ID: 1139474303

View in Genome Browser
Species Human (GRCh38)
Location 16:67194928-67194950
Sequence CCCTGGCAGTGCAGAAGTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139474294_1139474303 26 Left 1139474294 16:67194879-67194901 CCCAGGAAGCCTCACGTCCAAAT 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1139474303 16:67194928-67194950 CCCTGGCAGTGCAGAAGTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1139474297_1139474303 9 Left 1139474297 16:67194896-67194918 CCAAATAGTCCTCAGCTCACTCC 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1139474303 16:67194928-67194950 CCCTGGCAGTGCAGAAGTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1139474296_1139474303 17 Left 1139474296 16:67194888-67194910 CCTCACGTCCAAATAGTCCTCAG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1139474303 16:67194928-67194950 CCCTGGCAGTGCAGAAGTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1139474295_1139474303 25 Left 1139474295 16:67194880-67194902 CCAGGAAGCCTCACGTCCAAATA 0: 1
1: 0
2: 0
3: 27
4: 244
Right 1139474303 16:67194928-67194950 CCCTGGCAGTGCAGAAGTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1139474298_1139474303 0 Left 1139474298 16:67194905-67194927 CCTCAGCTCACTCCCACTGCTGT 0: 1
1: 0
2: 3
3: 47
4: 469
Right 1139474303 16:67194928-67194950 CCCTGGCAGTGCAGAAGTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139474303 Original CRISPR CCCTGGCAGTGCAGAAGTCC AGG Exonic
900185780 1:1332572-1332594 CCAGGGCAGAGCAGAAGGCCGGG - Exonic
900938346 1:5781185-5781207 CCCAGGCAGTGCAGACCTCAAGG + Intergenic
901629223 1:10640228-10640250 CCCTGGCACAGCAGGGGTCCTGG + Intronic
901634016 1:10661271-10661293 CCCGGGGAGGGCAGGAGTCCGGG + Intronic
902977984 1:20102791-20102813 CCCTGGCAGTGACGTATTCCTGG + Intergenic
903091405 1:20921847-20921869 CCATGGCAGGGCAGAAGCCTGGG - Intronic
903222168 1:21875057-21875079 CCCTGCCAGTGGAGGACTCCAGG - Intronic
904026229 1:27505264-27505286 CCCTGCCAGTGAGCAAGTCCAGG - Intergenic
908788340 1:67756831-67756853 ACCTTGCAGTGCAGATGACCCGG - Intronic
910944675 1:92577401-92577423 TGCCGGCAGGGCAGAAGTCCAGG + Intronic
913177102 1:116284971-116284993 CCCTGGCAGTGCTGATGAGCTGG + Intergenic
913652535 1:120932195-120932217 CCCTGGCATTCCAGAAATCCTGG - Intergenic
914168564 1:145196858-145196880 CCCTGGCATTCCAGAAATCCTGG + Intergenic
914523687 1:148440813-148440835 CCCTGGCATTCCAGAAATCCTGG + Intergenic
914642718 1:149626321-149626343 CCCTGGCATTCCAGAAATCCTGG - Intergenic
915747575 1:158176550-158176572 CCCTAGCACTCCAGAAGGCCGGG - Intergenic
917120844 1:171643309-171643331 CCCTGGCAGCACAGAAGAACAGG - Intronic
917802646 1:178584310-178584332 CCCTGGATGTGGAGAAGTCATGG + Intergenic
