ID: 1139478951

View in Genome Browser
Species Human (GRCh38)
Location 16:67217757-67217779
Sequence AGGGCTTCAGCAGAGAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139478951_1139478958 16 Left 1139478951 16:67217757-67217779 CCAACCCTCTCTGCTGAAGCCCT 0: 1
1: 1
2: 2
3: 25
4: 362
Right 1139478958 16:67217796-67217818 TTTACTCTCCTGAGACAACCTGG 0: 1
1: 0
2: 0
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139478951 Original CRISPR AGGGCTTCAGCAGAGAGGGT TGG (reversed) Intronic
900728579 1:4235828-4235850 AGGGCTGAAGTAGAGAGGGTGGG + Intergenic
900823948 1:4911481-4911503 AAGGCTTCAGCAGAGACGAACGG - Intergenic
901241198 1:7694692-7694714 AGGGAGACAGCAGAGAGGGCCGG - Intronic
901808580 1:11752805-11752827 AGTGGCTGAGCAGAGAGGGTGGG + Intronic
904320725 1:29696471-29696493 AGGGGATCAGTAGGGAGGGTGGG - Intergenic
904454102 1:30636572-30636594 AGGGCTGCTGCAGGGAGAGTGGG + Intergenic
905259531 1:36707752-36707774 AGGACTCCAGGAGATAGGGTGGG - Intergenic
905316124 1:37082556-37082578 AGGAGTTCAGCAGAGTGTGTGGG + Intergenic
905863750 1:41366065-41366087 AGGGACTCATCTGAGAGGGTGGG + Intronic
906552072 1:46673318-46673340 AGTGGTTCAGCAGGGGGGGTAGG - Exonic
907314974 1:53562561-53562583 TGGGACTCAGCTGAGAGGGTGGG - Intronic
907386201 1:54127216-54127238 ATGGTTTCAGGAGAGGGGGTTGG - Intergenic
907574966 1:55518156-55518178 AGGGATTTAGGAGAGAGGGCTGG + Intergenic
907888358 1:58614909-58614931 ATGGCTACAGCAGGGAGGGAGGG - Intergenic
908573680 1:65437045-65437067 AAGGCTGCAGCAGGGATGGTTGG - Intronic
908855396 1:68421151-68421173 AGGGCTTCAGCAAATGGGGGAGG - Intergenic
909007696 1:70296780-70296802 AGGGAAGCAGCAGAGAGGGAAGG + Intronic
910201994 1:84709145-84709167 ATGGAGTCAGCAGAGAGGGTGGG - Intergenic
910538192 1:88323915-88323937 AGGGCAGCAGGAGAGAGAGTGGG + Intergenic
911157750 1:94653652-94653674 AGGGCTTCAGCACAGAGGTGAGG + Intergenic
911746083 1:101443164-101443186 AGGGCAACAACACAGAGGGTAGG + Intergenic
914698308 1:150106573-150106595 AAGGCTTCAGAAGAGCCGGTAGG - Intronic
914811811 1:151034148-151034170 ACGGCCTCAGCAGAGAGTTTAGG - Exonic
915108287 1:153547601-153547623 AGGGGTACAGGAGAGAGGGTAGG + Exonic
915213837 1:154327659-154327681 AGGGCATCAGGAAACAGGGTGGG - Intronic
915349046 1:155213218-155213240 AGGGCTGGAGCAGAGAGAGAAGG - Exonic
915352233 1:155233845-155233867 AGGGCTGGAGCAGAGAGAGAAGG - Intergenic
917921688 1:179755894-179755916 AAGACTTCAGCAGAGAGGTGGGG - Intronic
918046521 1:180944909-180944931 AGGGCCTCATCGGACAGGGTGGG - Intronic
920820163 1:209373050-209373072 AGGGCATCAACAAAGAGGTTAGG + Intergenic
921005832 1:211093082-211093104 AGGGCTGCAGCTGGGAGGGGAGG - Intronic
922746787 1:228048757-228048779 AGGGCATGAGGAGAGGGGGTGGG - Intronic
923459251 1:234194433-234194455 GGGGACTCAGGAGAGAGGGTGGG + Intronic
1063604098 10:7507928-7507950 ACGGCTTCCTCAGAGGGGGTGGG + Intergenic
1065462231 10:25981002-25981024 AGGGATTCAGGGGAGAGGGAGGG - Intronic
1065502352 10:26394738-26394760 ACTGTTTAAGCAGAGAGGGTAGG + Intergenic
1066064127 10:31750112-31750134 TGGGCTTCAGGGGAGAGGGGAGG + Intergenic
1066681411 10:37939406-37939428 AGGGCTTCCCCAAAAAGGGTGGG - Intergenic
1067834890 10:49632455-49632477 AGGGCTTCAGCTGAGAGGGTTGG - Intronic
1068135917 10:52951381-52951403 AGGGCTTCCCCAAAAAGGGTAGG + Intergenic
1072322598 10:94265088-94265110 AGGGTGTCAGCAGAGAGGAGCGG + Intronic
