ID: 1139472767

View in Genome Browser
Species Human (GRCh38)
Location 16:67187110-67187132
Sequence AATGATGGGGAGCCTGGAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139472767_1139472774 -3 Left 1139472767 16:67187110-67187132 CCAACTCCAGGCTCCCCATCATT 0: 1
1: 0
2: 1
3: 32
4: 274
Right 1139472774 16:67187130-67187152 ATTTCCTGCCTGGAGATAGGTGG 0: 1
1: 0
2: 1
3: 17
4: 200
1139472767_1139472773 -6 Left 1139472767 16:67187110-67187132 CCAACTCCAGGCTCCCCATCATT 0: 1
1: 0
2: 1
3: 32
4: 274
Right 1139472773 16:67187127-67187149 ATCATTTCCTGCCTGGAGATAGG 0: 1
1: 0
2: 0
3: 17
4: 218
1139472767_1139472776 2 Left 1139472767 16:67187110-67187132 CCAACTCCAGGCTCCCCATCATT 0: 1
1: 0
2: 1
3: 32
4: 274
Right 1139472776 16:67187135-67187157 CTGCCTGGAGATAGGTGGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139472767 Original CRISPR AATGATGGGGAGCCTGGAGT TGG (reversed) Exonic
900327515 1:2116056-2116078 GATGACGGGGAGCCGGGAGCCGG - Intronic
900737581 1:4308833-4308855 CAGGATGGGGTGCATGGAGTGGG + Intergenic
903996225 1:27306925-27306947 AAGGATGGGAGCCCTGGAGTGGG + Exonic
905547541 1:38811609-38811631 ATGGATGGGGAGCCAGAAGTGGG - Intergenic
905547655 1:38812263-38812285 ATGGATGGGGAGCCAGAAGTGGG - Intergenic
905910052 1:41647534-41647556 TATGATGGGGAGAGTGGAGAAGG - Intronic
908618567 1:65950378-65950400 AAAGATGGGGATCCTGGAGTTGG - Intronic
909582572 1:77254230-77254252 CATGCTGGGCTGCCTGGAGTTGG - Intergenic
910414939 1:86987569-86987591 AATGATCTGGAACCTGGGGTAGG - Intronic
910488486 1:87742333-87742355 AATCATGGGGAGACTGGATGAGG + Intergenic
911905575 1:103564536-103564558 AATGATGGGGTACAGGGAGTAGG - Intronic
912477646 1:109950385-109950407 AGTGATAGGGAGCCTGGCATGGG + Intergenic
912491053 1:110063073-110063095 AAGGATGGAGACCCTGGAGTAGG - Intronic
915247790 1:154568502-154568524 AACGATGGGGAGCCCGGGGAGGG - Intronic
917082818 1:171273617-171273639 AATAGTGGGGAGGCTGAAGTGGG - Intronic
917901219 1:179545314-179545336 AAAGATGGGGACTCTAGAGTTGG - Intronic
918384030 1:183986901-183986923 TGTGGTGGGGAGCCTGGAGTGGG - Intronic
918595476 1:186287933-186287955 AATGATGGTAAGCCTGAAGAGGG - Intergenic
919234000 1:194814223-194814245 AATGGTGGGAACCCTGGAGGCGG - Intergenic
920183924 1:204149049-204149071 AATGCTGTGGAGCCTGGAAAGGG - Intronic
920245943 1:204587721-204587743 AATGCAGGGGAGTCGGGAGTCGG - Intergenic
921259353 1:213371895-213371917 GATGATGGCGAGCAGGGAGTGGG - Intergenic
922152269 1:223016666-223016688 TAGTAGGGGGAGCCTGGAGTTGG + Intergenic
922240863 1:223754871-223754893 TCTGATGGGGAGCCTGGGGCGGG - Intronic
922922171 1:229314876-229314898 AGTGATGGGGAGGCTGAGGTGGG + Intergenic
923687048 1:236160710-236160732 ACTGACGGGGAGGCTGGAGGGGG - Intronic
1063450571 10:6147505-6147527 AATGATGGGGAGATTTGGGTAGG + Intronic