919727690 1:200894770-200894792 CCCCGGAAGTGCAGAGGCCCAGG + Intronic
921118867 1:212119410-212119432 TCCTGGCAGGGCAGTAATCCAGG - Intergenic
922068787 1:222170401-222170423 CTCAGGCAGGGCAGAAATCCAGG + Intergenic
922323295 1:224506409-224506431 GCCTGGCAGAGCAGAAGCCAAGG - Intronic
1062827515 10:583594-583616 CCCGGGCAGTGCAGAAAGCGAGG - Intronic
1065883649 10:30058950-30058972 CCCGGGCAGTCCAGACGGCCGGG + Intronic
1067772314 10:49135612-49135634 CCCTGGAACTGCAGAGATCCAGG - Intergenic
1069511004 10:69042530-69042552 TCCTGGCAGCACAGAAGTCCCGG - Intergenic
1069629810 10:69890579-69890601 CCCTGGCAGTGCCCCAGTCATGG - Intronic
1070846180 10:79524128-79524150 CCGGGGCAGGGCAGATGTCCTGG - Intergenic
1070927618 10:80236182-80236204 CCGGGGCAGGGCAGATGTCCTGG + Intergenic
1071858376 10:89648234-89648256 CCCAGGCAGGGCAAAAGTACTGG + Intergenic
1074453839 10:113580700-113580722 CCATGGCTGTTCAGAAGCCCAGG + Intronic
1076428311 10:130383080-130383102 CCCAGGCAGTCCAGGGGTCCAGG + Intergenic
1076643767 10:131937198-131937220 CTCTGGCTGTGCAGAAGACGAGG + Intronic
1076690668 10:132222536-132222558 CCCTGGCAGCGCACACGTCTCGG - Intronic
1076917189 10:133430164-133430186 TCCTGGCAGTGCTGAGGCCCAGG + Intergenic
1076937284 10:133574923-133574945 TCCTGGCAGTGCTGAGGCCCAGG + Intergenic
1079186792 11:18245505-18245527 CTCTGGCATTGCTGTAGTCCAGG + Exonic
1079743973 11:24101587-24101609 CCCTCCCTGTGCAGAAATCCAGG + Intergenic
1081568946 11:44277816-44277838 CACTGGCAGTGCAGACGCCATGG + Intronic
1081580568 11:44348852-44348874 CCCTGGCAAGGGAGAAATCCAGG + Intergenic
1081981968 11:47272757-47272779 CCCTGTCCTTGCAGAAATCCTGG + Intronic
1084184738 11:67465485-67465507 ACAGGGCAGTGCAGGAGTCCTGG + Intronic
1084305904 11:68283149-68283171 TTCTGGCAGCGCAGAAGGCCTGG - Intergenic
1084583674 11:70040963-70040985 CCCTGTCAGTGGAGAGGTTCTGG + Intergenic
1084608423 11:70185862-70185884 CCCTGTCAGTGCAGGGGGCCTGG - Intronic
1084790634 11:71473425-71473447 ACCTGGGACTGCAGACGTCCTGG + Intronic
1084941681 11:72616522-72616544 CCCTCACAGTACAGTAGTCCTGG - Intronic
1087728914 11:101756510-101756532 CCTTGGGGCTGCAGAAGTCCTGG + Intronic
1089349784 11:117815826-117815848 CCCTGGCAGGGCGGGAGACCAGG - Intronic
1091399442 12:173397-173419 CCCTGGGAGTGCACAGGTCCGGG + Intronic
1095288403 12:40444457-40444479 CCACGGCAGTGCAGAATCCCAGG - Exonic
1096412512 12:51387664-51387686 CCCTAGGAGTGCAGAAGTGGAGG + Intronic
1101428441 12:104606737-104606759 CCATGCCATTCCAGAAGTCCTGG - Intronic
1101718491 12:107331669-107331691 CCCTGGTGGTGCAGACTTCCGGG - Intronic
1101997393 12:109534803-109534825 CCCTGGCAGCCCAGGAGCCCTGG - Exonic
