTCCTCTGTGTTTCTGG + Intergenic
1165008304 19:32824166-32824188 TTGGCTTCCCGCAGGGTTTCTGG + Intronic
1166934515 19:46322997-46323019 ATTCCTTCCCCCAGGGTATCGGG + Intronic
1167131062 19:47586246-47586268 ATACCCTCCCTCAGTGTTACAGG - Intergenic
1168514867 19:57002730-57002752 TTACCTGTCCCAAGTGTGTCTGG + Intergenic
925479214 2:4251386-4251408 TGGCCTTTCCCCAGTGCTTCTGG + Intergenic
926678001 2:15642690-15642712 TCACCTTCTCCCAGCCTTTCAGG - Intergenic
928581473 2:32712050-32712072 TAACCTTGCCCCAGTTTGTCTGG + Intronic
928724295 2:34153127-34153149 TTACCTTCCAACATTATTTCTGG + Intergenic
929804532 2:45133004-45133026 TTCCCTTTCCCCAGTGATTTAGG - Intergenic
930485092 2:52001473-52001495 TTTCCTTCCGGCTGTGTTTCTGG + Intergenic
930613369 2:53567501-53567523 TTCCCTTCCTCCTGTGATTCTGG - Intronic
933360428 2:81275906-81275928 TTACTTTCCCACGGTGTTTAAGG - Intergenic
935594077 2:104866424-104866446 TTACCTTTCCCCTTTGTTCCTGG + Intergenic
935782506 2:106520423-106520445 CCACCTACCCCCAGTGTCTCTGG - Intergenic
937541912 2:122966137-122966159 TAACCTTCCCCCACTGCTTCAGG + Intergenic
940168861 2:150804883-150804905 TTAGCTTCCCCTAGTGTCTTTGG - Intergenic
940327084 2:152436691-152436713 ATCACTTCCTCCAGTGTTTCTGG + Intronic
941385126 2:164842111-164842133 TTTCCTTCCCCCAGGGCTTCGGG + Intronic
942293552 2:174496234-174496256 TTATATTCCCCCTGTGATTCTGG - Intergenic
1169060565 20:2657817-2657839 TTAACATTGCCCAGTGTTTCTGG - Intronic
1170039983 20:12029750-12029772 TTTCATGTCCCCAGTGTTTCTGG + Intergenic
1170907406 20:20528507-20528529 TCTCCTTACCCCACTGTTTCTGG - Intronic
1172040353 20:32040485-32040507 TTCTCTTCCCCCAGTGTCTCTGG - Intergenic
1172125320 20:32622145-32622167 TGGCCTTCCCCCAGTGTCCCCGG - Intergenic
1173905272 20:46623545-46623567 TTACTTTCCCCCTCTGTTTTGGG + Intronic
1174368103 20:50068493-50068515 TTCCCTGCCCCCAGTGGCTCAGG - Intergenic
1174521046 20:51131080-51131102 TGACCTCCCACCAGTGTTTGCGG + Intergenic
1174600346 20:51719213-51719235 TTACCTCACCCCTGTGCTTCTGG - Intronic
1174683827 20:52434449-52434471 TTTCCTTCCTCCAGTGGCTCAGG + Intergenic
1176076714 20:63251936-63251958 TTACCTTCCCCCCGGGGCTCCGG - Intronic
1176218401 20:63958814-63958836 TAACCTGCCCCCATTGTTTCTGG - Exonic
1179148854 21:38793470-38793492 TCACCTTCCCCAAGTGTTATGGG + Intergenic
1180157012 21:45982781-45982803 TGACCTTCCTCCTGTGCTTCTGG + Intronic
1180233750 21:46443930-46443952 TGACCTTCCCCCACTGTGTGGGG - Exonic
1181806626 22:25378634-25378656 TGACCTTCCCTTAGTGCTTCTGG - Intronic
1182636542 22:31732052-31732074 TTCCATTCCCCCATTCTTTCAGG + Intronic
953043535 3:39275884-39275906 TCACCCTCCCCCAGTTTTTAAGG - Intronic
954188133 3:48935939-48935961 TTACCTTCCCCTAGAGCCTCTGG + Intronic
958667621 3:97160806-97160828 TTCCCCTTCACCAGTGTTTCAGG + Intronic
959145186 3:102535502-102535524 TTACCTTTCCTCATTGATTCTGG + Intergenic
960447993 3:117771317-117771339 TTCCCTTCCCACACTGTTCCGGG + Intergenic
962819999 3:139039220-139039242 TTATCTTCATCCAGTGTTTCAGG + Intronic
962894982 3:139706081-139706103 CTACCTTCCAGCAGTGTTTATGG + Intergenic
