ID: 1139467094

View in Genome Browser
Species Human (GRCh38)
Location 16:67159845-67159867
Sequence TGGGAACCCAGGCCCCGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139467094_1139467103 13 Left 1139467094 16:67159845-67159867 CCTCGGCGGGGCCTGGGTTCCCA 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1139467103 16:67159881-67159903 CCGCTCTACTCCGCCGCTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 44
1139467094_1139467108 26 Left 1139467094 16:67159845-67159867 CCTCGGCGGGGCCTGGGTTCCCA 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1139467108 16:67159894-67159916 CCGCTTCCGGGTGTGCGCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 102
1139467094_1139467104 14 Left 1139467094 16:67159845-67159867 CCTCGGCGGGGCCTGGGTTCCCA 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1139467104 16:67159882-67159904 CGCTCTACTCCGCCGCTTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1139467094_1139467106 23 Left 1139467094 16:67159845-67159867 CCTCGGCGGGGCCTGGGTTCCCA 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1139467106 16:67159891-67159913 CCGCCGCTTCCGGGTGTGCGCGG 0: 1
1: 0
2: 1
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139467094 Original CRISPR TGGGAACCCAGGCCCCGCCG AGG (reversed) Exonic
900641238 1:3689033-3689055 GCGGAACCCAGGCCCCGCCTCGG + Intronic
901791306 1:11654862-11654884 TGGAAAGCGAGGCCCCGCCCCGG - Exonic
902608256 1:17581455-17581477 GTGGAATCCAGGCCCCGCCTGGG + Intronic
903515699 1:23909406-23909428 TGGGAACCCACGCACAGCCAAGG - Intronic
903554272 1:24181698-24181720 CAGGAACCCAGGCCCAGCCCAGG + Intronic
904233221 1:29094826-29094848 TTGGAACCAAGGCCCCACAGAGG - Intronic
905648268 1:39639674-39639696 CGGGAAGTCAGGCCCCGCCCCGG + Exonic
905896277 1:41547868-41547890 TGGGCTCCCAGGCCCCTCCCAGG + Intronic
907275203 1:53313189-53313211 TGGGAAAGCAGGCCACGCCCTGG - Intronic
912411818 1:109485093-109485115 TGGGAGCCCAGGCCACCCTGGGG + Intronic
915470484 1:156123000-156123022 TGAGATCCCAGGCCCGGCAGGGG + Intronic
919386837 1:196933725-196933747 CGGGAACCCGGGCTGCGCCGCGG + Intronic
919464278 1:197911773-197911795 CGGGAGCCCAGGGCACGCCGCGG + Intergenic
921229188 1:213051338-213051360 AGGGAAACCCGGCGCCGCCGCGG - Exonic
1064060091 10:12129828-12129850 TGGGAACGCAGGCCCCGCCTGGG + Intronic
1065214868 10:23439490-23439512 TGGGACCCGGGGCCCCGGCGGGG - Exonic
1069556978 10:69404921-69404943 TGGGGACACAGCCCCCTCCGAGG - Exonic
1069627186 10:69875555-69875577 TGGGAACCCTGGCTCCACCGAGG - Intronic
1069893146 10:71664423-71664445 AGGGAAGCCAGGCCCAGCCCTGG - Intronic
1070948129 10:80409400-80409422 TGGGAACCCCGGTCCGGCAGTGG - Intronic
1074890785 10:117735262-117735284 TGAGAACCCAGGCGCGCCCGGGG - Intergenic
