ID: 1139465378

View in Genome Browser
Species Human (GRCh38)
Location 16:67151221-67151243
Sequence CACTCCCGCGTCTCTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139465367_1139465378 7 Left 1139465367 16:67151191-67151213 CCTGGTTAGCTCCCCCAACTATC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1139465378 16:67151221-67151243 CACTCCCGCGTCTCTGGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1139465368_1139465378 -4 Left 1139465368 16:67151202-67151224 CCCCCAACTATCCACTCCCCACT 0: 1
1: 0
2: 0
3: 42
4: 349
Right 1139465378 16:67151221-67151243 CACTCCCGCGTCTCTGGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1139465366_1139465378 8 Left 1139465366 16:67151190-67151212 CCCTGGTTAGCTCCCCCAACTAT 0: 1
1: 0
2: 1
3: 4
4: 68
Right 1139465378 16:67151221-67151243 CACTCCCGCGTCTCTGGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1139465365_1139465378 9 Left 1139465365 16:67151189-67151211 CCCCTGGTTAGCTCCCCCAACTA 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1139465378 16:67151221-67151243 CACTCCCGCGTCTCTGGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1139465369_1139465378 -5 Left 1139465369 16:67151203-67151225 CCCCAACTATCCACTCCCCACTC 0: 1
1: 0
2: 0
3: 33
4: 336
Right 1139465378 16:67151221-67151243 CACTCCCGCGTCTCTGGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1139465371_1139465378 -7 Left 1139465371 16:67151205-67151227 CCAACTATCCACTCCCCACTCCC 0: 1
1: 1
2: 5
3: 77
4: 729
Right 1139465378 16:67151221-67151243 CACTCCCGCGTCTCTGGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1139465370_1139465378 -6 Left 1139465370 16:67151204-67151226 CCCAACTATCCACTCCCCACTCC 0: 1
1: 0
2: 1
3: 33
4: 361
Right 1139465378 16:67151221-67151243 CACTCCCGCGTCTCTGGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139465378 Original CRISPR CACTCCCGCGTCTCTGGAGT GGG Intergenic
900082613 1:869895-869917 CCCTCCCGCGGCTCCGGAGCCGG + Intergenic
900681042 1:3916479-3916501 CACCCCAGCGTCTCTGAATTGGG + Intergenic
902451262 1:16498566-16498588 CCCGGCAGCGTCTCTGGAGTGGG - Intergenic
902501607 1:16914716-16914738 CCCGGCAGCGTCTCTGGAGTGGG + Intronic
906475585 1:46167312-46167334 CACACCCTCGTCTCTGGACCAGG - Intronic
909264529 1:73539530-73539552 CCCTCTCCCCTCTCTGGAGTTGG - Intergenic
912270173 1:108200405-108200427 CACTTCCGGCTCTCTGGAGGCGG - Intronic
922597860 1:226827649-226827671 CACACCCGGCTCTATGGAGTGGG + Intergenic
1063307405 10:4917538-4917560 GACTCCGGCGTTACTGGAGTCGG + Intergenic
1078434780 11:11315488-11315510 CACTCCAGAGTCTCTGGGCTGGG - Intronic
1083308463 11:61772647-61772669 CACTCCAGCCTCTCTGGCATGGG + Intronic
1084426799 11:69088535-69088557 TAGTCCTGCTTCTCTGGAGTAGG + Intronic
1087683586 11:101239918-101239940 AACTCCCGACTCTTTGGAGTTGG - Intergenic
1087762343 11:102114203-102114225 CTCTCCAGCTTCTCTGCAGTTGG + Exonic
1089581374 11:119483670-119483692 CCCTCCCGCCTGTCTGGACTTGG + Intergenic
1090130936 11:124141546-124141568 CACTCCCTGCTCTCTGCAGTGGG - Intronic
1094807626 12:34107861-34107883 CCCTCCCGCGGCTCCGGAGCTGG + Intergenic
1096069587 12:48767574-48767596 CCCTCCCAAGTCTCTGGTGTTGG - Exonic
1098288534 12:68933253-68933275 CACCCGCGCGGCTCCGGAGTGGG - Intronic
1103775762 12:123365119-123365141 CATTACCGCGGCTCTGGGGTGGG + Intergenic
1108638132 13:52356613-52356635 CCCTCCCCAGTCTCTGGAGTAGG + Intergenic
1109410960 13:61969136-61969158 CACTCCTCAGTCTCTGGAGTAGG - Intergenic
1109860194 13:68188211-68188233 AACTTCTGTGTCTCTGGAGTGGG - Intergenic
1114031414 14:18583838-18583860 CCCTCCCGCGGCTCCGGAGCCGG + Intergenic
1114459845 14:22879304-22879326 CTCTCCCCAGTCTCTGGAGAGGG - Exonic
1114672217 14:24417348-24417370 CACCCCAGCTTCTCTGGGGTTGG - Exonic
1119727994 14:76933655-76933677 GACTCCCGAGTTTCTGGTGTGGG - Intergenic