964519743 3:157552019-157552041 CCACCTTCTCCCATTGTTTCTGG + Intronic
966331384 3:178818645-178818667 TTAAACTCTCCCAGTGTTTCAGG - Intronic
967403051 3:189084845-189084867 TGACCTTACCCAAATGTTTCAGG + Intronic
970341013 4:15106843-15106865 TGACCTTTGCCCAGGGTTTCTGG - Intergenic
970968444 4:21953887-21953909 TTACCTTCCCACAGTTCTGCAGG - Intergenic
971231207 4:24801086-24801108 TTAACTTCCCTGAGTGATTCTGG - Intergenic
973208736 4:47590906-47590928 TTACCCTCCCCCTTTATTTCAGG + Intronic
973616285 4:52681505-52681527 TTACCTTCAGCAAGTGTGTCAGG + Intergenic
976731978 4:88271974-88271996 TCTCTTTCCCCCAGTGTTGCAGG + Intronic
977290021 4:95155068-95155090 TTACCTTCCAGCAGAGTTCCTGG - Exonic
979727850 4:123985787-123985809 TTACCTTTCTTCAGTGTTTTTGG + Intergenic
981578573 4:146229963-146229985 TTACCTATCCCCAGTGCCTCTGG + Intergenic
983512555 4:168624485-168624507 TTACCTATGCCCAGTGATTCAGG - Intronic
988813564 5:34808570-34808592 TTTCCTTCCCCCAGCGGCTCAGG + Exonic
988959068 5:36350918-36350940 TTACCTTCCTGCAGTATTTGGGG - Intergenic
990042764 5:51392669-51392691 TTACCTTCCTCCTGTGATTCAGG - Intronic
990489524 5:56290616-56290638 TTAGCTTCCCCGTGGGTTTCTGG - Intergenic
990581696 5:57172732-57172754 TTACGTTCCACCCGTTTTTCAGG + Intergenic
991400364 5:66245277-66245299 TTACCTCCCTCCAGTTCTTCTGG + Intergenic
994328241 5:98474641-98474663 TTTCCTTCTCCCTGTGTTTGGGG - Intergenic
995249964 5:109982213-109982235 TTACTCTCCTTCAGTGTTTCAGG - Intergenic
996310893 5:122103522-122103544 TAACCCTCCCACACTGTTTCTGG + Intergenic
996770409 5:127079803-127079825 TTATTTTCCCCCAGCTTTTCAGG + Intergenic
998845299 5:146302892-146302914 TAAACTTCCCCAAGTGATTCTGG + Intronic
998941507 5:147288182-147288204 TTACCTCCACCCAGTGATTCTGG + Intronic
998942952 5:147304848-147304870 TGACCTTGTCCCAGTGTTTTGGG + Intronic
999822110 5:155238644-155238666 TTACCTTCTTCCAGTGACTCTGG - Intergenic
1003860534 6:10318511-10318533 TTCCCCTTCCCCAGTGTTTTTGG - Intergenic
1004213742 6:13681433-13681455 TTCCCTTTCCCCAGTGTCTGTGG - Intronic
1004942260 6:20571045-20571067 TTACCTTCTACCTGTATTTCTGG + Intronic
1004991867 6:21147192-21147214 TTTTTTTCCCCCAATGTTTCTGG + Intronic
1009626529 6:66143754-66143776 TGAACTTCCCCCAGGGATTCTGG - Intergenic
1010155671 6:72789423-72789445 TTACCTCAGACCAGTGTTTCAGG + Intronic
1010837086 6:80601817-80601839 TGACCTTTCCCCAGTGTTCTTGG + Intergenic
1011025939 6:82869159-82869181 TTTCTTTCCCCTAGTGCTTCTGG + Intergenic
1013504127 6:110782161-110782183 TTATTTTCCTCCTGTGTTTCTGG - Intronic
1016209411 6:141510205-141510227 TTCCCTTCCCTCTGTGATTCAGG + Intergenic
1018734593 6:166678195-166678217 TTACCTTCCCACCTTATTTCCGG + Intronic
1018772784 6:166986581-166986603 ATTCCTTCCCCCAGTGTGTATGG + Intergenic
1019129216 6:169861303-169861325 GTAGCTTTCACCAGTGTTTCAGG + Intergenic
1019266103 7:118363-118385 CTGCCTTCCCCCAGTATCTCAGG + Intergenic
1021148523 7:17120067-17120089 TCACATTTCCTCAGTGTTTCTGG + Intergenic
1022028709 7:26471952-26471974 TTTTCTTCTCCCTGTGTTTCAGG + Intergenic
1023976133 7:45031484-45031506 TTCTCTCCCCCCAGTCTTTCAGG + Intronic