1064709543 10:18109514-18109536 ATGGATGGGGAGCCTGAAGGAGG - Intergenic
1065009737 10:21410552-21410574 ATGGATGGGGAGCCAGAAGTGGG + Intergenic
1065168598 10:23005946-23005968 AATGCTGGGGAGCCCTGAGGTGG + Intronic
1067292823 10:44956781-44956803 CATGGTAGGGAGTCTGGAGTAGG + Intergenic
1069255231 10:66323994-66324016 ATGGATGGGGAGCCAGAAGTGGG - Intronic
1069837118 10:71316575-71316597 AGGGATGGGGAGGCTGGGGTGGG - Intergenic
1070164270 10:73886162-73886184 AAGGATGGAGAACCTGGAGATGG + Intergenic
1071294022 10:84206300-84206322 AAAGATGGGCAGCCTGGAGAAGG + Intronic
1071603466 10:86970134-86970156 AATGGTGGGGCACCTGTAGTCGG + Intronic
1074406053 10:113181122-113181144 GAGGAGGGGGAGGCTGGAGTGGG - Intergenic
1074903414 10:117839302-117839324 ACCGATGGGGAGCCAGGAGGGGG - Intergenic
1075291721 10:121236696-121236718 CATGCTGAGGAGCCTGGAGTTGG - Intergenic
1076038306 10:127220300-127220322 AATGAAGAGGAGGCAGGAGTGGG + Intronic
1076551259 10:131279434-131279456 CATGATGTGAAGCCTGGAATGGG - Intronic
1076643551 10:131935493-131935515 CAGGAAGGGGAGCCTGGAGGAGG + Intronic
1076830304 10:132991211-132991233 CATGACAGGGAGCCTGGTGTGGG - Intergenic
1077368472 11:2170785-2170807 CCTGATGGGGAGCCTGGTGGGGG + Intronic
1078135086 11:8645204-8645226 AATGGTAGGTAGCTTGGAGTTGG + Intronic
1078443652 11:11387808-11387830 AATGATGGTGAGCCTGGCTTGGG + Intronic
1078872555 11:15362640-15362662 AATGAGGTGGAGGTTGGAGTGGG - Intergenic
1079024616 11:16936539-16936561 AATGATTGGGAGAGTGGAGGTGG - Intronic
1079122815 11:17697282-17697304 ACTGCTGGGGAGCCTGGTGTGGG - Intergenic
1079609883 11:22419083-22419105 AATGCTGGAGATCCTGGAGGAGG - Intergenic
1081688096 11:45056605-45056627 GAGGATGGGGAGCCAGGAGGAGG - Intergenic
1082008656 11:47435941-47435963 AAGGAGGGGCAGCCTGGCGTGGG - Intergenic
1082042681 11:47699302-47699324 CATGAGTGGGAGCCTGGAGGAGG - Intronic
1083149383 11:60782403-60782425 CATGCTGGGGATCCAGGAGTGGG - Intergenic
1083463915 11:62832854-62832876 AATGAGGGGTAGCTTGGGGTGGG - Intronic
1083750812 11:64759631-64759653 GCTGCTGGGGAGCCTGGGGTGGG - Intronic
1083921437 11:65783039-65783061 AATGAGGGAGGGCGTGGAGTGGG - Intergenic
1085294180 11:75421372-75421394 AATGAGGGGGAGCCTGCAGCTGG + Intronic
1087411654 11:97798306-97798328 AATGCTAGGGAGCCTAGAGTGGG + Intergenic
1089380890 11:118030667-118030689 AAAGATGGGAAGCCTGGTGTGGG + Intergenic
1089462799 11:118662608-118662630 AGTGCTGGGCAGCCTGGAGGTGG + Intronic
1089702329 11:120252976-120252998 AAGGAGGGGGAGCCTGGTGTGGG + Intronic
1091804115 12:3343659-3343681 AGTGATGGGGAGCAAGGGGTGGG + Intergenic
1091898262 12:4121973-4121995 GTTGATGAGGAGCCTGGGGTTGG + Intergenic
1091983243 12:4883623-4883645 AATGATGGAGTGCTTGGAGGCGG + Intergenic
1092986074 12:13847666-13847688 AATGATGGAGAGCAGGGAGCAGG + Intronic
1094105273 12:26804844-26804866 ACTGATAGGGAGGCTGAAGTGGG - Intronic