1107447995 13:40485223-40485245 CCCTGGCATGGTATAAGTCCTGG - Intergenic
1113740891 13:112711718-112711740 TCCTGGCTGTTCAGAATTCCAGG + Intronic
1113882576 13:113635844-113635866 CGCTGGCATTTCAGATGTCCAGG + Intronic
1115820457 14:37207223-37207245 TCCTGGTAGTGAATAAGTCCAGG + Intronic
1117464159 14:55975656-55975678 CCCAAGGAGTGCAGGAGTCCTGG + Intergenic
1117571142 14:57050267-57050289 CCCTGGCTGTTCAGACGTGCTGG + Intergenic
1117574894 14:57087981-57088003 CCCAGGCAGGAGAGAAGTCCTGG + Intergenic
1119183700 14:72621444-72621466 CCCCACCAGTGCAGAAATCCTGG + Intronic
1121178151 14:91906467-91906489 CCCTGGGAGTCTAGAAGTGCGGG + Intronic
1121249635 14:92489928-92489950 CACTGACAGACCAGAAGTCCAGG + Intronic
1121325160 14:93015602-93015624 CACTGGCAGGGCAGACGCCCTGG + Intronic
1122425233 14:101601850-101601872 CCCTGGCAGCCCAGCAGTCTGGG + Intergenic
1123020014 14:105393292-105393314 GCCTGGCAGTGCAGATGAGCCGG - Exonic
1124342469 15:28899150-28899172 TCCTCGCAGCCCAGAAGTCCTGG + Intronic
1124818437 15:33019552-33019574 CTCTGGCAGCGCAGAAGCCCGGG + Intronic
1131351958 15:91709266-91709288 TCTTGGCAGAGCAGAAGCCCAGG + Intergenic
1132390044 15:101431940-101431962 ACCTGGCAGTGCAAGTGTCCTGG + Intronic
1132678893 16:1131661-1131683 ACCTTCCAGTGCAGAAATCCAGG + Intergenic
1132937187 16:2487088-2487110 CCCTGGCAGTGCTGAGGGGCTGG - Intronic
1134244481 16:12529796-12529818 CCCTGGCAGTGCACAGGTCAGGG - Intronic
1136499479 16:30662839-30662861 ACCTGCCAGTGCTGAGGTCCAGG - Exonic
1139474303 16:67194928-67194950 CCCTGGCAGTGCAGAAGTCCAGG + Exonic
1140216480 16:73012991-73013013 CTTTGGCAGTCCAGGAGTCCTGG - Intronic
1140483075 16:75273074-75273096 CCATGGCGGTGCACAACTCCAGG - Intergenic
1142134054 16:88443646-88443668 CCCTGGCTGTGCACAGGGCCGGG - Intergenic
1142167785 16:88602070-88602092 CACTGCAAGTGCAGATGTCCTGG + Intronic
1142886975 17:2919043-2919065 ACCTGGCAGGGCAGAAATCAGGG - Intronic
1144270414 17:13610049-13610071 CCCTGCCAGTCCAGCAGCCCAGG - Intergenic
1145797812 17:27666134-27666156 TCCTGGCAGTTCCGGAGTCCTGG + Intergenic
1145824815 17:27868834-27868856 ACGTGGCAGTGAAGAAGCCCAGG - Intronic
1145835190 17:27949462-27949484 CCTTGGCTTTGCAGAAGTGCAGG - Intergenic
1147178157 17:38669573-38669595 CACAGGCTATGCAGAAGTCCAGG + Intergenic
1147449224 17:40493555-40493577 CCCAGGCATTGCAGGTGTCCAGG + Intronic
1149299888 17:55295507-55295529 CCCTGGCAGTGCAGAGCCGCAGG - Intronic
1149638802 17:58190447-58190469 CCCTGGAAGTACAGCAATCCAGG + Intergenic
1151600831 17:75105114-75105136 ACTGGGCAGTGCAGAGGTCCAGG + Intronic
1152263288 17:79278620-79278642 CGCTGGCAGGGCAGATCTCCAGG - Intronic
1152604504 17:81282383-81282405 CCCTGTCAGTGCAGAGAGCCCGG - Intronic