1075343012 10:121662184-121662206 TGGGAAACCAGGCTCAGCAGAGG + Intergenic
1076422139 10:130339049-130339071 TGGGAAGCCTGGCCCTACCGTGG - Intergenic
1076603924 10:131677240-131677262 TGGGAACCTGGGCCCCTCCCTGG - Intergenic
1077320518 11:1938883-1938905 TGGGCATCCAGGCACCGCCCTGG - Intergenic
1077408773 11:2394018-2394040 TCGGCACCCAGGACCCTCCGGGG + Intronic
1081775599 11:45674237-45674259 TGGGACCCCAGGTCCCTCCTGGG + Intergenic
1084175832 11:67421615-67421637 TTGGCACCCAGGACCCGCAGAGG + Intronic
1089554362 11:119307511-119307533 GGGGAAACCAGGCCCTGCAGAGG - Exonic
1092605268 12:10111705-10111727 CGAGAACCCAGGCCGCCCCGAGG + Intergenic
1096179300 12:49541810-49541832 TGGGTGCCAAGGCCCCGCCCGGG - Intronic
1097873911 12:64625722-64625744 TGGGAACCCAGCCACGGCCAGGG - Intronic
1102022557 12:109694363-109694385 AGGGAACCCGGGCCCCTCTGAGG + Intergenic
1103001173 12:117386442-117386464 TGGGGACCCAGGCCTGGCTGGGG + Intronic
1104376337 12:128267588-128267610 TGGGATCCGAGCCCCCGCCGAGG - Intronic
1107796065 13:44053046-44053068 TGGGCAGCCAGGGCCAGCCGTGG + Intergenic
1113503752 13:110798877-110798899 TGAGAACCCAGACTCCGCCAGGG - Intergenic
1113820273 13:113208722-113208744 TGGCGCCCCCGGCCCCGCCGCGG + Intronic
1116592666 14:46799045-46799067 TGGGAACCCAGTCACTGCTGTGG - Intergenic
1117141067 14:52791558-52791580 TGGGAACCGCGGCCCAGACGTGG + Exonic
1121320543 14:92989269-92989291 TGGGATCCCAGGCCTCCCTGGGG - Intronic
1122888819 14:104723463-104723485 TGGGAACCTGGGCCCCACGGTGG + Intergenic
1123000945 14:105293767-105293789 TTGGAAGCCAGGCCCCACGGGGG - Intronic
1202848699 14_GL000225v1_random:2061-2083 TGGGATCCCAGGGCCAGCCCAGG + Intergenic
1124902247 15:33835242-33835264 TGGGACCCCGCGCCCCTCCGAGG - Intronic
1124959988 15:34386809-34386831 GGGGCACCCAGTCCCCGCTGCGG + Intronic
1124976617 15:34533030-34533052 GGGGCACCCAGTCCCCGCTGCGG + Intronic
1125647451 15:41284228-41284250 TTGGAACCCCCGCCCAGCCGAGG - Intergenic
1125745358 15:41993944-41993966 GAGGAACTCAGGCCCAGCCGGGG - Intronic
1128161092 15:65423101-65423123 TGGCCACCCTGGCCCCGCCGGGG + Intergenic
1129348214 15:74937915-74937937 CCGGACCCCCGGCCCCGCCGTGG - Exonic
1129389909 15:75215295-75215317 TGGGAGCCCAGGCCTCACTGAGG - Intergenic
1129761538 15:78131633-78131655 TGTGAGCCCGGGTCCCGCCGTGG + Intronic
1132471363 16:105369-105391 TAGGAAGCCAGGCCCATCCGTGG - Intronic
1132643619 16:988965-988987 TGGGACCTCAGGCCCCTCCCAGG - Intergenic
1132685015 16:1158612-1158634 TCGGGACTCAGGCCCCGCTGGGG + Intronic
1132721725 16:1319872-1319894 TGGGAACACAGGCCCCAGGGTGG - Intronic
1132747387 16:1442719-1442741 TGGGAAGCCTGGGCCCGCTGCGG - Intronic
1132785948 16:1657029-1657051 AGGGAAGCCAGGCCCAGCCTTGG + Intronic
