ID: 1139465337

View in Genome Browser
Species Human (GRCh38)
Location 16:67151057-67151079
Sequence AGCACTCCGGCCTCAGAGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139465323_1139465337 28 Left 1139465323 16:67151006-67151028 CCAGCTGTGCGCGCCCAGACTTC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1139465337 16:67151057-67151079 AGCACTCCGGCCTCAGAGTGGGG 0: 1
1: 0
2: 3
3: 12
4: 140
1139465325_1139465337 15 Left 1139465325 16:67151019-67151041 CCCAGACTTCTGGAGCTCAGCTC 0: 1
1: 0
2: 5
3: 22
4: 231
Right 1139465337 16:67151057-67151079 AGCACTCCGGCCTCAGAGTGGGG 0: 1
1: 0
2: 3
3: 12
4: 140
1139465326_1139465337 14 Left 1139465326 16:67151020-67151042 CCAGACTTCTGGAGCTCAGCTCC 0: 1
1: 1
2: 0
3: 29
4: 258
Right 1139465337 16:67151057-67151079 AGCACTCCGGCCTCAGAGTGGGG 0: 1
1: 0
2: 3
3: 12
4: 140
1139465329_1139465337 -7 Left 1139465329 16:67151041-67151063 CCGCCCCGGCGCCAGGAGCACTC 0: 1
1: 0
2: 2
3: 19
4: 155
Right 1139465337 16:67151057-67151079 AGCACTCCGGCCTCAGAGTGGGG 0: 1
1: 0
2: 3
3: 12
4: 140
1139465330_1139465337 -10 Left 1139465330 16:67151044-67151066 CCCCGGCGCCAGGAGCACTCCGG 0: 1
1: 0
2: 1
3: 9
4: 90
Right 1139465337 16:67151057-67151079 AGCACTCCGGCCTCAGAGTGGGG 0: 1
1: 0
2: 3
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139465337 Original CRISPR AGCACTCCGGCCTCAGAGTG GGG Exonic