ID: 1139467110

View in Genome Browser
Species Human (GRCh38)
Location 16:67159900-67159922
Sequence CCGGGTGTGCGCGGAGGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 219}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139467100_1139467110 6 Left 1139467100 16:67159871-67159893 CCGCCAGGCTCCGCTCTACTCCG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1139467110 16:67159900-67159922 CCGGGTGTGCGCGGAGGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 219
1139467098_1139467110 12 Left 1139467098 16:67159865-67159887 CCACGCCCGCCAGGCTCCGCTCT 0: 1
1: 0
2: 1
3: 22
4: 274
Right 1139467110 16:67159900-67159922 CCGGGTGTGCGCGGAGGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 219
1139467101_1139467110 3 Left 1139467101 16:67159874-67159896 CCAGGCTCCGCTCTACTCCGCCG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1139467110 16:67159900-67159922 CCGGGTGTGCGCGGAGGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 219
1139467102_1139467110 -4 Left 1139467102 16:67159881-67159903 CCGCTCTACTCCGCCGCTTCCGG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1139467110 16:67159900-67159922 CCGGGTGTGCGCGGAGGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 219
1139467095_1139467110 21 Left 1139467095 16:67159856-67159878 CCTGGGTTCCCACGCCCGCCAGG 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1139467110 16:67159900-67159922 CCGGGTGTGCGCGGAGGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 219
1139467099_1139467110 7 Left 1139467099 16:67159870-67159892 CCCGCCAGGCTCCGCTCTACTCC 0: 1
1: 0
2: 0
3: 19
4: 236
Right 1139467110 16:67159900-67159922 CCGGGTGTGCGCGGAGGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 219
1139467097_1139467110 13 Left 1139467097 16:67159864-67159886 CCCACGCCCGCCAGGCTCCGCTC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1139467110 16:67159900-67159922 CCGGGTGTGCGCGGAGGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139467110 Original CRISPR CCGGGTGTGCGCGGAGGCGC TGG Exonic
900190162 1:1349772-1349794 GCGGGCGTGCACGGAGGCGTCGG + Intergenic
900530520 1:3150859-3150881 CCGGGTGGGGGCGGGGGGGCTGG + Intronic
900714259 1:4133769-4133791 CCGGGGGTGGGCGGTGGTGCCGG + Intergenic
901489284 1:9588655-9588677 CCGGGTGGGCGGGGCGGCGGCGG - Intergenic
901822777 1:11840792-11840814 CTGGGTGTGAGCAGAGGCTCTGG + Exonic
902348207 1:15834935-15834957 CGGGGTGTGGGCGGAGCGGCGGG - Intergenic
902505976 1:16939204-16939226 CCGGGTGGGGGCGGGGGCGGGGG + Intronic
902520338 1:17012022-17012044 CCCGGTGTGTGCGGAGGAGCAGG - Intergenic