1133033633 16:3023072-3023094 TGGGAACCCAGGAGCCCCTGGGG - Intronic
1133275345 16:4634860-4634882 AGGGATGCCAGGCCCCGCTGAGG - Intronic
1137761644 16:50945648-50945670 TGGGAACCATGGCCCTGCTGAGG - Intergenic
1139467094 16:67159845-67159867 TGGGAACCCAGGCCCCGCCGAGG - Exonic
1139923373 16:70473075-70473097 TGGGACCCCAGGACCTGCTGTGG + Exonic
1141979150 16:87539027-87539049 TGAGCACACAGGCCCCGCCGGGG - Intergenic
1143400596 17:6639992-6640014 TGGGACCCCAGGCTCCATCGAGG - Intronic
1143631440 17:8142575-8142597 CGGGAGCCCAGGCCCCGTCTTGG - Intronic
1144586976 17:16492700-16492722 GCGGATCCCAGGCCCCACCGAGG - Intergenic
1144623740 17:16833935-16833957 TGTGACCCCTGACCCCGCCGTGG + Intergenic
1144882690 17:18438781-18438803 TGTGACCCCTGACCCCGCCGTGG - Intergenic
1145149544 17:20505605-20505627 TGTGACCCCTGACCCCGCCGTGG + Intergenic
1147920456 17:43913579-43913601 TGGGCACCCAGGCCGTGCCCTGG + Intergenic
1148336062 17:46842024-46842046 GGCCAGCCCAGGCCCCGCCGAGG - Intronic
1148694840 17:49552577-49552599 AGGGCTCCCAGGCCCCACCGCGG - Intergenic
1152103519 17:78316176-78316198 AGGGGACCCAGGCGCGGCCGTGG - Intergenic
1152301309 17:79496577-79496599 TGGGAAGCCAAGCCCCGCCAGGG - Intronic
1152316430 17:79583343-79583365 TGGGGTCCCAGGACCTGCCGTGG - Intergenic
1152427185 17:80224813-80224835 TGGCAACCCTAGCCCCGCCCAGG + Intronic
1152534153 17:80940839-80940861 TGGGAACCCAGCCACCGCCTGGG + Intronic
1152573845 17:81131717-81131739 TGGGACCCCAGGCACAGCCCGGG - Intronic
1157802017 18:50628376-50628398 AGGGAACCCAGGCCCCAGGGAGG - Intronic
1160818254 19:1046233-1046255 TTGGGACCCTGGCCCAGCCGCGG + Exonic
1161086691 19:2338741-2338763 TGGGCCCCCAGGTCCCCCCGGGG + Exonic
1161261017 19:3337699-3337721 TGGGAACCCAGGCCCCTCTGTGG - Intergenic
1161738115 19:6004172-6004194 GGGGAGCCCAGGCCCCACCCCGG + Intronic
1162189018 19:8930201-8930223 TGGGCACCCAGGGCCCACTGCGG + Intronic
1164672084 19:30077985-30078007 TGGGCACCCAGCCCCAGCCTGGG + Intergenic
1165448307 19:35868762-35868784 TGGGAGCCCCGGCGCGGCCGAGG + Exonic
1166165409 19:40984319-40984341 TGGGACCTCAGGCCCCTGCGTGG - Intergenic
1166836122 19:45669095-45669117 TGGGAACCCGGGGACCGCCTTGG - Intronic
1167097040 19:47380051-47380073 TGGGAAGCCAGGCCTTCCCGAGG - Intronic
1167293020 19:48634959-48634981 TGGGATCCCAGGCCTCTCCTAGG + Intronic
1167409816 19:49338192-49338214 TGGGAGACCAGGCGACGCCGGGG - Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
926220338 2:10931978-10932000 TGGGACCCCAGGGCCTGCCAGGG - Intergenic
927576750 2:24207329-24207351 TGGCCACCCAGGCCCCTCCCTGG - Intronic
934773309 2:96921622-96921644 TGTGTGCCCAGGCCCAGCCGGGG - Exonic
935182797 2:100705411-100705433 TGGGAAACCAGGCACCCCCCAGG + Intergenic
936946512 2:117935713-117935735 TGGGATCCCAGGGGCCCCCGTGG - Intronic