1026168335 7:67931162-67931184 TTACTCTCCCCTAATGTTTCAGG + Intergenic
1027880916 7:83834957-83834979 TTACCTTCTCCCACTGATTTTGG + Intergenic
1030406395 7:109119604-109119626 CTATCTGACCCCAGTGTTTCAGG - Intergenic
1030583843 7:111392456-111392478 TTACCTCCCTCCAGTTTTCCTGG + Intronic
1031482137 7:122290908-122290930 TCACCTCTCCCCATTGTTTCTGG + Intergenic
1032125497 7:129189616-129189638 TAACCTGCCCCCAAAGTTTCGGG - Intronic
1033142594 7:138840769-138840791 TCACCCTCACACAGTGTTTCAGG - Intronic
1033392284 7:140939536-140939558 TTCCCTTCCTACAGTATTTCAGG - Intergenic
1035358987 7:158297355-158297377 TTCCCTTCCCAAAGGGTTTCTGG - Intronic
1035444360 7:158929691-158929713 TCACCTGCCCCCAGAGTTTTAGG + Intronic
1035492539 7:159293025-159293047 TCAGCTTCCCCCACAGTTTCTGG - Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1036486438 8:9183826-9183848 TTCCCTTCGCCTAGTGATTCTGG + Intergenic
1041269539 8:56098073-56098095 TTGCTTTTCCCCAGTGTTCCAGG + Intergenic
1042173416 8:66015070-66015092 TTACCCTCCAGCTGTGTTTCTGG - Intergenic
1043199944 8:77354367-77354389 TTATCTTCTCACAGTTTTTCTGG - Intergenic
1044550374 8:93505497-93505519 TTACAATCCCCCAGTGCTCCGGG + Intergenic
1044565374 8:93656721-93656743 TGACTATCCCCCAGTGTTGCTGG - Intergenic
1047006601 8:120626818-120626840 TTACCTTCCCTAAGTTCTTCTGG + Intronic
1047551390 8:125876376-125876398 TTACATTCCCCCAGTGTTCCAGG + Intergenic
1047743679 8:127827693-127827715 TTTCCTTCCCCCTTTCTTTCTGG + Intergenic
1048195408 8:132328095-132328117 GTACCTTCCCTCACTGGTTCAGG - Intronic
1048362453 8:133709761-133709783 TTACCATCTCACAGTTTTTCAGG - Intergenic
1048654573 8:136521878-136521900 GTAACTTCCCCCTGTGTTTGTGG - Intergenic
1049353624 8:142177266-142177288 TTCCCGGCCCCCAGGGTTTCCGG + Intergenic
1050790103 9:9457764-9457786 TTATCTTCCCCCTGTATTTGGGG - Intronic
1053235015 9:36445626-36445648 TCACCATCCTCCAGTGGTTCTGG - Intronic
1057044275 9:91872829-91872851 TTACTTTTCCCCAGTGTGTAAGG - Intronic
1057998006 9:99837771-99837793 CTAGCTTCCCCCAGTGAGTCAGG + Intronic
1058349107 9:103999838-103999860 TAACCTTCCACCCGTTTTTCGGG - Intergenic
1062496132 9:136832612-136832634 TCAGTTTCCCCCAGTGTTTTTGG + Intronic
1062571985 9:137190006-137190028 CTACCTTCCCTCACTGTCTCAGG + Exonic
1185577027 X:1182578-1182600 TGACCTTCCCCCATTTTTTATGG + Intergenic
1185761402 X:2691774-2691796 TTATCTACCCCCAGGGTTTGGGG + Intronic
1188515582 X:30982001-30982023 TTACCTTCCCTGAGTTTTTCTGG - Intergenic
1188851017 X:35132167-35132189 TCATTTTCCCCCAGTGTTCCTGG - Intergenic
1190913640 X:54794051-54794073 CTATCTTCCCCCAGTGCTCCTGG - Intronic
1192929546 X:75791701-75791723 TGGCCTTTCCCCAGTGCTTCTGG - Intergenic
1196581255 X:117381727-117381749 TCTCCTGCCCTCAGTGTTTCTGG - Intergenic
1198151741 X:133917306-133917328 TTGCCTGCCTCCATTGTTTCAGG - Intronic
1199683616 X:150244574-150244596 GGACCTGCCCCCAGAGTTTCTGG - Intergenic
1200287132 X:154834054-154834076 CCAGCTTCCTCCAGTGTTTCGGG - Intronic
1200500629 Y:3943890-3943912 TTTCCTTCTCCCAGAGATTCTGG + Intergenic