1095448216 12:42303208-42303230 ATGGATGGGGAGCCGGAAGTGGG + Intronic
1096018126 12:48296895-48296917 AAAGACTGGGCGCCTGGAGTGGG - Intergenic
1096428957 12:51527534-51527556 AATGTTGAGGTGCCTGGAGGAGG - Intergenic
1097069702 12:56345957-56345979 AAGGCTGGGGAGACTGGAATAGG + Intronic
1098594515 12:72256219-72256241 AATAATGGGGAGCCAAGACTGGG - Intronic
1100673243 12:96838861-96838883 AAAGATGGGGAGAATGAAGTGGG + Intronic
1101447312 12:104746495-104746517 AGTGATGGAGGGCCTGGTGTTGG - Intronic
1102944844 12:116977156-116977178 AATGATGGCGAAACTGCAGTCGG - Intronic
1103446565 12:120999037-120999059 GATGCAGGGGAGCCTGGAGGAGG - Intronic
1104357995 12:128105602-128105624 AATTATGCGGAGGCTGGAGGAGG - Intergenic
1107991450 13:45822113-45822135 GATGCTGGGGAGCTTGGACTGGG - Intronic
1108207479 13:48105505-48105527 GAGGATGAGGAGACTGGAGTAGG + Intergenic
1110072213 13:71191439-71191461 AAGGATGGGGAGCATGTAGATGG + Intergenic
1110460935 13:75745109-75745131 TTTGATCAGGAGCCTGGAGTGGG + Intronic
1111504150 13:89164203-89164225 AGTGATGGGGAGCCTAGGGAGGG + Intergenic
1113842560 13:113368613-113368635 AATGATATGAAGTCTGGAGTTGG + Intergenic
1114201303 14:20523365-20523387 AATGATGGGGAGGCTGGGCATGG - Intergenic
1118060480 14:62132483-62132505 AATGATAGGGAGCAAGGTGTGGG - Intergenic
1121019578 14:90571083-90571105 ACTGATGGGGACCCTGCTGTTGG - Intronic
1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG + Intergenic
1122809351 14:104280365-104280387 AATGATGGGAAGCCATGGGTGGG + Intergenic
1125387169 15:39150104-39150126 AGTGTTTGGGAGCCAGGAGTGGG + Intergenic
1128131242 15:65228484-65228506 AGTGATGGGGAGCATGGTGTAGG + Intergenic
1128634937 15:69297141-69297163 AATGATGTGGAGCCAGGAGAGGG - Intergenic
1129307776 15:74680172-74680194 AATGATGGGAACCCAGGAGGAGG + Intronic
1129316574 15:74748969-74748991 AAAGACGGGGAGCCTGGGCTAGG + Intronic
1130707415 15:86246346-86246368 GTTGCTGGGGAGCCTGGAGGTGG + Intronic
1132067393 15:98743593-98743615 AAAGGTGGGGAACCTGGAGGCGG + Intronic
1133318840 16:4900767-4900789 GAGGATGGGAAGCTTGGAGTCGG - Intronic
1134905768 16:17978361-17978383 AATGATGGGGAGAGTGGCGAGGG - Intergenic
1135597954 16:23757429-23757451 AATGATGGGGTCTCTGGAATGGG + Intronic
1135867702 16:26119530-26119552 GAGGTTAGGGAGCCTGGAGTGGG + Intronic
1136014150 16:27384064-27384086 AATGATGAGGGCCCTGGTGTGGG - Intergenic
1137732535 16:50699340-50699362 TATGGTGGGGAGCTTGGATTGGG + Intronic
1139472767 16:67187110-67187132 AATGATGGGGAGCCTGGAGTTGG - Exonic
1139775791 16:69316408-69316430 AATGATAGGGAGCCGTGAGGAGG - Intronic
1139968243 16:70757461-70757483 AGTGCTGGGGAGGCTGGAGAAGG + Intronic
1140140517 16:72252309-72252331 AATGATTGGGAGTGGGGAGTGGG + Intergenic
1141149869 16:81556593-81556615 AAGGAAGGGGAGCCGGGAGTTGG + Intronic
1142278921 16:89137701-89137723 AAGGATGGGGAGAGGGGAGTGGG + Intronic
