ID: 1139473988

View in Genome Browser
Species Human (GRCh38)
Location 16:67193335-67193357
Sequence GACTCAGGTCCACCGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139473988_1139473997 -3 Left 1139473988 16:67193335-67193357 CCCTCCCCCGGTGGACCTGAGTC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1139473997 16:67193355-67193377 GTCCCCAGAACGGTCTCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1139473988_1139474003 29 Left 1139473988 16:67193335-67193357 CCCTCCCCCGGTGGACCTGAGTC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1139474003 16:67193387-67193409 CAGACCTTAGCTAAAGAATTGGG 0: 1
1: 0
2: 0
3: 15
4: 119
1139473988_1139473996 -4 Left 1139473988 16:67193335-67193357 CCCTCCCCCGGTGGACCTGAGTC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1139473996 16:67193354-67193376 AGTCCCCAGAACGGTCTCTGAGG 0: 1
1: 0
2: 1
3: 9
4: 103
1139473988_1139474002 28 Left 1139473988 16:67193335-67193357 CCCTCCCCCGGTGGACCTGAGTC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1139474002 16:67193386-67193408 TCAGACCTTAGCTAAAGAATTGG 0: 1
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139473988 Original CRISPR GACTCAGGTCCACCGGGGGA GGG (reversed) Intronic
900505347 1:3027603-3027625 GACTCATCTCCACCAGGGGCAGG + Intergenic
901004987 1:6167182-6167204 GCCTCAGGTCCCCCCGGGGCAGG + Intronic
901143353 1:7049988-7050010 GAATGGGGTCCAGCGGGGGAAGG + Intronic
901302367 1:8209095-8209117 GACTCAGGTGCCCAGGGGCAGGG + Intergenic
906182433 1:43833777-43833799 GGCGCAGGTCCACAGGGGGATGG + Intronic
907562638 1:55405069-55405091 GACTCAGTTCCACAGGGCTAAGG + Intergenic
920051700 1:203168273-203168295 GCCTCAGAACCACCAGGGGAAGG + Intronic
922315248 1:224435399-224435421 GACTCTGCTCCACCCTGGGAAGG + Intronic
922870337 1:228897582-228897604 GACTCAGGTGCATTGGGGCATGG - Intergenic
924440379 1:244080872-244080894 GACACAGCTCCACCGAGGCAGGG + Intergenic
1066318852 10:34278708-34278730 GACTCAGTTCCACAGGGCTAAGG - Intronic
1067044122 10:42974949-42974971 GCCTCAGGTCCAGTGGGAGAGGG + Intergenic
1068753767 10:60626874-60626896 GACTGAGGACCAGCTGGGGAGGG + Intronic
1070334785 10:75445690-75445712 CACTCAGGGCCCCTGGGGGAGGG - Intronic
1070479701 10:76870235-76870257 GACTCAGGGTCAGCGTGGGAAGG - Intronic
1070775946 10:79109879-79109901 GACTGAGGTCTGCTGGGGGAAGG - Intronic
1075425247 10:122337066-122337088 CACTCAGGCCCACTGGGGAAGGG + Intronic
1077393361 11:2309818-2309840 GACTCAGGCCCTCTGGGGGTGGG + Intronic
1083301390 11:61741224-61741246 GAGTCAGGTCCACCTCGGTAGGG - Exonic
1083580232 11:63819930-63819952 GCCTCAGCTCCACCAGGGTAAGG - Intronic
1084860616 11:72015567-72015589 GACACAGGCCCAGCGGGAGAAGG - Exonic
1088971607 11:114779381-114779403 GACTCAGGTGCACCTGGGAAGGG + Intergenic