1156794380 18:41024951-41024973 CCCTGACACTGCATAAATCCAGG + Intergenic
1158872210 18:61699157-61699179 CCCAGGCAGTGCTGAAGACCAGG + Intergenic
1160881566 19:1323225-1323247 CCCTGGCAGGGCAGGACTCTGGG + Intergenic
1161934432 19:7362872-7362894 CCATGGCAGAGAAGAAGTCTGGG - Exonic
1162193459 19:8965292-8965314 CCCTGGATGTGCAGAAGTGGTGG + Exonic
1162516786 19:11153048-11153070 CCCTGGCACTGCAGCTGTCAGGG + Intronic
1162734810 19:12740779-12740801 CCCTGGCAGCGCCCAAGTTCTGG - Intronic
1163003240 19:14381944-14381966 ACCTTGCAGTGGAGAAGTCCTGG - Intronic
1163063451 19:14776302-14776324 ACCCTGCAGTGGAGAAGTCCTGG + Intronic
1164745404 19:30608956-30608978 CCACGGAAGTGGAGAAGTCCAGG + Intronic
1164761296 19:30730281-30730303 CCCTTTCAGTGCAGGAGGCCAGG - Intergenic
1164918811 19:32073182-32073204 CCTTGGCTGTCCAGATGTCCAGG + Intergenic
1165682627 19:37790616-37790638 CACGGGCAGCGCAGAGGTCCAGG - Intronic
1166751633 19:45166639-45166661 GCCTGGCAGAGCAGAAGTGGGGG + Intronic
1166801634 19:45461233-45461255 CCCTGGTAGTGCAGAAGCTTTGG - Intronic
1168554395 19:57326025-57326047 CCATGGCAGTAGAAAAGTCCTGG - Intronic
925309533 2:2872605-2872627 CCCAGCCAGTGCAGGAATCCAGG - Intergenic
926423913 2:12724249-12724271 GCATGGCAGTGCAGAGGTCTTGG + Intronic
927869030 2:26612174-26612196 CCCAGGCAGAGCTGAACTCCTGG + Intronic
929807232 2:45157086-45157108 CCCCCGCAGTCCAGAAGTCCTGG - Intergenic
930121629 2:47765507-47765529 CCTTTGCAGTTCAGAAGTTCGGG - Intronic
932053159 2:68418967-68418989 CCCTGGCAATGCAGGAGCACAGG - Intergenic
932601979 2:73133803-73133825 CGCTGGCAGTGCCAAAGCCCAGG + Intronic
937599826 2:123718044-123718066 CGCTGTCAGAGCAGCAGTCCTGG - Intergenic
938400494 2:130987107-130987129 CCCTGGCCCTGCAGCAGGCCAGG - Intronic
938827507 2:135020528-135020550 CCATGCCAGTCCAGAACTCCTGG + Intronic
942752653 2:179305466-179305488 CCCAGGCAATCCAGAAGTCTAGG + Intergenic
943820351 2:192314336-192314358 CCCTGGCTGTGGAGAAGAGCCGG - Intergenic
944400157 2:199316867-199316889 CCGTTGAAGTGAAGAAGTCCAGG - Intronic
946726885 2:222670429-222670451 CCCTGACCGTGCAGCAGTCTTGG + Intergenic
948551033 2:238773075-238773097 CCCAGCCAGTGCAGGAGACCCGG + Intergenic
948648912 2:239426658-239426680 CCCTGGGAGTGCAGAACACAGGG + Intergenic
949043155 2:241858641-241858663 CCCTGGCAGCCCAGGGGTCCCGG - Intronic
1168962228 20:1877404-1877426 CCATGGTAATGCAGAAGCCCTGG - Intergenic
1170571359 20:17634587-17634609 CCCTGCCAGTCCAGAAGCTCTGG - Intronic
1171108890 20:22462478-22462500 CCCTGGCAGTGCAGGAGTGGGGG - Intergenic
1172851787 20:37971667-37971689 GCTTGGCAGGCCAGAAGTCCTGG - Intergenic
1173605216 20:44326859-44326881 ACCTGGCTGTGCAGCTGTCCCGG + Intergenic