1144590663 17:16521004-16521026 GAGGATGGGGAGCCTGGTGCTGG + Intergenic
1144626518 17:16846874-16846896 CATCTTGGGGAGCCTGGAGTGGG - Intergenic
1144721060 17:17470264-17470286 AATGAAGGGGACCCTGGTGATGG - Intergenic
1144763692 17:17721804-17721826 AAATATGGGGAGCCCCGAGTGGG + Intronic
1144879914 17:18425837-18425859 CATCTTGGGGAGCCTGGAGTGGG + Intergenic
1145152319 17:20518547-20518569 CATCTTGGGGAGCCTGGAGTGGG - Intergenic
1146163664 17:30572750-30572772 CATCTTGGGGAGCCTGGAGTGGG - Intergenic
1146574359 17:33978567-33978589 AAGGATGGTGTGCCTGGGGTGGG + Intronic
1147014386 17:37479208-37479230 AATGATGTGGAGGCAGCAGTGGG + Exonic
1147399673 17:40172777-40172799 AATGATGGGAACCCGGGAGGTGG + Intergenic
1147419356 17:40314482-40314504 AGTGATGGGCAGGCTGCAGTGGG + Intronic
1147580658 17:41625561-41625583 CATCTTGGGGAGCCTGGAGTGGG - Intergenic
1148683094 17:49485921-49485943 AATGAGGGGGGCCCTGGAGGCGG - Intergenic
1148690589 17:49524745-49524767 AGAGGTGGGGAGCCTGGAGTGGG + Intergenic
1151354794 17:73551869-73551891 ACAGAAGGGAAGCCTGGAGTTGG - Intronic
1153753949 18:8261239-8261261 AAGGATGGGGAGCTGGGGGTGGG + Intronic
1156372693 18:36485478-36485500 AATGGTGGGGAGCAGGGACTGGG - Intronic
1158888232 18:61849001-61849023 AGGGAAGGGGAGCCTGGAGAGGG + Intronic
1158902750 18:61981561-61981583 AATAATGGGGAGTCTGGAAATGG - Intergenic
1159509701 18:69380349-69380371 AATGCTGGGGGTCCTGGTGTTGG - Intergenic
1160376770 18:78419858-78419880 GGTGATGGGGAGGCTGGAGACGG - Intergenic
1160555339 18:79721000-79721022 AATGAGGGGGCGCCTGGGGCAGG + Intronic
1161285061 19:3464434-3464456 AAAGATGGCGATCCTGGGGTGGG - Intronic
1161577270 19:5061238-5061260 GAAGATGGGGAGCCTGGGATGGG - Intronic
1162269287 19:9600929-9600951 AATGAAGGGGAGCCAGATGTGGG - Intergenic
1162344322 19:10110769-10110791 AAGGACGGCGAGCCTGGAGTTGG + Exonic
1163127119 19:15250302-15250324 AATGGTGAGGACCCTGGAGGTGG - Intronic
1163254245 19:16145514-16145536 AATGATTAAGAGCCTGGAATTGG - Intronic
1163758486 19:19120598-19120620 CAGGAAGCGGAGCCTGGAGTGGG - Intronic
1164261280 19:23570299-23570321 AATGCTGGGGAGGGTGGAGGTGG - Intronic
1165045009 19:33097836-33097858 AAGGACGAGGAGCCTGGAGACGG + Exonic
1165148825 19:33749415-33749437 GATGATGGGGAGGATGGAGGGGG - Intronic
1166404382 19:42509152-42509174 AGGGATGGGGAGGCTGAAGTTGG + Exonic
1168180506 19:54659658-54659680 AATGAAGGGATGCCTGGAGGTGG - Intronic
1168571990 19:57478045-57478067 CATGATGTGGAACGTGGAGTGGG + Intergenic
925421574 2:3717173-3717195 AATAATGGAGAGAATGGAGTGGG - Intronic
925854670 2:8118036-8118058 AATGATGGGAAGCTTGGGGAAGG - Intergenic
927099197 2:19775036-19775058 GAGGAATGGGAGCCTGGAGTGGG - Intergenic
928948639 2:36794190-36794212 AATGACAGGGAGCCAGAAGTTGG - Intronic
929465640 2:42141427-42141449 CATGTTGGGGCGCCTGGATTTGG - Intergenic