938367195 2:130744407-130744429 AGGGAGCCCAGGCCCAGACGCGG + Intergenic
941748885 2:169114932-169114954 TGGGAACACAGGCCCTGGTGAGG + Intergenic
947590030 2:231380197-231380219 TGGGATCCCAGGCCACACCAGGG - Intergenic
947861011 2:233357224-233357246 TGGGAACCCTGGCCTTGCTGGGG + Intronic
1168948731 20:1782157-1782179 AGGGAGCCCAGGGCCCGCCCAGG + Intergenic
1169066029 20:2694409-2694431 TGGGAACCCAGCACCCGCGCCGG + Intronic
1170904713 20:20503058-20503080 TGGGAAAGCAGGCCCCTCTGAGG - Intronic
1172588282 20:36100231-36100253 GGGGAAGCCAGGCCCCTCCTTGG + Intronic
1173908680 20:46647818-46647840 TGGAAACCCAGGCCCCAAAGAGG + Intronic
1174476883 20:50801966-50801988 TGGGGACCCAGGCCCTGGTGTGG - Intronic
1175935994 20:62514268-62514290 AGGGTGCCCAGGGCCCGCCGGGG + Intergenic
1175945760 20:62558014-62558036 TGGGCACCCAGGGGCCTCCGGGG - Intronic
1179271512 21:39854748-39854770 TGGTAACCCTGGCGCCGCCCTGG + Intergenic
1179804048 21:43826050-43826072 TGGGTCTCCAGGCCCCGCCATGG + Intergenic
1179807989 21:43852179-43852201 TAGGTGCCCAGGCCCCTCCGTGG + Intergenic
1180185492 21:46137185-46137207 TGTGAATCCAGGCCCCCACGTGG + Intronic
1181313790 22:21959500-21959522 TGGGGACCCAGGTCCCCACGTGG - Intronic
1181902675 22:26169311-26169333 TGGCACCCCCGGCGCCGCCGCGG + Intergenic
1182098136 22:27639464-27639486 TGGGACCCCAGGCCCCCCACGGG - Intergenic
1183429666 22:37757941-37757963 GGGGCACCCAGGCCCCGGCGCGG - Exonic
1183468726 22:37994190-37994212 AGGGAACCCAGGCACAGCCCTGG + Intronic
1183541089 22:38429785-38429807 TGGGAACCCAGGCCCAGTCCTGG - Intronic
1184175295 22:42785575-42785597 GGGGCACCCAGCCCCCGCTGTGG - Intergenic
1184550639 22:45202618-45202640 TGGGGACCCAGGCCCGGCCCTGG - Intronic
1184763331 22:46557986-46558008 TGGGAGCCCAGGGCCTGCCTGGG - Intergenic
1185229263 22:49670896-49670918 TTGGAACCCAGACCCCGGCTGGG + Intergenic
950650205 3:14402526-14402548 TGGAAGCCCCGGCCCCGCCCCGG + Intergenic
953032206 3:39186299-39186321 TGGGGCCCCAGGCCCCGGAGGGG + Exonic
953577233 3:44122790-44122812 TGGAAGGCCAGGCCCCTCCGGGG + Intergenic
954431992 3:50475790-50475812 TGGGAGCCCAGGCCCAGGAGGGG - Intronic
954506769 3:51082972-51082994 TGGGTACTCAGGCCCCGTGGTGG - Intronic
954779193 3:53046409-53046431 CGGGAACCCAGTGCCCGCCCTGG + Intronic
966201065 3:177359868-177359890 CGGGAACCCGAGCCCCGCCTGGG + Intergenic
968758549 4:2428994-2429016 TGGGAACCCTGGCGCCTCCTGGG + Intronic
968771152 4:2508128-2508150 TGGGACACCATGCCCAGCCGAGG + Intronic
969393988 4:6909299-6909321 CCGGAGCTCAGGCCCCGCCGCGG - Intronic
976431351 4:84966323-84966345 GGGGCTCCCGGGCCCCGCCGCGG - Exonic
983296394 4:165873771-165873793 TGAGCACCCCGGTCCCGCCGAGG + Exonic
985445883 4:190021203-190021225 GGGGATCCCAGGGCCCGCCCAGG - Intergenic