1178711010 21:34916779-34916801 CCCAGGCAGAACAGAAGGCCAGG + Intronic
1180649888 22:17369326-17369348 CCCTGGCGGTGCAGCTGTCCGGG + Intronic
1181027030 22:20132333-20132355 CCCTGGCAGGGGAGGAGGCCGGG + Intronic
1182194567 22:28502730-28502752 GGCTGTCAGTGCAGAAATCCTGG + Intronic
1182687746 22:32133968-32133990 CCCTGGCAGGGGATAATTCCCGG - Intergenic
1183539788 22:38423338-38423360 CTTTGGCACTCCAGAAGTCCTGG + Intergenic
1183589028 22:38769332-38769354 ACCTTGCAGTCCAGAAGTCTTGG - Intronic
1185115013 22:48928950-48928972 ACCTGAGACTGCAGAAGTCCCGG - Intergenic
1185332708 22:50258836-50258858 CCTTGGCTGTGCAAAACTCCAGG - Intronic
949775279 3:7625727-7625749 GCCAGGCTGTGCAGAAGTCAGGG - Intronic
950811484 3:15653450-15653472 CACTGGCTGTGCATTAGTCCAGG - Intergenic
951986313 3:28625549-28625571 CCCTGACAGAGCAGGAGTGCAGG - Intergenic
952702775 3:36343654-36343676 CCCAGGCAGACCAGAGGTCCTGG - Intergenic
954454683 3:50591311-50591333 CCCTGGCCTTGCAGAACTCATGG + Intergenic
954794272 3:53153615-53153637 CCCTGCCAGCCCAGAACTCCAGG - Intergenic
955287749 3:57659936-57659958 CCATGGAATTGCAGAACTCCAGG + Intronic
955467804 3:59254585-59254607 TCCTGGCAGTGGAGAAGCACTGG + Intergenic
956844255 3:73167962-73167984 TCCTGGAATTGAAGAAGTCCTGG - Intergenic
959267783 3:104166322-104166344 CCATAGCAGTACAGAAGTACAGG - Intergenic
960963918 3:123091517-123091539 GGCTGGCAGTGCTGAAATCCTGG + Intronic
961420500 3:126799049-126799071 GCCTGGTAATGCAAAAGTCCAGG - Intronic
961669715 3:128520142-128520164 CCCTGGCACTGAGAAAGTCCTGG + Intergenic
968604138 4:1523628-1523650 CCCTGGCAAGGCAGAAGTGAAGG - Intergenic
968763829 4:2457921-2457943 CCCTGGCAGCGGACAAGTCTCGG - Intronic
969254919 4:5995138-5995160 CCCTTCCTGTGCAGAGGTCCAGG + Intergenic
970046141 4:11856845-11856867 ACCTGGAAATGCAGAAGTCTGGG - Intergenic
970268559 4:14317681-14317703 CCCTGGCAGAGTAGAGGTCTTGG + Intergenic
971333143 4:25699074-25699096 ACCATGCAGTGAAGAAGTCCAGG - Intergenic
971354927 4:25886758-25886780 CCCTGGCAGAAAAGAATTCCTGG - Intronic
971647612 4:29229483-29229505 CCCTGGAAGTGCAAAGGTTCAGG + Intergenic
971703386 4:30008576-30008598 CTCAGTCAGTGCAGAAGCCCAGG + Intergenic
972696199 4:41449194-41449216 CTCTGGCCTTGCAGAACTCCAGG + Intronic
974490737 4:62560624-62560646 CTCTGGCAGTAGATAAGTCCAGG + Intergenic
976279532 4:83313144-83313166 CCTTGGAAGAGCAGTAGTCCAGG + Exonic
978602794 4:110446237-110446259 CCCTCCCACTGCAGAAGTTCAGG + Intronic
978605693 4:110476636-110476658 CACTGGCCGGGCAGATGTCCTGG - Exonic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
980127485 4:128787796-128787818 CCCTGCCAGACCAGCAGTCCGGG + Intergenic
981080818 4:140637396-140637418 GGCTGGCTGTACAGAAGTCCTGG - Intronic
