ID: 1139472737

View in Genome Browser
Species Human (GRCh38)
Location 16:67186922-67186944
Sequence GATCTGACCCTGCTGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139472732_1139472737 1 Left 1139472732 16:67186898-67186920 CCAGGGGCAAAGGAATGTAGCAG 0: 1
1: 0
2: 1
3: 23
4: 247
Right 1139472737 16:67186922-67186944 GATCTGACCCTGCTGGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 149
1139472730_1139472737 15 Left 1139472730 16:67186884-67186906 CCTGGGGGGAGGGGCCAGGGGCA 0: 1
1: 1
2: 5
3: 120
4: 890
Right 1139472737 16:67186922-67186944 GATCTGACCCTGCTGGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139472737 Original CRISPR GATCTGACCCTGCTGGAGAT GGG Intronic
900545326 1:3225793-3225815 GATCCGACACTTCTGGAGGTGGG - Intronic
900988717 1:6087681-6087703 GCTCTGCCCCTGCTGGGGACAGG - Intronic
901054665 1:6443598-6443620 GATCTGTCCCTGCCGCAGCTGGG - Intronic
901122859 1:6909453-6909475 ACTGTTACCCTGCTGGAGATGGG - Intronic
902491262 1:16782543-16782565 TATCTGTCCATGCTGGAGAGAGG - Intronic
903355160 1:22742006-22742028 GAACTCACCCTGCTACAGATGGG + Intronic
903499213 1:23792394-23792416 GACCTGAGCTTGCTGGAGACAGG - Intronic
903944217 1:26951692-26951714 GACCTGGACCTGCCGGAGATGGG - Exonic
905584594 1:39106289-39106311 GGTCTGGGCCTGCTGGAGGTAGG + Intronic
910244316 1:85122441-85122463 GCTCTGAGCCTGCTAGAGATAGG - Intronic
910966882 1:92816749-92816771 GCTCTGCCCCTGATGGAGACAGG + Intergenic
912947763 1:114098864-114098886 GAGCTGCCCCTGACGGAGATAGG + Intronic
915606397 1:156954604-156954626 GAGCTGTCCCTGCAGGAGAAGGG + Intronic
916991321 1:170248783-170248805 AATATGACCCTGTTGGAAATAGG + Intergenic
920053650 1:203177953-203177975 AATCTGAACCAGCTGGAGCTGGG - Intergenic
923529177 1:234799995-234800017 TATCTGTCCATGCTGGAGAGAGG + Intergenic
923539176 1:234876031-234876053 GATCTGCTCCCTCTGGAGATGGG - Intergenic
923683389 1:236137376-236137398 GACCTAACCCTGAAGGAGATAGG - Intergenic
1062838886 10:654170-654192 TATCAGACGCTGCCGGAGATTGG + Intronic
1066282893 10:33935395-33935417 GATCAGAGCCTGCTGGAGTCTGG - Intergenic
1069269847 10:66513430-66513452 GATGTGACTTTACTGGAGATGGG + Intronic
1069911340 10:71761684-71761706 AACCTGACCCTGCTGGATAGCGG - Exonic
1074430045 10:113386718-113386740 GAACTCAGCCTGCTGGAGAAAGG - Intergenic
1074607520 10:114988530-114988552 GATCTGCCACTACTGGAGAAGGG - Intergenic
1075003174 10:118812670-118812692 GATCTGAGACTCCTGGAGAAAGG - Intergenic
1075071260 10:119321347-119321369 TATCTTACCGTTCTGGAGATCGG + Intronic
1075782980 10:125028804-125028826 GATCTAAGCCTGCTGGAATTAGG - Intronic
1076336012 10:129706805-129706827 AATCCACCCCTGCTGGAGATGGG + Intronic
1076763140 10:132615675-132615697 GAACTGGCCCTGCTGGAGAGTGG + Intronic
1076899093 10:133328363-133328385 GAGTTGTCCCTGCTGGAGGTGGG - Intronic
1077170263 11:1162908-1162930 CATCTGCCCCTGGTGGGGATGGG + Intronic
1078472684 11:11604411-11604433 GATCCCACACTGCTGGAGAGTGG + Intronic
1078607550 11:12790208-12790230 GCTCTGGCCCTGCTGCAGACAGG - Intronic
1082866172 11:57901955-57901977 GACCTCTCCCTGCAGGAGATAGG + Intergenic