1094871733 12:34602621-34602643 GTCTCAGGCCCACGGGGGGCAGG + Intergenic
1103334380 12:120178279-120178301 GACTCAGTTCCATGGGGGCAGGG + Intronic
1104856221 12:131903669-131903691 GACTCAAGGCCACTGGGGGTGGG - Intronic
1105750868 13:23420844-23420866 GCCTCATGTCCACCTGGGGCCGG + Intronic
1106578594 13:30998943-30998965 GGCTCAGGTCCACTGAGGGCAGG + Intergenic
1114709713 14:24766163-24766185 GACTCAGGTCCCCATGGTGAGGG - Intergenic
1121696864 14:95920705-95920727 GGCTCATGTGCACAGGGGGAGGG + Intergenic
1123164602 14:106314540-106314562 GACTCACGACCACTGGGGAAGGG - Intergenic
1202898007 14_GL000194v1_random:21153-21175 GCCTCATGTCCACCTTGGGATGG - Intergenic
1124005908 15:25795296-25795318 GACACAGGCCCACGGAGGGAGGG + Intronic
1125829559 15:42704634-42704656 TACTCAGGTCCATCGGGGCCAGG - Intronic
1125831266 15:42718587-42718609 GCCTCAGGTCCTCTAGGGGAAGG + Intronic
1125887081 15:43237110-43237132 CACTCAGGTCCACTCGGGTATGG + Intronic
1133390585 16:5407048-5407070 GACTCAGTTCCACCTGGGTGGGG + Intergenic
1137056419 16:35748516-35748538 GACTGACTTCCACGGGGGGAGGG - Intergenic
1137715262 16:50594679-50594701 GGCTCAGGGCCACCTGGGGTGGG + Intronic
1139473988 16:67193335-67193357 GACTCAGGTCCACCGGGGGAGGG - Intronic
1141636443 16:85316551-85316573 CACTGAGGTCCACAGGGGTAAGG + Intergenic
1142763826 17:2055387-2055409 GACTCAGGACCACCGGGCCGCGG + Intronic
1145024543 17:19458110-19458132 GACTCAGGCCTAGCAGGGGAAGG + Intergenic
1147720616 17:42537245-42537267 GTCTCAGCTCCACCTGGGGTGGG + Intronic
1147944229 17:44071216-44071238 GACTCAGGGCCCTCGGGGGTGGG - Intronic
1152937674 17:83149982-83150004 GACGCTGCTCCACCAGGGGAGGG - Intergenic
1154335598 18:13462361-13462383 GACTGGGGGCCACAGGGGGACGG + Intronic
1154338592 18:13485147-13485169 AGCTCAGGTCCACCGAGGGAAGG - Intronic
1154346268 18:13546019-13546041 AACTTAGGTCCAGAGGGGGAAGG - Intronic
1155009477 18:21761600-21761622 CACCCAGGTCCACTGAGGGAGGG - Intronic
1155590168 18:27418913-27418935 GTCTCAGGACCACCAGAGGATGG - Intergenic
1156973461 18:43186504-43186526 AAATCAGGTGCAACGGGGGAGGG + Intergenic
1160424032 18:78768089-78768111 GACCCATGTCCACAGGGAGAGGG - Intergenic
1160684041 19:425216-425238 TCCCCAGCTCCACCGGGGGACGG - Exonic
1160731746 19:644448-644470 GCCTCAGATCCCCCGGGGAAGGG + Intergenic
1160733746 19:652549-652571 GACCCAGGCCCTCCGGGGAAGGG - Intronic
1160937873 19:1605745-1605767 AACTGAGGTCCAGCGGGGAAGGG + Intergenic
1161356231 19:3820835-3820857 GACACAGGGACACCGGGGGTCGG + Intronic
1161356256 19:3820910-3820932 GACACAGGGACACCGGGGGTCGG + Intronic
1161356285 19:3821009-3821031 GACACAGGGACACCGGGGGTCGG + Intronic
1162719215 19:12652152-12652174 GGCTCAGATCCACCTGGTGAAGG - Exonic