981614448 4:146632609-146632631 CCCTCGCAGGGCAGAATTCCTGG + Intergenic
981708263 4:147683852-147683874 CATAGGCAGTGCCGAAGTCCTGG + Exonic
982644607 4:158007853-158007875 CCGTGGCTGTGCTGAAGTCATGG + Intergenic
983074760 4:163312574-163312596 CCCTGGCTGTTCTGAACTCCTGG + Intergenic
983499891 4:168487084-168487106 CCCTTCCAGGGCAGAAGGCCTGG - Intronic
985745149 5:1642638-1642660 CCCTGCCTGTGGAGGAGTCCTGG - Intergenic
988925923 5:35991087-35991109 CCCTGGCAGTGCGGGGATCCGGG + Intronic
989984716 5:50685118-50685140 CCCTGGCATTCCAGAAATCCTGG - Intronic
991262477 5:64682111-64682133 CCCTGTTAGTGCAAATGTCCTGG - Intergenic
994101516 5:95898549-95898571 CCCTAGCACTCCAGAAGGCCGGG - Exonic
995224476 5:109688674-109688696 CCTTGGCAGTGGAGAAAGCCAGG + Intergenic
995588413 5:113673188-113673210 CCCAGGCAATGCAGAATTCCTGG - Intergenic
998059754 5:139110731-139110753 CCCTGGCAGTGCACAGGGCAGGG - Intronic
998914204 5:146996649-146996671 TCCTGCCACTGCTGAAGTCCAGG - Intronic
1001444546 5:171773292-171773314 CCCTTGCTGTGCAGCAGTCATGG - Intergenic
1001596030 5:172899271-172899293 ACCTGGCAGCTCAGAAGGCCTGG - Intronic
1001963529 5:175894787-175894809 CCCTGGCAGCACAGATGTCTTGG - Intergenic
1002711422 5:181197462-181197484 GCCTGGCAGTGCAAAGGCCCCGG + Intronic
1003346222 6:5270124-5270146 CCTTTGCACTGCAGAATTCCAGG - Intronic
1004338183 6:14783673-14783695 CTCTGGCTGTGCAGGAGCCCAGG + Intergenic
1005811486 6:29519489-29519511 CCCAGGGACTCCAGAAGTCCTGG + Intergenic
1006090837 6:31627856-31627878 CCCTGGCAGTGGAGCGGGCCCGG + Exonic
1007498671 6:42279361-42279383 CCCTGGCCCTGCAGCTGTCCTGG + Intronic
1008369470 6:50715857-50715879 ACCTGGAAGTGCGGGAGTCCGGG + Intronic
1010229499 6:73521849-73521871 CCCTGGTACTCCAGATGTCCAGG + Intronic
1010744159 6:79542084-79542106 GCCTGGCAGAGCAGTGGTCCTGG - Intergenic
1014851200 6:126341419-126341441 GGGTGGCAGTGGAGAAGTCCAGG - Intronic
1015546299 6:134364956-134364978 ACCAGGAACTGCAGAAGTCCGGG - Intergenic
1016953120 6:149600288-149600310 CCCAGGCAGTCTAGAACTCCTGG - Intronic
1018175826 6:161178560-161178582 CCCGGGAAGTGCAGGGGTCCGGG - Intronic
1018861305 6:167712591-167712613 CCCTGGCAGTGCACCTGGCCTGG - Intergenic
1019189896 6:170245794-170245816 CCCTGGCTGTGCAGTCCTCCTGG + Intergenic
1019510154 7:1413806-1413828 CCCAGACAGTGCAGGATTCCAGG + Intergenic
1022144668 7:27524986-27525008 CCCTTGCAGAGCATAAGTTCTGG - Intergenic
1022601115 7:31760951-31760973 CCCTTGCAGTTCAAAACTCCTGG - Intronic
1023124510 7:36942167-36942189 CCCTGTCAGTCCAGACCTCCAGG + Intronic
1023852740 7:44159267-44159289 CCCTTTCAGTGCAGAAGCCCTGG - Exonic
1024781607 7:52857171-52857193 CCCTGACACTCCAGTAGTCCAGG - Intergenic