1087181242 11:95144558-95144580 AATCTGACCCTGCTCCAGATGGG + Intergenic
1090448505 11:126785381-126785403 GCTCTGACCATGCAGGAGGTGGG - Intronic
1096111739 12:49033062-49033084 CATCAGACTCTGCTGAAGATGGG + Exonic
1096162031 12:49386746-49386768 GATCAGAAGCTGCTGGAGTTTGG + Intronic
1102029429 12:109731458-109731480 CCTCTGCCCCTGCTGGAGAATGG + Intronic
1106618386 13:31351599-31351621 GATGTGACAGTGATGGAGATTGG - Intergenic
1107976512 13:45693603-45693625 CAACTGAACCTGCTGGGGATAGG + Intergenic
1113332383 13:109342254-109342276 GATCTCACAGTTCTGGAGATTGG - Intergenic
1114549426 14:23524504-23524526 GATCTGCCCTTGCTGGTGTTTGG - Exonic
1115486025 14:33912079-33912101 AACCTGGCCCTGCTGGGGATTGG + Intergenic
1115802753 14:37014117-37014139 GAGATGACCTTGCTGAAGATTGG + Intronic
1118525704 14:66639583-66639605 CATCTGACCCAGCTGGTGAATGG + Intronic
1119209069 14:72816270-72816292 GATGTTATCCTGCTGGAGCTGGG - Intronic
1119580196 14:75771763-75771785 AATTTGAACATGCTGGAGATAGG - Exonic
1122393383 14:101406216-101406238 GAGCTGGGCCTGCTGGAGAAAGG + Intergenic
1122771579 14:104100110-104100132 GAGCAGACCCTCCTGGAGAAAGG + Intronic
1122779198 14:104136513-104136535 GCTCCCAGCCTGCTGGAGATGGG + Intergenic
1122837210 14:104436171-104436193 GAGCTGAGCCTCCTGCAGATGGG + Intergenic
1123111968 14:105876199-105876221 GTTCTGAGCCTCCTGGAGATGGG + Intergenic
1123393302 15:19899523-19899545 GACCTCACCCAGCAGGAGATAGG + Intergenic
1124208069 15:27740259-27740281 AAGCTGGCCCTGCTGGAAATAGG - Intergenic
1127976236 15:63999244-63999266 GATCTGACCAAGCTGGGGCTGGG + Intronic
1128643741 15:69359904-69359926 GTCCTGACCCAGCTGGAGTTAGG + Intronic
1129035725 15:72647386-72647408 AATCTGCACCTGCAGGAGATCGG - Intergenic
1129399850 15:75275539-75275561 AATCTGCACCTGCAGGAGATCGG - Intronic
1131095021 15:89649301-89649323 GTGCTGAGCCTCCTGGAGATGGG - Exonic
1133592256 16:7257020-7257042 GATCCGACCCTCCTGGAGAATGG + Intronic
1137770066 16:51009042-51009064 GAGCTGGCCATGCTGGAGGTTGG - Intergenic
1138278189 16:55751417-55751439 GATCTGTCCCTGCTGGGGGAAGG - Intergenic
1138290487 16:55842528-55842550 GATCTGTCCCTGCTGGGGGAAGG + Intergenic
1139472737 16:67186922-67186944 GATCTGACCCTGCTGGAGATGGG + Intronic
1140748794 16:78004711-78004733 AATCAGACACTCCTGGAGATGGG - Intergenic
1142197319 16:88744860-88744882 GAAGAGACGCTGCTGGAGATGGG + Intronic
1142715686 17:1745693-1745715 GATCTGTCCCTGCAGGAGCCTGG + Exonic
1143887165 17:10073289-10073311 GCTCTGACACAGCTGGAGACAGG + Intronic
1150453415 17:65288135-65288157 GATGAGATCCTGCTGGAGAAGGG + Intergenic
1150863140 17:68822029-68822051 GATCTGGTCCTGCTGAAGAGAGG + Intergenic
1150974825 17:70073519-70073541 GATCTGACTCAGCTGGAGTTGGG + Intronic
1151327199 17:73386628-73386650 GATCTGGCCCTGCTCGGGAAAGG + Intronic
1152278211 17:79370288-79370310 GCTCTGGCCCTGCTGGGAATGGG - Intronic
1153228349 18:2914389-2914411 GAGCTGTGTCTGCTGGAGATTGG - Exonic
1155533915 18:26795617-26795639 GTTCTGAGCCACCTGGAGATGGG - Intergenic
1160890762 19:1377611-1377633 CGTCTGACCCTGCTGGAGCCTGG - Exonic