1162823616 19:13237790-13237812 CACCCAGCTCCACCTGGGGATGG + Intronic
1164412323 19:28016308-28016330 TACTCAGGTCCATCTGTGGAAGG - Intergenic
1165321339 19:35087088-35087110 GACCCAGGTCCACCTGCGGAGGG + Intergenic
1167429694 19:49447341-49447363 GACTCAGCTCTCCCGGGGGCGGG + Exonic
1167903843 19:52642121-52642143 GACTCAGGTGTACAGAGGGACGG + Intronic
925915170 2:8599848-8599870 GACCCAAGTCCACTGGGGCAAGG + Intergenic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
926329698 2:11814210-11814232 GACTCAGGTGCTCTGGGAGAAGG + Intronic
926346129 2:11947338-11947360 GACTCAGGTCCACAGGGCCCGGG + Intergenic
931462470 2:62461083-62461105 GACTCAGTTCCTCTGTGGGAAGG - Intergenic
932101855 2:68908518-68908540 GACTCAGGGACACCTGCGGAGGG - Intergenic
934614173 2:95761171-95761193 GACTCAGGGACAGCTGGGGAGGG - Intergenic
934646737 2:96063357-96063379 GACTCAGGGACAGCTGGGGAGGG + Intergenic
934840140 2:97619439-97619461 GACTCAGGGACAGCTGGGGAGGG + Intergenic
946176236 2:217923258-217923280 GCTTGAGGTCCACTGGGGGAAGG - Intronic
948495523 2:238346225-238346247 GACTCAGCTCAACCCTGGGATGG - Intronic
1168998893 20:2152459-2152481 GTGTCAGGTCCATAGGGGGAAGG + Intronic
1171442772 20:25178820-25178842 GTCTGAGGGCCACTGGGGGAGGG - Intergenic
1174821943 20:53733932-53733954 GACACAGATCCACAGGGAGAAGG + Intergenic
1176022815 20:62970754-62970776 GAATAAGGTGCACCGCGGGATGG + Intergenic
1176617688 21:9037142-9037164 GCCTCATGTCCACCTTGGGATGG - Intergenic
1176707463 21:10126545-10126567 GACAGATGTCCACCTGGGGACGG + Intergenic
1178904635 21:36626573-36626595 GACTCAGGCCCACAGGGAGCAGG - Intergenic
1179209656 21:39313986-39314008 GACCCAGGTCCCACGGGGGGCGG - Intronic
1182451555 22:30424815-30424837 AACTGAGGTCCAGCGGGGGAAGG + Exonic
1183161199 22:36114499-36114521 GACCCAGGGCCACCGTGGAATGG - Intergenic
1183382272 22:37496141-37496163 GACTTAGGTCCAGAGGGGGCAGG + Intronic
1184294946 22:43517255-43517277 GAGTGAGGTCCACAGGGGCAGGG + Intergenic
1184389809 22:44196863-44196885 GACTTAAGTCAGCCGGGGGAGGG - Intronic
1185081031 22:48709470-48709492 GACTGGGGTCCACAGGTGGATGG - Intronic
953613511 3:44468678-44468700 GAGTCAGCTCCTCGGGGGGAGGG - Intronic
954849142 3:53585707-53585729 GACTGTGCTCCACCTGGGGAGGG + Intronic
956282160 3:67569436-67569458 CACTCAGAGCCACCGGGGCATGG + Intronic
959350856 3:105261061-105261083 GAATCAGGTCCAGAGAGGGAAGG + Intergenic
961324940 3:126104377-126104399 GACTCAGGACCTCAGAGGGACGG - Intronic
964321107 3:155498074-155498096 GACTCATGTCCAGAGTGGGACGG - Intronic
975612209 4:76213979-76214001 CACTCAGGGCCACCGGGGACCGG - Intergenic
979584386 4:122398151-122398173 GACTCTGGGGCACCGGGGGAAGG - Intronic
981047833 4:140281678-140281700 AACTCAGGACCACCTGGGGCAGG + Intronic