903492909 1:23743314-23743336 CCGGGTGGGCGCTGGGGAGCGGG + Exonic
904160430 1:28518632-28518654 CCGGGTGCGCGCGGCCGCCCGGG + Intronic
904756162 1:32769992-32770014 CCGGGTGTCCCTGCAGGCGCTGG + Exonic
905806967 1:40884314-40884336 GCGGGTGTGAGCGGCGGGGCAGG + Intergenic
906520115 1:46461841-46461863 CTGGGTGTGGGCAGAGGCCCTGG + Intergenic
906614606 1:47225707-47225729 CTGGGCGCGCGCGGAGGCCCGGG - Exonic
907303979 1:53503698-53503720 CCGAGTGTGCCAGGAGGAGCGGG + Intergenic
909393189 1:75137504-75137526 CCGGATGTGTGTGGATGCGCTGG + Intronic
911144797 1:94541806-94541828 CCGGGGGCGGGCAGAGGCGCGGG - Intergenic
920358184 1:205391678-205391700 TGGGGTGTGCGTGGAGGCGGGGG - Intronic
921909053 1:220528180-220528202 CCGGCTGCGCGCGGAGCAGCGGG - Intronic
922783982 1:228274005-228274027 CCGTGTGGGCGCAGAGGGGCAGG + Exonic
923008069 1:230067575-230067597 CCCGGCGTGCGCAGAGGGGCCGG - Intronic
923629863 1:235642725-235642747 CCGTGTGTTCTTGGAGGCGCGGG + Intronic
1062908906 10:1199568-1199590 CCAGGTGGGCGAGGAGGGGCGGG - Intronic
1063115463 10:3068677-3068699 CCGGGTGCACGTGGGGGCGCCGG + Intronic
1065214746 10:23439068-23439090 CGCGGTGCGCGCGGAGGCCCGGG - Intergenic
1067103759 10:43351410-43351432 CCGGGTGTGGGAGGAGACTCAGG - Intergenic
1070179242 10:73998372-73998394 CCGGGTGAGCGCGCAGGGCCTGG + Exonic
1074819215 10:117166424-117166446 CCTGGGGTGCGAGGAGGGGCTGG - Intergenic
1076628910 10:131841183-131841205 CGGGGTGTGCGGTGAGGCCCTGG - Intergenic
1076683453 10:132186710-132186732 GCGGGTCTGCGCGGGGGCCCGGG + Intergenic
1076923481 10:133467594-133467616 TCGGGTGTGCTGGGAGCCGCGGG + Intergenic
1077016574 11:401223-401245 CCGGGTGTGAGCGGGGCCGGGGG - Intronic
1077016706 11:401561-401583 CCGGGTGTGAGCGGGGCCGGGGG - Intronic
1079128900 11:17736184-17736206 CAGGATGTGCGCGAAGACGCCGG - Exonic
1082188049 11:49208331-49208353 CTGGCTGTGCGCTGGGGCGCTGG - Exonic
1082787420 11:57324632-57324654 GCGCGTGTGCGCGGAGGCGGAGG - Intronic
1083571530 11:63764284-63764306 CGGGGTGTGCGGGGGCGCGCTGG - Exonic
1083995225 11:66268452-66268474 GGGAGTGGGCGCGGAGGCGCGGG + Intergenic
1085197982 11:74683683-74683705 GCAGGGGTGCGCGGAGCCGCGGG - Intergenic
1087761809 11:102110657-102110679 CAGGGCGGGGGCGGAGGCGCCGG + Exonic
1092462533 12:8698512-8698534 GCGCGTGTGCCGGGAGGCGCCGG + Intronic
1099443851 12:82728992-82729014 CAGGGTGAGGGCGGAGGCTCAGG - Intronic
1100869532 12:98895310-98895332 CCCGGAGTGCGCGGAGGGGGCGG - Intronic
1102520681 12:113476062-113476084 CCGGGTCTGCGCGGCGGCGGCGG + Intergenic
1103364014 12:120369333-120369355 CCGGGCGCCCGCGGAGGCGGCGG + Intergenic
1103377622 12:120469298-120469320 AGGGGTCTGCGCGGAGGCGGGGG + Intronic