1073104883 10:101026905-101026927 AGGCCCTGAGGAGAGAGGGTTGG - Intronic
1073187499 10:101625428-101625450 AGGGCTTCTGGAGAGTGGGATGG + Intronic
1074198880 10:111214153-111214175 ATGGCTGCTGGAGAGAGGGTCGG - Intergenic
1075629838 10:123994369-123994391 AAGGGTTCAGAAGAGAGGGTTGG + Intergenic
1076387444 10:130067427-130067449 ATGGCTTCAGCAAAAAGGGAAGG - Intergenic
1076830808 10:132993275-132993297 ACGGCTTCAGGAGGGAGGGATGG - Intergenic
1077022845 11:426877-426899 AGGGACTCAGCACACAGGGTTGG + Intronic
1078043564 11:7892343-7892365 AGGTCTTAAGCAGAGATTGTGGG - Intergenic
1078458716 11:11496607-11496629 AGGGCTACCACACAGAGGGTGGG + Intronic
1079089548 11:17471057-17471079 AGGGCTGGAGCAGAAAGGGCAGG - Intronic
1079102101 11:17548056-17548078 AGGGCTTTAGCACTTAGGGTGGG + Intronic
1079105940 11:17572481-17572503 GGGGCATGGGCAGAGAGGGTGGG - Intronic
1080747307 11:35119742-35119764 TGGGCTGGAGCAGTGAGGGTGGG + Intergenic
1081761294 11:45577948-45577970 AGAGCTTCAGGAGTGGGGGTGGG - Intergenic
1082808249 11:57463370-57463392 AGGGGGTGAGCAGAGAGGGTGGG + Intronic
1083340748 11:61957018-61957040 AGGGCTGCCGCAGAGTGGGAAGG + Intronic
1083775331 11:64891811-64891833 ATGGCTGCAGCAGGGAGGGTGGG - Intergenic
1084312821 11:68326645-68326667 CAGGCTGCAGGAGAGAGGGTGGG - Intronic
1084576484 11:69991927-69991949 ATGGCATCAGCACAGAGGGAGGG - Intergenic
1084789300 11:71463413-71463435 AGGCCTGCAGGAGAGAGGGGAGG - Exonic
1085388988 11:76172614-76172636 AGGGGTTCAGGAGAAAGGGGAGG - Intergenic
1086119549 11:83291786-83291808 AGGGGTCCAGGAGAGAGGATTGG + Intergenic
1086332912 11:85771808-85771830 GGTGATTCAGCAAAGAGGGTAGG - Intronic
1086994691 11:93342530-93342552 AGGGCTGCAGCAGATATTGTGGG - Intronic
1087834990 11:102864317-102864339 AGCTCTTCAGTAGAGAAGGTGGG - Intronic
1088916244 11:114230055-114230077 TGGGCTTCAACCGAGAGGGCGGG - Intronic
1089104037 11:115987312-115987334 GGGGATTCAGCAGAGAAGGCTGG + Intergenic
1089298111 11:117481647-117481669 AGGGATCCAGGAGAGAGGGAGGG + Intronic
1089383226 11:118050920-118050942 AGCTCTTCTGCAGATAGGGTGGG - Intergenic
1090220896 11:125023953-125023975 AGGGCTAGAGGTGAGAGGGTGGG + Intronic
1090296325 11:125591821-125591843 AAGGCTACACCAGAGAGAGTGGG - Intronic
1091013915 11:132032175-132032197 AGGGCTTCAGAAGAGACAGGCGG - Intronic
1092061379 12:5553726-5553748 AGGCCTCCAGCAGAGAGCGCAGG + Intronic
1092208783 12:6632970-6632992 CAGGCTTCAGCAGAGAAGGGTGG - Intronic
1092649902 12:10623036-10623058 AGAATTTCAGCAGAGAGGGATGG - Intronic
1094280797 12:28735623-28735645 AGGGCCTCAGGGGAAAGGGTGGG + Intergenic
1096750202 12:53753787-53753809 TGGGCTGCAGCAGAGAGCCTGGG + Intergenic
1096978188 12:55712344-55712366 TGGGCTTCAAGAGAGGGGGTTGG - Intronic
1099274822 12:80561397-80561419 TGGGCTTCAACAGAGAAGGTAGG + Intronic
1101220057 12:102629552-102629574 AGGGTGTCAGGAGATAGGGTAGG - Intergenic
1101854763 12:108432956-108432978 AGGGCAACAGCAGAGGAGGTAGG + Intergenic
1101930362 12:109008848-109008870 ATGGCCTCAGCAGAGAGGAGTGG + Intronic
1102524969 12:113505989-113506011 GGGGCTGCAGCAGAGAGAGTGGG - Intergenic
1102727971 12:115082189-115082211 AGGGCAGCAGCAGAGTGGGTTGG + Intergenic
1103611663 12:122127807-122127829 AGGGGTGCAGCAGACAGGCTGGG + Intronic
1103932561 12:124458305-124458327 CGGGCTGCAGCAGAGAGAGGAGG + Intronic
1105939311 13:25132970-25132992 AGGGGTCTAGCAGAGAGGGGTGG + Intergenic
