ID: 1139465481

View in Genome Browser
Species Human (GRCh38)
Location 16:67151689-67151711
Sequence GCACTTCAGCCTGTCTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139465477_1139465481 4 Left 1139465477 16:67151662-67151684 CCCAGTCTGCTTTAATTTCACAG No data
Right 1139465481 16:67151689-67151711 GCACTTCAGCCTGTCTCCCCGGG No data
1139465478_1139465481 3 Left 1139465478 16:67151663-67151685 CCAGTCTGCTTTAATTTCACAGG No data
Right 1139465481 16:67151689-67151711 GCACTTCAGCCTGTCTCCCCGGG No data
1139465476_1139465481 8 Left 1139465476 16:67151658-67151680 CCAACCCAGTCTGCTTTAATTTC No data
Right 1139465481 16:67151689-67151711 GCACTTCAGCCTGTCTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139465481 Original CRISPR GCACTTCAGCCTGTCTCCCC GGG Intergenic
No off target data available for this crispr