1160898089 19:1412220-1412242 CATCTGACCCTGCTGGGGAGAGG + Intronic
1166662911 19:44658813-44658835 TTTCTGATCCTGCTGGGGATCGG + Exonic
926105409 2:10146619-10146641 GCTCTGCCCCTGCTGCAGGTGGG + Intronic
927192361 2:20525327-20525349 CATCTGACCCTGCAGGAGAGCGG - Intergenic
928898936 2:36297132-36297154 GAGCTGACCTTGCTGGAGCTAGG - Intergenic
930418264 2:51117563-51117585 GATCTCACCATGCTGAAGGTGGG + Intergenic
933671929 2:85016587-85016609 GATGTGAAACTGCTGGAGAAAGG - Intronic
934646394 2:96061616-96061638 GATCTGGCCATGCTGGAGGCAGG - Intergenic
936267913 2:111024268-111024290 AATGTGACCCTGTTGGAAATAGG + Intronic
940366650 2:152855801-152855823 GATCTGTCCCTGCTTGAGTTGGG + Intergenic
941215680 2:162705688-162705710 AATCTGACACTGCTTGAGTTGGG - Intronic
941272086 2:163442720-163442742 GAGCTGACTGGGCTGGAGATGGG + Intergenic
942700396 2:178701423-178701445 GTTCTGACTCTGCTGCAGTTTGG + Intronic
945313693 2:208346618-208346640 GATTTGACAGTGCTGGAGCTGGG + Intronic
945767952 2:214003226-214003248 TATCTGACACTGTGGGAGATCGG + Intronic
948711865 2:239830222-239830244 TCCCTGGCCCTGCTGGAGATGGG - Intergenic
1173641266 20:44603769-44603791 GCTGTCTCCCTGCTGGAGATAGG + Intronic
1175177288 20:57119891-57119913 AATCTGGCACTGCTGGAGGTGGG + Intergenic
1176249589 20:64114058-64114080 GACCAGGCCCTGCTGGAGAGGGG + Intergenic
1180929455 22:19579111-19579133 GTTCTGACACTGCTGGAATTGGG + Intergenic
1184512912 22:44943496-44943518 TAGCTGAGCCTGCTGGAGATCGG - Intronic
1185103395 22:48853733-48853755 GAGCTGGGCCTGCTGGGGATGGG + Intergenic
949123098 3:411731-411753 GATCTGACCATGGAGGACATTGG - Intergenic
950415612 3:12867466-12867488 GAGGTGACCCTACTGCAGATGGG - Intronic
953217327 3:40931414-40931436 GATCTGAGCCTCCTGGAACTGGG - Intergenic
953902474 3:46851153-46851175 GCTCTTACCCTGGTGGAGATTGG - Intergenic
957448849 3:80349751-80349773 GAAATGACCCTGATGAAGATGGG + Intergenic
958085192 3:88797638-88797660 GTTCTGACCCATCTGGAGCTGGG + Intergenic
958982096 3:100733626-100733648 AATGTGACCCTACTGGAGTTGGG - Intronic
960453098 3:117834700-117834722 GACCTGACCTTCCTGGAGGTTGG - Intergenic
960994568 3:123332425-123332447 GAGCAGAGCCTGCTGGTGATGGG - Intronic
961713125 3:128842273-128842295 GGGGTGACCCTGCTGCAGATGGG + Intergenic
961783981 3:129338396-129338418 GAGGTGACCCTACTGCAGATGGG - Intergenic
962388446 3:134952079-134952101 GATCTGGCCCTGCCATAGATGGG - Intronic
963983557 3:151566879-151566901 GAGCTGACAGTGCTGTAGATAGG - Intergenic
964227828 3:154428199-154428221 TATCCCGCCCTGCTGGAGATGGG + Intronic
967110447 3:186288733-186288755 TACCTGTCCCTGCTGGAGACGGG - Exonic
967373800 3:188778496-188778518 AATCCAACCCTGCTGTAGATAGG + Intronic
969675431 4:8611804-8611826 GGTCTGGCACTGCTGGAGTTCGG - Intronic
974533423 4:63143271-63143293 GATGTGATCCTGTTGGTGATTGG + Intergenic
976616117 4:87079067-87079089 GATCTGGCTCTGCTGAAGACTGG - Intronic
977738169 4:100443809-100443831 GTTGTGACCCTGGTGGACATGGG + Intronic
977772847 4:100880229-100880251 GACTGGACCCTGCTGGGGATGGG + Intergenic
982827479 4:160019134-160019156 AAGCTGAGCCTGCTGGAAATGGG - Intergenic