1026826833 7:73587716-73587738 CCCTGGGAGTCCAGAATTCTCGG - Intergenic
1027700571 7:81465081-81465103 CTCTGACAGTTCTGAAGTCCGGG - Intergenic
1029375312 7:100173906-100173928 CCCTGGCAGGGCATAAGTGAGGG + Exonic
1032002435 7:128274155-128274177 CCCTGGTACTGCAGAAGCACAGG + Intergenic
1034400835 7:150860506-150860528 CCCTGGCAGTGACCAAGTACCGG + Exonic
1035786421 8:2264718-2264740 CACTGGAAATGCAGAAGACCGGG + Intergenic
1035786434 8:2264786-2264808 CACTGGAAATGCAGAAGACCGGG + Intergenic
1035806373 8:2456930-2456952 CACTGGAAATGCAGAAGACCGGG - Intergenic
1035806386 8:2456998-2457020 CACTGGAAATGCAGAAGACCGGG - Intergenic
1035959333 8:4119606-4119628 CACAGACAGAGCAGAAGTCCTGG - Intronic
1037546370 8:19927945-19927967 CCCTGGCAGTCTTGAACTCCTGG - Intronic
1038546687 8:28431146-28431168 CCCGGGCAGTTCACAGGTCCAGG + Intronic
1041421468 8:57671694-57671716 CCCTGGAAGTGCAGGAGGACAGG + Intergenic
1043184064 8:77122778-77122800 CTCTGGCAGTTTAGTAGTCCTGG - Intergenic
1043961021 8:86418666-86418688 CCTAGGCAGAGCAGAAGTTCTGG - Intronic
1044454570 8:92378128-92378150 GCATGGAAGTGCAGATGTCCAGG + Intergenic
1045252058 8:100490611-100490633 TCCTGGCAGTTCAGAATTCTGGG - Intergenic
1046989621 8:120436920-120436942 CCTTGGCTGTGCACAAGTTCAGG - Intronic
1047289565 8:123517527-123517549 CCCTGGAAGAGGAGAAGACCTGG + Intronic
1048319241 8:133385626-133385648 CTCTGGAAGTGCTGAAGCCCTGG - Intergenic
1057134051 9:92674202-92674224 CCATGGCAGTTTTGAAGTCCTGG - Intergenic
1057860346 9:98635998-98636020 CCATGGTGATGCAGAAGTCCAGG - Intronic
1059411933 9:114137998-114138020 CCCTGGTTATGCAAAAGTCCTGG - Intergenic
1060224898 9:121784689-121784711 CCTTGGGAGAGCAGCAGTCCCGG - Exonic
1061083807 9:128387579-128387601 ACCTGGCACTGCTGAAGTCCTGG - Intronic
1061238251 9:129354281-129354303 CACTGCCAGTGCAGAAGTGGGGG - Intergenic
1061240781 9:129370853-129370875 CCCAGGCAGCTCAGGAGTCCAGG - Intergenic
1061570662 9:131475805-131475827 CACTGGCAGAGCAAAAGTCCAGG + Exonic
1061745116 9:132733891-132733913 CCCTGGGATTGCAGAACTTCAGG + Intronic
1061914282 9:133741179-133741201 CTCTGACGGGGCAGAAGTCCAGG + Intergenic
1062218531 9:135402221-135402243 CCATGGCAGTGCAAAAGTCCTGG - Intergenic
1062278474 9:135741595-135741617 CCCTGGGAGGGCCGAGGTCCTGG - Intronic
1062572025 9:137190175-137190197 CCCTGGCAGGGCAGGAGTGTGGG - Exonic
1062619995 9:137416414-137416436 CCCTGGCTGTGCAGAAGCTGCGG - Intronic
1203781541 EBV:103791-103813 CCCTGGCATTGTAGAACTCAGGG - Intergenic
1193031834 X:76907087-76907109 CCCTCTCAGTGCAGAAATCCTGG + Intergenic
1199761006 X:150903985-150904007 AGGAGGCAGTGCAGAAGTCCCGG + Intergenic
1201986706 Y:19976441-19976463 CCATTGCAATGCAGAATTCCTGG - Intergenic