1103912626 12:124360686-124360708 CGGGGTGTGTGAGGAGTCGCCGG - Intronic
1104835346 12:131786597-131786619 CTGGGTGTGCACGCAGGTGCTGG + Intronic
1104841497 12:131828165-131828187 CGGGATGGGCGCGGAGGCGGGGG - Intergenic
1105780567 13:23702256-23702278 CCGGGTGTGCGAGTGGGCACAGG - Intergenic
1113673811 13:112194798-112194820 CGGGGTGAGCGCGGAAACGCTGG - Intergenic
1116627361 14:47282553-47282575 CCGGGTGTGGCGGCAGGCGCCGG + Intronic
1116905132 14:50396794-50396816 CCGGGCGGGCAAGGAGGCGCGGG - Intronic
1117920790 14:60723760-60723782 CGGGGTCTGCGCGGCGGCGGCGG + Exonic
1118514156 14:66508323-66508345 CCGGGAGTGCGCGGGTCCGCGGG - Exonic
1118757244 14:68853934-68853956 CCTGGTGTGGGTGGAGGAGCCGG - Intergenic
1121226176 14:92323396-92323418 GCGAGTGGGCGCGGCGGCGCGGG + Intronic
1122281809 14:100628032-100628054 CCGTGTGTGTGTGGAGGCGGGGG - Intergenic
1202852844 14_GL000225v1_random:31674-31696 CCGGGTGTGCGGGGTGGGGGTGG - Intergenic
1124779369 15:32615522-32615544 CTGGGTGTCTGCGGAGGAGCTGG + Exonic
1125674609 15:41495388-41495410 CCGGGTCGGCGCGGCGGGGCGGG + Intronic
1126668263 15:51094142-51094164 CCGGGACTGCGCTGCGGCGCAGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1127784464 15:62343487-62343509 CCGGGTGTGTGTGGAAGGGCCGG - Intergenic
1129763977 15:78149501-78149523 CCGGGTGTGGGCGGGCGCGTGGG + Intronic
1130370577 15:83283342-83283364 CCGGGTCTGGGCGGCGGCTCCGG + Intronic
1132317501 15:100900645-100900667 CAGGGTGTTCGTGGAGGAGCAGG + Exonic
1132665443 16:1079390-1079412 CCTGGTGTTCGCGGACGTGCAGG + Exonic
1132694709 16:1196715-1196737 CTGGGTGTGAGGGGAGGCGGAGG + Intronic
1132844125 16:1992248-1992270 CCGGGTGGGCGGGGAGGGGGCGG + Intronic
1132844166 16:1992360-1992382 CCGGGTGGGCGGGGAGGGGGCGG + Intronic
1135296454 16:21283697-21283719 CCGGGGGCGCGCGGAGGAGCCGG - Intronic
1135423940 16:22323036-22323058 GCGGGTGTGTGAGGAGGCCCTGG + Intronic
1136318425 16:29467098-29467120 CCTGGAGCGCGCGGACGCGCAGG - Exonic
1136433000 16:30206447-30206469 CCTGGAGCGCGCGGACGCGCAGG - Exonic
1139467110 16:67159900-67159922 CCGGGTGTGCGCGGAGGCGCTGG + Exonic
1141632369 16:85295197-85295219 ACCGGTGTGTGCGGAGGCCCTGG - Intergenic
1142583916 17:959008-959030 GCGGATGTGCGCGGAGCCGAGGG + Intronic
1142860079 17:2755885-2755907 CCGGGTGGGCGGAGGGGCGCCGG + Intergenic
1143202556 17:5122693-5122715 CCGGGTGGGAGCTTAGGCGCGGG - Intronic
1143610401 17:8014693-8014715 CCGGGAGCGCACGGAGGAGCTGG + Exonic
1143729739 17:8874338-8874360 TCGGGTGTGCCTGGAGCCGCAGG + Intergenic
1144648547 17:16991478-16991500 CCGGGTGTGGGCGTGTGCGCAGG - Intergenic
1145234999 17:21202080-21202102 CTGGGTGTGCGGGGAGGGGCGGG + Intronic