985549324 5:525021-525043 TGGGAGCCCAGGGGCCCCCGTGG + Intergenic
985749985 5:1668150-1668172 AGGGAACCCAGGCCCCAAGGGGG - Intergenic
986336912 5:6762236-6762258 TGGGAACACTGGCCCCACCTGGG + Intergenic
993899914 5:93578481-93578503 CGGGAGCCCAGGCCCCGGCAAGG + Intergenic
1001543745 5:172557249-172557271 TGGGAACACAAGCCGCGCAGAGG + Intergenic
1014977380 6:127904338-127904360 TGGGAAGCCAGGGCCAGCCAAGG + Intronic
1016340924 6:143060823-143060845 TGGGAACCCGGGCGCGGGCGCGG - Intronic
1018066925 6:160131085-160131107 AGGGAACCCAGGCCTGGCTGGGG + Intronic
1019572055 7:1717552-1717574 TGGGAGCCCAGGCCTGGCTGGGG + Intronic
1019747903 7:2710772-2710794 GGGGAACCCAGGCGCAGCCATGG + Intronic
1022449827 7:30504523-30504545 TGGGCATCCCGGCCCCGGCGTGG + Intronic
1022484201 7:30765492-30765514 GGGGAACCCAGGCCCCAGCCAGG - Intronic
1024951019 7:54860526-54860548 TGGGGAGCCAGGCTCTGCCGAGG - Intergenic
1030082400 7:105789156-105789178 GGGAAACCCAGGCACTGCCGAGG - Intronic
1034409758 7:150934187-150934209 GGTGAAACCAGGCCCCGCAGTGG + Intergenic
1034434764 7:151058155-151058177 TGGGAACCACGGCGCCGCGGCGG - Exonic
1035075427 7:156174494-156174516 TGGGAACCCTGCCCCCTCCCAGG - Intergenic
1035331896 7:158101948-158101970 TGGGACCTCAGGGCCCACCGTGG - Intronic
1036746239 8:11412141-11412163 TGGGAACCCAGGCCATGGAGGGG - Intronic
1037781555 8:21872719-21872741 TGGGAACCCAGGCCTGGCAGAGG + Intergenic
1038513610 8:28163878-28163900 TGGGAGCACAGGCCCCACCCAGG - Intronic
1049174089 8:141180801-141180823 TGGGAACGCCTCCCCCGCCGAGG - Exonic
1053121115 9:35548110-35548132 TGGGGAGCCAGGCCCGGCCATGG - Exonic
1053180238 9:35962239-35962261 TGGGCTCCCAGTGCCCGCCGGGG - Intergenic
1053360875 9:37485958-37485980 CGGGAGCCCAGGCCGCGCTGCGG - Exonic
1054713703 9:68536992-68537014 TGGGGACCCAAGGCCAGCCGGGG + Exonic
1056758033 9:89394596-89394618 TGGGTGCCCTTGCCCCGCCGTGG - Intronic
1057129322 9:92642134-92642156 TGGGCCCCCAGGCCCCACTGCGG + Intronic
1057869721 9:98708727-98708749 GGGGAAGCCATGCCGCGCCGCGG + Exonic
1060200936 9:121651558-121651580 CGGGTCCCCAGCCCCCGCCGCGG + Intronic
1060229680 9:121817642-121817664 TGGAAACCCACGTCCCGCAGAGG - Intergenic
1060267083 9:122118148-122118170 TGGGCACCCAGGTCCCGCTGAGG - Intergenic
1061064213 9:128267378-128267400 GGGGCACCCAGCCCCCGCTGTGG + Intronic
1061576978 9:131513485-131513507 AGGGGACCCAGGCCTGGCCGCGG + Intronic
1061626813 9:131845394-131845416 TGAGAATCCAGGCCCCTCCTTGG - Intergenic
1062026010 9:134341128-134341150 TGTGACCGCAGGCCCCGCCGTGG + Intronic
1062549115 9:137077877-137077899 TGGGAACCGAGGCCGCGCTCGGG + Intronic
1185505358 X:629680-629702 TGGGTCCCCAGGCCCCGCCGGGG + Intronic
1192207888 X:69108211-69108233 TGTGAAGCCTGGCCCCGCAGTGG + Intergenic