983489899 4:168376574-168376596 GACTCAGCTCCATCTGTGGATGG + Intronic
985346313 4:189008793-189008815 GACTCAGGACCTCAGGGGGAAGG - Intergenic
986816828 5:11421566-11421588 CACTGTGGTCCACTGGGGGAGGG + Intronic
991082205 5:62613900-62613922 GACTCAGGCCCTTCGGGGGCTGG - Intronic
1001507560 5:172292024-172292046 GACACAGGTCTACTGGAGGAGGG - Intergenic
1002566633 5:180115900-180115922 GACTCAGCACCACTGAGGGAGGG - Intronic
1002662989 5:180803552-180803574 GACCCAGGCCCACCGAGGGGAGG + Intronic
1005272531 6:24181183-24181205 AACTCAGGTCCAGAGGGGAATGG + Intronic
1006597118 6:35201643-35201665 GACACATGTCCCCTGGGGGAGGG - Intergenic
1006904364 6:37523126-37523148 GACTCAGTTGCATTGGGGGATGG + Intergenic
1018986273 6:168639701-168639723 GACTCTGGTCCACCTGATGATGG - Intronic
1019491336 7:1314960-1314982 CACCCAGGCCCACCTGGGGATGG + Intergenic
1023885302 7:44349701-44349723 GTCTCAGATCCATGGGGGGAGGG + Intergenic
1029537159 7:101163553-101163575 GACGCCGGGCCACCGGCGGAAGG - Exonic
1032544007 7:132727085-132727107 GGCTCAGGTCCTGCGGGAGAGGG - Intronic
1034468425 7:151243297-151243319 GACCCAGGTCCAGCTGGGTATGG - Intronic
1035745600 8:1960255-1960277 GAGTCAGGTTCACCTGAGGAAGG + Intergenic
1039613091 8:38934532-38934554 GTCTCAGATTCACAGGGGGATGG + Intronic
1039951990 8:42179977-42179999 GCTGCAGGTCCGCCGGGGGAAGG + Exonic
1044221840 8:89678587-89678609 GACCCAGGGCCACCGTGGCATGG - Intergenic
1049656746 8:143802460-143802482 CACACAGGTCCACAGGGGGCAGG - Intronic
1051680545 9:19603478-19603500 GACTAAGATCCACAGGGTGAGGG + Intronic
1053644657 9:40113283-40113305 GACAGATGTCCACCTGGGGACGG + Intergenic
1053761325 9:41351568-41351590 GACAGATGTCCACCTGGGGACGG - Intergenic
1054350104 9:64013131-64013153 GCCTCATGTCCACCTTGGGATGG - Intergenic
1054539919 9:66262686-66262708 GACAGATGTCCACCTGGGGACGG - Intergenic
1056120757 9:83485673-83485695 GACTCAGGTCAACCAGAGAAGGG + Intronic
1062196149 9:135275334-135275356 GGCTCAGGACAACCGGAGGACGG - Intergenic
1202792211 9_KI270719v1_random:95425-95447 GACAGATGTCCACCTGGGGACGG + Intergenic
1185620752 X:1451312-1451334 GACCCAGGACCACCTAGGGATGG - Intronic
1186425780 X:9464198-9464220 GACTTAGGTACACCGGGGCCAGG + Intronic
1186893162 X:13980093-13980115 GACTAAGGTCCAACTGTGGAAGG + Intergenic
1191133596 X:57040853-57040875 GACACAGGTCCACTGGAGGATGG - Intergenic
1199606589 X:149584014-149584036 GCCTCAGGTCAACAGAGGGAGGG - Intronic
1199607012 X:149585805-149585827 GACTCAGGTCCACAGAGGGGTGG - Intronic
1199627924 X:149757887-149757909 GACTCAGGTCCGCAGAGGGATGG - Intergenic
1199632111 X:149783563-149783585 GACTCAGGTCCACAGAGGGGTGG + Intronic
1199632534 X:149785354-149785376 GCCTCAGGTCAACAGAGGGAGGG + Intronic
1201151076 Y:11095980-11096002 GCCTCATGTCCACCTTGGGATGG - Intergenic