1146022550 17:29292704-29292726 CCGGGTGCGGCGGGAGGCGCGGG - Intronic
1146057654 17:29589308-29589330 CCGGGTAAGCGCGGCGGGGCCGG - Exonic
1146167478 17:30600950-30600972 CCGGGTGGGCGAGCTGGCGCGGG + Intergenic
1147007487 17:37415596-37415618 CCGGCTGGGCGCGGTGGCTCAGG + Intronic
1148437424 17:47694693-47694715 CGGGGTGGGCGCAGAGGGGCGGG + Intronic
1148911246 17:50944319-50944341 CAGGCTTGGCGCGGAGGCGCAGG + Intergenic
1150124593 17:62627959-62627981 CGGGGGGAGCGCCGAGGCGCGGG + Intronic
1151370712 17:73644799-73644821 CCGGCTGGGCGCGGAGCCGAGGG - Intergenic
1151756327 17:76077227-76077249 CCGTGTGTGCGCTGCCGCGCGGG + Exonic
1151780295 17:76240724-76240746 CCGGGTGCCCGCGGCGGGGCGGG + Intergenic
1152530980 17:80918972-80918994 CCGGGTGTGTGGGAAGGCTCGGG - Intronic
1152617874 17:81346125-81346147 GCGGGTGTGCGGCGAGGCTCGGG - Intergenic
1152636312 17:81431918-81431940 CTGGGTGTGCGCAGGGGCTCGGG - Intronic
1160072887 18:75643658-75643680 CCAGGCGTGCGGTGAGGCGCAGG - Intergenic
1160684449 19:426996-427018 CCGGGTGTGGGCACAGGGGCAGG + Intronic
1160823340 19:1068157-1068179 CGGGGCCTGCGGGGAGGCGCGGG - Intronic
1160896938 19:1407546-1407568 CCGGGCGTGCGCAGGGGCGGCGG + Intergenic
1160903118 19:1438947-1438969 CCGGGTGAGGGCGGCGGGGCGGG + Intronic
1160927873 19:1555764-1555786 GCGGCTGTTCTCGGAGGCGCCGG + Exonic
1161063221 19:2225679-2225701 TGGCGTGTGCGCGGAGGCCCTGG - Intronic
1161115767 19:2495651-2495673 CCAGGTGTGGGCAGAGGGGCAGG - Intergenic
1161153460 19:2721105-2721127 CAAGGTGAGCGCGGAGGGGCCGG + Intronic
1161241102 19:3224530-3224552 CCGGGGATGCGGGGAGGCGCCGG + Intergenic
1163123507 19:15232112-15232134 CCTGGTGTTCTCGGTGGCGCTGG - Exonic
1163304820 19:16471607-16471629 CCGGGGACCCGCGGAGGCGCTGG - Intronic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163630777 19:18417082-18417104 CCGGGGGAGGGCGGAGGCGGAGG - Intergenic
1163800083 19:19359374-19359396 CCGGCTGGGCGCGGTGGCTCAGG - Intergenic
1165838215 19:38771996-38772018 CCTGCTGTGCGGGGAGGAGCAGG - Exonic
1165841348 19:38790701-38790723 CCTGCTGTGCGGGGAGGAGCAGG + Exonic
1166035582 19:40165780-40165802 CTGGGTGTGCAGAGAGGCGCTGG - Intergenic
1168452557 19:56477556-56477578 TCGGGGGTGTGCGCAGGCGCGGG - Intronic
924969060 2:107580-107602 CCGGCTGGGCGCGGTGGCTCAGG - Intergenic
924987767 2:287748-287770 CCGGGGGGGCGCGGAGCCCCGGG - Exonic
925730732 2:6917964-6917986 GCGGGTCTGCGCTGCGGCGCGGG + Intronic
930641695 2:53859931-53859953 CCCGGGATGCGCGGAGGCGGTGG - Exonic
931348867 2:61470922-61470944 CCGGAGGGGCGCCGAGGCGCCGG + Intergenic
934993186 2:98935863-98935885 CGGGGTGGGCGCGGGGGCACCGG - Intronic