929910744 2:46087491-46087513 AAGGAAGGGAAGCCTGGAGTGGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930781189 2:55225737-55225759 GGAGATGGGGAGCCTGGAGGAGG - Intronic
931147338 2:59533662-59533684 AAGGATGGGGAAACTGGAGGAGG + Intergenic
931187701 2:59969541-59969563 AATCAAGGGGAGCCTGAAGTTGG + Intergenic
933745098 2:85564840-85564862 AAAAATGGGGAGCCTGAAGGGGG + Intronic
934157586 2:89217962-89217984 AATGAAGAGGAGCAGGGAGTGGG - Intergenic
934209679 2:89964463-89964485 AATGAAGAGGAGCAGGGAGTGGG + Intergenic
936288804 2:111201793-111201815 AATGCTCTGGATCCTGGAGTGGG - Intergenic
937063096 2:118994708-118994730 AATGTTGTGGTGCATGGAGTGGG - Intergenic
938161634 2:128989679-128989701 AAGGATGGGGACCTTGGGGTGGG - Intergenic
940159889 2:150700137-150700159 AATGACTGGGAGCTTGGAATAGG + Intergenic
942983175 2:182106529-182106551 ATGGATGGGGAGCCAGAAGTGGG - Intronic
944275932 2:197837596-197837618 AAGGATGGAGAGCCGGGATTGGG + Intronic
944518173 2:200533447-200533469 GATGATGGGTAGCCTTGAGGAGG + Intronic
945052983 2:205843162-205843184 AGAGATGGGGAGCCTGGGATTGG - Intergenic
946931665 2:224677411-224677433 AATGATGGGAACCCAGGAGGCGG - Intergenic
947065189 2:226216768-226216790 AAAGATGGCGAGCCTGGCCTAGG + Intergenic
948653813 2:239464711-239464733 AGTGGTGGGGAGCCGAGAGTAGG + Intergenic
1169137599 20:3206742-3206764 AATGGTGGGGACCCGGGAGGCGG + Intergenic
1170157350 20:13280652-13280674 AAAGAAAGGGAGCCTGGAGAAGG + Intronic
1170961893 20:21032845-21032867 AGAGGTGGGGAGGCTGGAGTAGG + Intergenic
1171460877 20:25297184-25297206 ACTGAGGGGGACACTGGAGTGGG + Exonic
1172099483 20:32476601-32476623 ATGGATGGGGAGTTTGGAGTAGG - Intronic
1172947578 20:38701136-38701158 AATGTCCTGGAGCCTGGAGTGGG + Intergenic
1173104733 20:40123229-40123251 TTTGATGGGGAGCCTGGAGAAGG - Intergenic
1174176494 20:48648724-48648746 AATGATGGGGAAGCAGGTGTGGG - Intronic
1174294940 20:49539389-49539411 AATGGTGGGGAGCCAGGGCTTGG - Intronic
1177157860 21:17516659-17516681 AAGAATGGGGATCCTGGAGCAGG + Intronic
1178454245 21:32732558-32732580 AACGGAGGGGAGCCTGGAGGAGG - Intergenic
1178913113 21:36692459-36692481 AATGAAGAGGGGACTGGAGTCGG + Intergenic
1179952406 21:44716330-44716352 AATGATGGGGAGCCCAGCCTTGG - Intergenic
1181780723 22:25190983-25191005 AAAGCTGGGCTGCCTGGAGTGGG + Intronic
1182321203 22:29479549-29479571 GATGAAGGGGGACCTGGAGTTGG - Intergenic
1182828543 22:33285854-33285876 AATGAGGGGGAACCTGGATCAGG + Intronic
1183352204 22:37340591-37340613 AATGATGGAGAGCCAGGAGGCGG + Intergenic
1183509788 22:38228012-38228034 GAGGACGAGGAGCCTGGAGTGGG + Intronic
1184459861 22:44630982-44631004 AAGGGTGGGGAGCCAGGAGTGGG + Intergenic
1184709983 22:46244170-46244192 GGAGATGGGGAGCCTGGAGTAGG + Exonic
1185075240 22:48679251-48679273 ATGGATGGGGAGCCGGGAGAGGG - Intronic
1185117781 22:48947784-48947806 CATGGTGGGGAGCCTGGTGAGGG - Intergenic