982952521 4:161717525-161717547 TATTTGACCCTACTGGAGTTTGG - Intronic
983968220 4:173840410-173840432 GCTCTTACTCTGCTTGAGATGGG + Intergenic
990537378 5:56736034-56736056 GAGATGCCCCTGCTGGAGAAAGG + Intergenic
995131317 5:108633268-108633290 GATCTGACCTTACAGGTGATTGG + Intergenic
995588597 5:113674726-113674748 ACTCTGATGCTGCTGGAGATGGG + Intergenic
1001311403 5:170613545-170613567 GATTTGAACCTGAAGGAGATGGG + Intronic
1001370349 5:171193694-171193716 GGCCTGACGCTGCTGGAGAAAGG - Intronic
1002951430 6:1816112-1816134 GATCTGACCCTGAAGGTGGTGGG + Intronic
1003487178 6:6589831-6589853 CATCATGCCCTGCTGGAGATAGG - Intronic
1004463523 6:15861897-15861919 GTTCAGACCTTGCTGGAGAAGGG + Intergenic
1006028205 6:31160820-31160842 GATCTGAACGAGCTGGAGCTGGG + Intronic
1007126108 6:39427003-39427025 GGTCTGACCATGCTGGTGTTGGG - Intronic
1007806067 6:44448424-44448446 AATCTCACCAGGCTGGAGATAGG + Exonic
1009401715 6:63263956-63263978 GAGCTTGCCCTGCTGGAGTTTGG - Intergenic
1011187285 6:84692158-84692180 CTTCTGCCCCTGCTGGTGATCGG + Intronic
1013605575 6:111744496-111744518 GATCTGTTTTTGCTGGAGATCGG + Intronic
1014879477 6:126704975-126704997 TAACTGAACCTGCTGGAGTTGGG + Intergenic
1015827092 6:137325602-137325624 GCTCTGACTCTCCTGGAGCTAGG - Intergenic
1017334190 6:153236099-153236121 GATTTTACTCTGATGGAGATGGG - Intergenic
1020275464 7:6622150-6622172 GAGCTGACCCCGGTGGAGCTAGG + Exonic
1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG + Intronic
1031312212 7:120212540-120212562 CATCTGACCATTCTGGACATAGG + Intergenic
1033676498 7:143545304-143545326 GAGCTGATCCTTCTGGAGAAAGG + Intergenic
1033695335 7:143784135-143784157 GAGCTGATCCTTCTGGAGAAAGG - Intergenic
1037102507 8:15064774-15064796 AATCGGGCCCTGCAGGAGATGGG - Intronic
1037405212 8:18535153-18535175 GATCGGACCCTGCTGGAAGCAGG - Exonic
1037799376 8:22024218-22024240 GATCTCACCGTTCTGGAGACAGG + Exonic
1039115739 8:34089520-34089542 GAACTTACCCTGGTGGAGATTGG + Intergenic
1039647356 8:39302743-39302765 GTTCTGAGCCAGCTGGAGCTAGG + Intergenic
1040534533 8:48297337-48297359 CCTCTGACACTGCTGGGGATGGG + Intergenic
1044428821 8:92084874-92084896 GATCTGGCCCTGATGGACACTGG - Intronic
1044516234 8:93142022-93142044 GAACAGACCCTGCTGGACCTGGG + Intronic
1048200754 8:132372121-132372143 GATGTTCCCCTGCTGGAGATGGG - Intronic
1051265692 9:15306903-15306925 GGTCTGTCCCCGCTGGAGCTAGG - Intronic
1053139194 9:35671928-35671950 GAACTGACCCAGGTGGAAATTGG + Intronic
1061537997 9:131261311-131261333 GATCTTGCCCTCCTGGAGGTCGG + Exonic
1190746000 X:53321768-53321790 AATCTGACACTGCTTGGGATTGG - Intergenic
1191793118 X:64992304-64992326 AATCTGAGCCTGTCGGAGATTGG - Intronic
1191853228 X:65601624-65601646 GATCTAACCCTGGTGGGGAAGGG + Intronic
1195351923 X:104004527-104004549 GATGTCACCCTGCTAGTGATAGG + Intergenic
1197953253 X:131919807-131919829 GTTCTGATCCTCCTGGAGCTGGG - Intergenic
1199783080 X:151081348-151081370 GCTTTGACTCTGTTGGAGATGGG + Intergenic
1201158115 Y:11150740-11150762 GATCTGGCCCAGCTGCAGCTTGG - Intergenic