935971641 2:108534799-108534821 CCGGGTGTCCGCGGTGGCACAGG + Intronic
936556872 2:113503788-113503810 CCGGCTCTGCGGGGCGGCGCGGG - Intergenic
937044128 2:118842088-118842110 CCCGGCGTGCGCAGGGGCGCTGG + Intergenic
940883431 2:158968930-158968952 CCGGGTGTGCCCGGCGGAGGAGG - Intronic
941021039 2:160407967-160407989 GCGGGCGGGCGGGGAGGCGCGGG - Intronic
942450661 2:176106500-176106522 CCGGGTGGGCACGAAGGCCCCGG + Intronic
944547500 2:200812203-200812225 CCGGGTGTGCGCCGCGGCGCTGG + Intronic
946306338 2:218859062-218859084 CAGGGCGTGCGCGCAAGCGCTGG - Intergenic
948645579 2:239401666-239401688 CTGCGTGCGCACGGAGGCGCAGG + Intronic
948945836 2:241218351-241218373 GCGGTTGTGCGCGGCGGCGAAGG - Exonic
1171813353 20:29762868-29762890 CCGGGTTTGCGCGGGGTCTCGGG - Intergenic
1172764942 20:37346266-37346288 CGGGGGGTCCGCGGAGGGGCGGG - Intronic
1172775883 20:37406640-37406662 CCACGTGTGCCCGGGGGCGCAGG + Intergenic
1173684002 20:44910075-44910097 CCGGGTGAGCGCGGGGCTGCTGG + Exonic
1175517247 20:59577461-59577483 CCGGGGCCGCGGGGAGGCGCCGG - Intergenic
1175899643 20:62354938-62354960 CCGCCTGTGCGAGGAGGCCCGGG + Intronic
1175962246 20:62642927-62642949 CCCGGAGCGCGCGCAGGCGCAGG + Intronic
1176207009 20:63894702-63894724 CCGGGTGGGGGCGGGGGCGACGG + Intergenic
1179537326 21:42060988-42061010 GCTGGTGTGGGCGGAGGCGGTGG + Intergenic
1179893854 21:44350746-44350768 CCCAGTGTGCGCAGAGGCGCGGG + Intronic
1180011686 21:45055361-45055383 CCGGGTGGGCCTGAAGGCGCGGG - Intergenic
1180072292 21:45442581-45442603 CCTGGTGTGGGCGGTGGTGCTGG + Intronic
1180072371 21:45442839-45442861 CCTGGTGTGGGCGGAGGTCCTGG + Intronic
1180182975 21:46126234-46126256 CCGGGTGAGCGTGTGGGCGCGGG + Exonic
1180190636 21:46160985-46161007 GCGGGTGGGCGTGGAGGCCCGGG + Intergenic
1181083618 22:20429350-20429372 CGGGGTCTGAGCGGAGGGGCGGG + Exonic
1181162041 22:20965137-20965159 GCGGGGGGGCGGGGAGGCGCGGG - Exonic
1183386193 22:37516167-37516189 CCGGGTGCTCGAGGAGGAGCGGG - Exonic
1184046759 22:41976873-41976895 CGGGGAGGGCGCGGCGGCGCGGG + Exonic
1184130197 22:42512996-42513018 CTGGGGGTGAGAGGAGGCGCGGG + Intronic
1184140373 22:42574819-42574841 CTGGGGGTGAGAGGAGGCGCGGG + Intergenic
952605701 3:35144889-35144911 CTGGGTGTGGGGGGAGGCACTGG + Intergenic
961743120 3:129046344-129046366 CCAGGTGCGCGAGGAGGCCCTGG + Intergenic
964819956 3:160757539-160757561 CGGGTTGTGCGCTGAGGCCCAGG + Intronic
966711918 3:182980423-182980445 GCGGGGGTGCGCGGCAGCGCCGG + Intronic
968063959 3:195747980-195748002 CCGGGTGGGCGGGGCGGGGCGGG - Intronic
968804608 4:2764066-2764088 CCGGGTGGGCGCGGCCCCGCGGG + Intergenic