1185117992 22:48949009-48949031 AGTGGAGGGGAGGCTGGAGTGGG - Intergenic
950893634 3:16427872-16427894 CATGATGGGTAGACTGGAATAGG - Intronic
952862993 3:37830435-37830457 AATGAGTGGGAGCCAGGAATTGG + Intergenic
952899433 3:38099798-38099820 AATGAGGCTGAGCCTGCAGTAGG + Intronic
954144519 3:48627930-48627952 GATGATGGTGAGACTGGAGGTGG - Exonic
954268678 3:49490264-49490286 AATGATGTGGACCCGGGAGGTGG + Intronic
956072739 3:65471680-65471702 TATGATGTAGAGCCAGGAGTAGG - Intronic
956638054 3:71386043-71386065 GATGATTGGGAGAATGGAGTTGG - Intronic
956643958 3:71438548-71438570 AGTGGAGGGGAGCCTGGAGAAGG - Intronic
956689283 3:71861109-71861131 ATGGATGGGGAGCCTGAAGGGGG - Intergenic
957183845 3:76916451-76916473 AATGCTCGGGAGGCTGAAGTGGG - Intronic
957409801 3:79824660-79824682 AATGATGTGCTGCCTGGGGTTGG + Intergenic
958124911 3:89343456-89343478 AATGATGGGGAGAATGGAGATGG - Intronic
959839553 3:110958834-110958856 ATGGATGGGGAGCCAGAAGTGGG + Intergenic
960460977 3:117935637-117935659 AAAGATGGGGAGCTAGCAGTGGG + Intergenic
962444354 3:135451465-135451487 AATGGGAGGGAGCCTGGAGGAGG + Intergenic
963925230 3:150944222-150944244 AATGGTGGGGAGGCAGAAGTGGG + Intronic
964031463 3:152144007-152144029 AATGGTGGGGAGGTTGGGGTGGG + Intergenic
965854054 3:173066439-173066461 CATGCTGGGCTGCCTGGAGTTGG - Intronic
966768882 3:183486491-183486513 AATGGTGGGGAGACTGGGGAGGG + Intergenic
967219605 3:187237521-187237543 AATGATGGGTGGCCCAGAGTAGG - Intronic
969094215 4:4719832-4719854 ACTGAGGGAGAGCCTGGAGCAGG + Intergenic
969280860 4:6170085-6170107 AATGATGGGGATCGTGGCGGTGG - Intronic
969331290 4:6474641-6474663 CATGCTGGGGACCCTGCAGTGGG + Intronic
969446363 4:7246943-7246965 AAGGAAGGGGACCCTGGAGGAGG - Intronic
972201678 4:36720360-36720382 AATTTTGGGGATTCTGGAGTTGG - Intergenic
975760121 4:77611973-77611995 ACTACTGGGGAGCCTGAAGTGGG - Intergenic
975767928 4:77688532-77688554 ATTGTTGGGAAGCCTGGAGAAGG - Intergenic
976596134 4:86896951-86896973 AATGATGGCTAGCATGGAGTAGG - Intronic
978204490 4:106064043-106064065 AGTAATGGGGAGCCGGGAGAGGG + Intronic
980233722 4:130076895-130076917 AATAATGGTGAGTTTGGAGTGGG - Intergenic
983941402 4:173537845-173537867 AATCGTGGGGTGCCTAGAGTCGG - Intergenic
984311893 4:178071780-178071802 TATGATGGGCAGACTGGAATTGG - Intergenic
984940234 4:184924867-184924889 GATGCTGGGGTGGCTGGAGTGGG - Intergenic
985746695 5:1652174-1652196 AAGAAGGGGGTGCCTGGAGTGGG + Intergenic
985860775 5:2469032-2469054 AAGGAAGGAGAGCCTGGAGATGG + Intergenic
988158866 5:27493186-27493208 AATTATAGGGAGCAGGGAGTAGG + Intergenic
989186808 5:38633944-38633966 AATGATGTGAACCCTGGAGGTGG - Intergenic
995054104 5:107740309-107740331 AATGAAGGTCAACCTGGAGTAGG - Intergenic
995127379 5:108591870-108591892 AAAGATGGGGAGTGGGGAGTTGG + Intergenic