1121006511 14:90494130-90494152 GAGTCCCGTGTCTCTGGGGTAGG - Intergenic
1122823324 14:104357901-104357923 CAGTGCCGCAGCTCTGGAGTTGG + Intergenic
1202893740 14_KI270722v1_random:183600-183622 CACTCCGGTGTCTCTGGAACTGG - Intergenic
1131596309 15:93801670-93801692 CCCTCCCTCTTCTCTGCAGTAGG + Intergenic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG + Intronic
1139465378 16:67151221-67151243 CACTCCCGCGTCTCTGGAGTGGG + Intergenic
1140775756 16:78247661-78247683 CACTCCTGCGTCTCTGGCCTTGG + Intronic
1141916500 16:87100849-87100871 GACTCCCGAGGCTCTGGAGCAGG - Intronic
1143302646 17:5922329-5922351 CAATCCAGCCTCTCTGGGGTCGG - Intronic
1147337844 17:39738020-39738042 CACTCCCGCTTCTCTACAGGTGG - Intronic
1152174899 17:78781523-78781545 CACACCCGCGTCTCGGCAGGCGG + Intronic
1156398889 18:36723141-36723163 CTCTCCTGGGTCTCTGGATTAGG + Intronic
1156982425 18:43306158-43306180 CAACCCCAAGTCTCTGGAGTAGG + Intergenic
1165846847 19:38823557-38823579 AACTCCCGACTCTTTGGAGTTGG + Intronic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
930033825 2:47073570-47073592 GATTCCCGCGTCTCTGGCTTGGG - Intronic
931789232 2:65648653-65648675 GACTCCCTCGTCTATCGAGTGGG - Intergenic
932593943 2:73082806-73082828 CCTGCCCGCATCTCTGGAGTCGG - Intronic
938496786 2:131801958-131801980 CCCTCCCGCGGCTCCGGAGCCGG - Intergenic
940993907 2:160126499-160126521 GACTCCTGCGTCTCTGAAGATGG - Exonic
942043289 2:172084914-172084936 CTCTGCCGCATCCCTGGAGTCGG - Intronic
942459459 2:176159362-176159384 CATTCCTGCGCCTCTGGAGTGGG + Intronic
942578663 2:177393008-177393030 CACTCCCGCCGCGCAGGAGTCGG + Exonic
1168756415 20:321541-321563 CACTCCCCCATCTCTGGTCTTGG + Intergenic
1169881264 20:10349874-10349896 CACTCACACGTATCTGAAGTTGG + Intergenic
1175795037 20:61765966-61765988 CACCCCCGCGCCTCTGGGATTGG + Intronic
1179024087 21:37666120-37666142 CACTCCCGCTTCTGTGGTTTGGG - Intronic
1179904296 21:44414242-44414264 CACTGCTGCGTCTCTTGAGCTGG + Intronic
1180455527 22:15510895-15510917 CCCTCCCGCGGCTCCGGAGCCGG + Intergenic
1184135782 22:42549072-42549094 CACTCCTGTGTCTCTGGATGTGG + Intergenic
953435827 3:42876363-42876385 CACTCCCTCATCTGTGAAGTAGG + Intronic
954149362 3:48649705-48649727 CTCTCCCTTGTCTCTGGGGTTGG + Intronic
954794391 3:53154220-53154242 CACTCCCCAGACTCTGGAGAAGG - Intergenic
963927737 3:150968932-150968954 CACCCCCGCGTCTCTGTACAGGG + Intronic
967258119 3:187613827-187613849 CACACCAGCGGCTCTGGTGTTGG - Intergenic
973691991 4:53444998-53445020 CCCTTCCACTTCTCTGGAGTAGG - Intronic
974526287 4:63053602-63053624 AACTGCCGAGTCTTTGGAGTTGG + Intergenic
986834064 5:11614862-11614884 CATTTCCACATCTCTGGAGTGGG + Intronic
987211857 5:15691880-15691902 GACTCCCGCATCGCTGGATTTGG + Intronic
1005456646 6:26026362-26026384 ACCTCCCCCTTCTCTGGAGTAGG - Intergenic
1006393518 6:33772561-33772583 CCCTCCTGTGCCTCTGGAGTGGG + Exonic
1007545246 6:42688352-42688374 TACTCCTGTGGCTCTGGAGTGGG + Exonic
1016728981 6:147407267-147407289 CTCTCCAGCTTCTCTGCAGTTGG + Intergenic
1018893638 6:167999127-167999149 CACGGCCGCGTCTCAGGAGCTGG + Exonic
1028641215 7:93043823-93043845 CACTCCCAAGGCTCTGGGGTCGG + Intergenic
1032663580 7:134012778-134012800 CACTCCAGCGTCTCAACAGTGGG - Intronic
1035888916 8:3323717-3323739 CCCTCCTGGGTCTCTGGGGTTGG - Intronic
1035888933 8:3323786-3323808 CCCTCCTGGGTCTCTGGGGTTGG - Intronic
1035889027 8:3324215-3324237 CCCTCCCGGGTCTCTGGGGTTGG - Intronic
1047720540 8:127634950-127634972 AACTCCCACGTCTCTGGGTTGGG - Intergenic
1049493023 8:142915002-142915024 CACTCCAGGGTCTCTGGGGCTGG + Intronic
1050504080 9:6329079-6329101 CACTCCCCGGAATCTGGAGTGGG - Exonic
1051867216 9:21696087-21696109 CACTCCTGAGGCTCTGGAGGAGG - Intergenic
1057510575 9:95676257-95676279 CCCTCCCACGTTTCTGCAGTGGG - Intergenic
1062288311 9:135783457-135783479 CTCTCTCCCGTTTCTGGAGTCGG - Intronic