969655539 4:8495677-8495699 CAGGGTGTGCGCTGAGACACGGG - Intergenic
969707029 4:8817594-8817616 CCAGGTCTGCCCGGAGGCTCCGG + Intergenic
973888569 4:55346757-55346779 CCGGGTGTCCGCGGACGCCGAGG + Intronic
976092336 4:81471601-81471623 CCGGGTGCGCTCCGAGGCGGCGG - Intronic
976388072 4:84482862-84482884 CCCGGGGTCAGCGGAGGCGCAGG + Intergenic
981475176 4:145180403-145180425 TGGGGAGTGCGCGGGGGCGCAGG - Intergenic
982712261 4:158769151-158769173 CCGGCTGCGCGCTGAGCCGCCGG + Exonic
983158811 4:164384298-164384320 CCGGGTGGGCGCGGTGGGGATGG + Intergenic
983919816 4:173333838-173333860 GAGGGTGTGCGCCGGGGCGCGGG - Intronic
985668387 5:1193535-1193557 CTGGGTGTGGGTGGAGGGGCAGG + Intergenic
985688415 5:1294211-1294233 CCCCGGGTGCGAGGAGGCGCGGG - Exonic
985777383 5:1851843-1851865 CGGGGTCTGCACGGTGGCGCGGG + Intergenic
991594468 5:68288576-68288598 CCGAGAGTGCGCGCAGGAGCGGG - Intronic
992067478 5:73120778-73120800 CCGCGGCAGCGCGGAGGCGCTGG + Intronic
992910736 5:81393954-81393976 CCGGGGCTGCGGGGAGGCGCGGG - Intronic
997228887 5:132228574-132228596 CTGGGTGGGGGCGGAGGCGGGGG + Intronic
997485265 5:134225901-134225923 CCGTGTGCGGGCGGCGGCGCGGG - Exonic
1002485528 5:179533378-179533400 CCGGCTGGGCGCGGTGGCTCAGG + Intergenic
1003314940 6:5003763-5003785 CCGGCGGTACGCGGAGGGGCGGG - Intronic
1003926372 6:10881672-10881694 CCGGGTGTGTGCGGGCACGCGGG - Intronic
1003942671 6:11044371-11044393 CCGAGGGGGCGGGGAGGCGCGGG - Intergenic
1004429795 6:15533181-15533203 CCGGCTGTGCGGGGTGGCGATGG - Intronic
1004864391 6:19838321-19838343 CCGGGGGAGCCCGGAGGAGCAGG - Intronic
1006572523 6:35017570-35017592 CCCGGTGTGCGAGGTGGGGCAGG + Exonic
1008106045 6:47442126-47442148 ACGGGTGGGCGGGGGGGCGCGGG + Intergenic
1015149257 6:130019942-130019964 CCGGGTGCGGGCGCGGGCGCGGG + Intronic
1018109423 6:160520569-160520591 CCGGGTGTGCGCGGACTCAGCGG - Intergenic
1019114905 6:169751945-169751967 AGGGCTGTGCGCGGTGGCGCGGG + Intronic
1019290766 7:248954-248976 CCGGGTGTGGAAGGAGGCACAGG - Intronic
1019729790 7:2623554-2623576 CTGGGTGTGCCCGGAGGAGGCGG + Intergenic
1019793017 7:3029595-3029617 CCGGTTGGGCGCGGTGGCTCAGG + Intronic
1021452744 7:20797968-20797990 CGGGAGGTGCGCAGAGGCGCGGG - Intergenic
1023516641 7:41008377-41008399 CCGGATGTGAGAGGAGGTGCTGG - Intergenic
1024255532 7:47537433-47537455 CCGAGCGAGCGCGGAGGCACAGG + Intronic
1024317683 7:48036243-48036265 CCTGGTGTTCGCGGGTGCGCTGG - Exonic
1026899162 7:74027659-74027681 CGGGGTGGGGGCTGAGGCGCGGG + Intergenic
1029298321 7:99558897-99558919 CCGAGAGTGCGCGGAGGCCCGGG + Exonic
1029496078 7:100895969-100895991 CCGGGAGAGCGGGGAGGGGCGGG - Intronic