997390227 5:133509135-133509157 AGTGATGGGGTGGCTGGAATAGG - Intronic
998819899 5:146049009-146049031 CCTGATGGGGGGCATGGAGTGGG - Intronic
999104190 5:149054909-149054931 AAGGATGGGGACCCTGGCTTGGG + Intronic
1001858379 5:175032318-175032340 AAGGATGGGGAGCCTGCTATAGG - Intergenic
1002049412 5:176561615-176561637 ACAGAAGGGGATCCTGGAGTTGG + Intronic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1003514647 6:6807828-6807850 AATAAGGGGGAGCCTTGTGTTGG - Intergenic
1005524105 6:26628624-26628646 TGTGATGGGTAGCATGGAGTGGG - Intergenic
1007608047 6:43130414-43130436 ATTGCTGGTGAGCCTGGGGTGGG + Exonic
1007693875 6:43719531-43719553 AATGGTGGGGAGATGGGAGTTGG + Intergenic
1008345777 6:50424536-50424558 CATGTTGGGGTGCCTGGGGTAGG + Intergenic
1009844765 6:69121735-69121757 GATGATGGGCAGCCAGGCGTAGG + Intronic
1012456791 6:99415879-99415901 AATGCTGCGAAGACTGGAGTTGG - Intronic
1012545360 6:100413023-100413045 AATGATCTGGAGACAGGAGTTGG - Intronic
1014085853 6:117342742-117342764 AATGATTGGTAGCCTTCAGTTGG + Intronic
1018525994 6:164710512-164710534 ATGGATGGGGAGCCGGAAGTGGG + Intergenic
1018526012 6:164710573-164710595 ATGGATGGGGAGCCAGAAGTGGG + Intergenic
1018577552 6:165275765-165275787 GATGGTGGAGAGCATGGAGTGGG - Intergenic
1021770979 7:24000858-24000880 AATCTTGGAGAGCCTGAAGTTGG - Intergenic
1022394866 7:29978350-29978372 CATGATGGCAAGACTGGAGTTGG + Intronic
1024457810 7:49629158-49629180 AATTATGAGGGGCCAGGAGTAGG - Intergenic
1024715321 7:52073513-52073535 AATAATGGGGAATCTGGAATGGG - Intergenic
1024794572 7:53005533-53005555 AACGTTGGTGACCCTGGAGTGGG + Intergenic
1027948418 7:84780594-84780616 AATGTAGGGGAGGCTGCAGTAGG + Intergenic
1029508408 7:100977143-100977165 AAAAATGGGGACCCTGGAGCTGG - Intronic
1029611600 7:101629563-101629585 GATGATGGGGAGCCAGAAGGGGG + Intergenic
1030513606 7:110515476-110515498 ATGGATGGGGAGCCAGAAGTGGG + Intergenic
1031129491 7:117815576-117815598 AATAGTGGGGAGCCTGTTGTTGG - Intronic
1032001435 7:128267941-128267963 AATGATGGTAAGCGAGGAGTTGG + Intergenic
1032395145 7:131584052-131584074 AATGATGGGAAGGCTGGAAGAGG + Intergenic
1033356069 7:140601535-140601557 AAAGATGGGAAGCCTGGCATCGG - Exonic
1033522518 7:142175530-142175552 AATGAAGAGGGGCCTGGAATGGG + Intronic
1034542114 7:151764849-151764871 AAGCATGGGGAGGCTGCAGTGGG + Intronic
1034852521 7:154508314-154508336 AATGAGGATGAGCCTGGAGGTGG + Intronic
1034938760 7:155216548-155216570 GATGCTGAGGAGCCTAGAGTGGG + Intergenic
1035596065 8:858942-858964 AATGGTGGGGAAACTGGGGTGGG + Intergenic
1036411529 8:8506326-8506348 ATGGATGGGGAGCCGGAAGTGGG - Intergenic
1036497409 8:9282010-9282032 CATGATGGGGACCCTCGAGGTGG - Intergenic
1038024403 8:23576005-23576027 AATGCAGGGGTGCCTGGAGGTGG + Intergenic
1039561587 8:38516665-38516687 AATGAAGCAGAGCCTGGGGTTGG + Intronic