1031361899 7:120857659-120857681 CCGGGGGCGCGCGGACGCGATGG - Intronic
1031639584 7:124145255-124145277 CCTGGTGTGTGGGGAGGAGCAGG + Intergenic
1033220413 7:139523688-139523710 CCGGCTGTGCGTGGAGGCTGCGG + Intergenic
1033299702 7:140175988-140176010 CCGGGTGTGTGCGGGGGCCCAGG + Intronic
1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG + Intergenic
1035021612 7:155804037-155804059 CCGGGTGTGTGCGGAGCTGGGGG - Intronic
1035247944 7:157577191-157577213 CCGGGTGTGCGCAGCTGCGACGG - Intronic
1035296820 7:157872178-157872200 ATGGGTGTGTGGGGAGGCGCTGG - Intronic
1037841085 8:22245540-22245562 CCGGGGGTGAGGGGAGGCGCCGG - Exonic
1039903261 8:41767655-41767677 GGGGGTGCGCGCGGGGGCGCGGG + Intronic
1040559825 8:48514511-48514533 CCGGGTGTCTGCGGGGGCGGGGG - Intergenic
1040915467 8:52563869-52563891 CTGGGTGTGGAAGGAGGCGCTGG - Intronic
1041648708 8:60280819-60280841 CCGGGTGAGAGCGCAGGCGGCGG + Intronic
1041690374 8:60680362-60680384 CGGGGCGGGCGCGGCGGCGCGGG + Intronic
1044685663 8:94823428-94823450 CAGGATGAGCGCGGAGGCGGCGG + Exonic
1047997882 8:130354169-130354191 CCGGCTGGGCGCGGTGGCTCAGG - Intronic
1049441711 8:142612629-142612651 CCGGGAGAGGGCGGCGGCGCCGG + Exonic
1049688769 8:143949802-143949824 GGGGGTGTGCGAGGAGGTGCTGG - Intronic
1049803969 8:144530630-144530652 GAGGGTGGGCGCGGAGGGGCGGG + Intronic
1049828491 8:144685412-144685434 CCGGGTGCGCGCCGACGGGCCGG - Intergenic
1051711355 9:19934419-19934441 CCGGGGGTGCGCGGGGGTCCGGG - Intergenic
1053372659 9:37576010-37576032 CCGGGGGACCGCGGAGCCGCGGG + Intronic
1057479626 9:95434388-95434410 CAGGGTGTGGGTGGAGGGGCAGG - Intergenic
1058605301 9:106715254-106715276 ACGGGTGTGCAGGGAGGTGCAGG + Intergenic
1060599587 9:124869147-124869169 GCGGCTGCGCGCGGAGGCGGTGG + Exonic
1060724705 9:125999284-125999306 CTGGGTGTGCTGGGAGGCGTTGG + Intergenic
1062349987 9:136133794-136133816 CCGGGTGTGCACCGGGGCTCAGG + Intergenic
1062504615 9:136866548-136866570 CCGCGTGTGCTCGGAGGCCGCGG - Intronic
1203784139 EBV:117720-117742 CTTGGTGTGCACGAAGGCGCAGG - Intergenic
1185747463 X:2584180-2584202 CGGGGGGCGCGCGGGGGCGCGGG + Intergenic
1187154619 X:16712011-16712033 CCGGGTGCGGGCGCTGGCGCGGG + Exonic
1188104133 X:26128417-26128439 CCGGGTGTTGGGGCAGGCGCCGG + Intergenic
1197695659 X:129547242-129547264 CCGGCTGGGCGCGGTGGCTCAGG + Intronic
1200138512 X:153886185-153886207 GCGGGCGTGCGCGCAGGGGCGGG + Intronic
1201416493 Y:13752927-13752949 CGGGGCCTGCGCGGAGGCTCTGG + Intergenic
1201764456 Y:17565184-17565206 CCGGGTGGTCGCGGAGTCCCAGG - Intergenic
1201837097 Y:18340806-18340828 CCGGGTGGTCGCGGAGTCCCAGG + Intergenic