1040021715 8:42746799-42746821 TGTGGTGGTGAGCCTGGAGTTGG - Intergenic
1042784298 8:72530817-72530839 AATGATGTGAAGTCTGGAGCTGG + Intergenic
1045409796 8:101905382-101905404 AGTGATTGGGAGGCTGGAGAAGG - Intronic
1045903708 8:107316554-107316576 AAAGCTGAGAAGCCTGGAGTAGG - Intronic
1045966975 8:108036180-108036202 AATGAGGGTCAGCCTGAAGTGGG - Intronic
1046617232 8:116490829-116490851 AATGATGGGGATCTTGCAGGAGG - Intergenic
1046686523 8:117233747-117233769 AATTAATAGGAGCCTGGAGTTGG - Intergenic
1047672089 8:127159080-127159102 AGAGGTGGGGAGCGTGGAGTAGG - Intergenic
1048887307 8:138918637-138918659 ATTGAGGGGTTGCCTGGAGTGGG - Intergenic
1048916925 8:139193934-139193956 AATGATTGCTGGCCTGGAGTAGG - Intergenic
1048963952 8:139601694-139601716 AATGAGGGTGAAACTGGAGTAGG + Intronic
1049397514 8:142408158-142408180 AATGAGGAGGAGCCAGGAGATGG - Intergenic
1049456418 8:142693310-142693332 TCTGCTGGGGAGCCTGGAGCCGG - Intergenic
1049804509 8:144532824-144532846 AGCCATGGGTAGCCTGGAGTGGG - Intronic
1050290457 9:4148805-4148827 ATTGCTGAGAAGCCTGGAGTGGG + Intronic
1051469609 9:17423086-17423108 CATGCTGGGTTGCCTGGAGTTGG + Intronic
1052323610 9:27194100-27194122 AAGGATATGGAGCCTGGACTGGG - Intronic
1052411994 9:28133636-28133658 ACTGATGGGCAGCTTGGAGGCGG + Intronic
1056368567 9:85931134-85931156 AATGGTGGGGAGCACGGGGTTGG + Intergenic
1056967586 9:91178098-91178120 AAAGGTGGGGAAACTGGAGTTGG - Intergenic
1057231171 9:93322403-93322425 AATGATGGGAACCCGGGAGGCGG - Intronic
1057585737 9:96327186-96327208 CATGATTGGAACCCTGGAGTTGG - Intronic
1058906103 9:109483843-109483865 AATGATGGGGAGCCTTGTGGAGG - Intronic
1059256633 9:112937034-112937056 AATGAGGCGCAGCCTTGAGTAGG - Intergenic
1060368899 9:123050095-123050117 AATTGTGTGGAGACTGGAGTTGG - Intronic
1060536009 9:124388726-124388748 AATCATGGGCAGCGTGGTGTTGG - Intronic
1060727858 9:126017608-126017630 TGGGATGGGGAGCGTGGAGTGGG + Intergenic
1061348909 9:130048563-130048585 AATGATGTGAACCCTGGAGACGG - Intergenic
1061789631 9:133052262-133052284 AAGGATGGGGAGCCAGGATAGGG - Intronic
1186524550 X:10236446-10236468 AAGGATGAGGAGTCTGCAGTGGG + Exonic
1187292768 X:17971274-17971296 AATTGTGGGGAGCCTGGATTTGG - Intergenic
1188807102 X:34605070-34605092 AAGGATGGGGAGCTGGAAGTGGG - Intergenic
1190060929 X:47211274-47211296 ACTGGTGGGGAGGCTGGACTAGG - Intronic
1193023217 X:76815117-76815139 AATGAGGGGGAGCATGAATTAGG - Intergenic
1193469172 X:81878427-81878449 ACTGCTGGCCAGCCTGGAGTTGG + Intergenic
1194884312 X:99294164-99294186 AATGATGAGGAGCTTGAAGTTGG + Intergenic
1199311874 X:146330279-146330301 AATGATGGGAACCCAGGAGGTGG - Intergenic
1199484767 X:148335610-148335632 AATAATGGGGAGCAAGGAGGAGG - Intergenic
1199587532 X:149431910-149431932 AAAGATGGTGAGTATGGAGTTGG + Intergenic
1199802604 X:151266265-151266287 AATGATTGGAAGCCTGGGGTTGG - Intergenic