1106043657 13:26117608-26117630 ATGGCCTCAGCAGAGAGTTTAGG + Intergenic
1110956938 13:81564634-81564656 AGGGCTTAAGCCGAGAGAGCGGG - Intergenic
1113224088 13:108140267-108140289 AAGGCTACAGCTGGGAGGGTCGG - Intergenic
1113529044 13:111006599-111006621 TCGGGCTCAGCAGAGAGGGTGGG + Intergenic
1113914083 13:113860758-113860780 ACGGCTCCAGCAGAGAGGGCTGG + Intronic
1116429629 14:44830981-44831003 AGGGGTTCAGGTCAGAGGGTGGG - Intergenic
1118313355 14:64708643-64708665 GTGGTTCCAGCAGAGAGGGTCGG - Intronic
1118456180 14:65947354-65947376 AGGGAATCATCAGAGAGAGTGGG - Intergenic
1119074361 14:71621178-71621200 AGGGCTTCAGCATAGAAGCAGGG - Intronic
1119181022 14:72605319-72605341 CAGGCTTCAGCACAGAGGCTTGG + Intergenic
1120512389 14:85431063-85431085 AAGGCTGCAGGAGAGAGGGCAGG + Intergenic
1121520483 14:94582967-94582989 AGGGTTCCAGTAGAGAGGGAAGG + Intronic
1122116821 14:99531917-99531939 AGGGCTTCAGCAGGTAGTGAGGG - Intronic
1122567244 14:102668536-102668558 AGGGCTTCAGCAGATAGCCGAGG - Intronic
1122771973 14:104101598-104101620 AGGGCCCCAGCAGAGTGGGCCGG - Intronic
1123152003 14:106190986-106191008 AGGGCTTCAGAAGAGAATATAGG + Intergenic
1202923970 14_KI270724v1_random:7550-7572 AGGGACTAAGGAGAGAGGGTGGG - Intergenic
1125784489 15:42303148-42303170 AGGGCTTCTGCAGAGAGATCCGG - Intronic
1126339448 15:47623061-47623083 AGGGCTTCAGGAGAGGGAGGGGG - Intronic
1126411147 15:48374303-48374325 TGGGCTACAGCAAAGAGAGTGGG - Intergenic
1127855581 15:62950926-62950948 AGGGCTACAGGAGGGCGGGTTGG - Intergenic
1128611452 15:69076898-69076920 AGATCTACAGCAGAGAGGCTGGG - Intergenic
1128730647 15:70018647-70018669 AGGGTTTCACCAGAGACGGTTGG + Intergenic
1128783364 15:70377435-70377457 AGGGCAGCAGCAGGGAGGGGAGG - Intergenic
1129016410 15:72473313-72473335 AGGAGTTCAACAGAGAAGGTAGG - Intergenic
1129223755 15:74153041-74153063 AGGCCTTCAGCAGCCAGGATGGG - Intergenic
1129796623 15:78382319-78382341 CGGGCTGCAGCAGGGAGGCTTGG + Intergenic
1130969659 15:88721971-88721993 AGGGCTAGAGCAGACAGGGGAGG + Intergenic
1132635784 16:945659-945681 AAGGCCTCGGCAGAAAGGGTCGG + Intronic
1132735135 16:1382212-1382234 AGGGCTTCACCGTAAAGGGTAGG - Intronic
1132870041 16:2111920-2111942 GGGGCTTCTGCCGAGCGGGTGGG - Intronic
1133818205 16:9214179-9214201 AGAGCTGCAGCAGAGGGGGTAGG - Intergenic
1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG + Intronic
1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134717382 16:16363681-16363703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134949435 16:18344964-18344986 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1134957370 16:18388478-18388500 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1135200146 16:20430298-20430320 ATGCCTTCAGCAGTGAGGGCTGG - Intronic
1135218539 16:20593297-20593319 ATGCCTTCAGCAGTGAGGGCTGG + Intergenic
1136073572 16:27803316-27803338 AGGGCTGCCGCAGAGAGGGTCGG - Intronic
1136136311 16:28258838-28258860 TGGCCTCCAGGAGAGAGGGTTGG - Intergenic
1137485411 16:48886459-48886481 AGAGTTTCAGTATAGAGGGTGGG - Intergenic
1137910874 16:52376842-52376864 GGGCCTTCAGCAAAGAGGGAAGG + Intergenic
1139361781 16:66403955-66403977 AGGCCTTCTCCAGAGGGGGTGGG - Exonic
1139478951 16:67217757-67217779 AGGGCTTCAGCAGAGAGGGTTGG - Intronic
1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG + Intergenic
1143737452 17:8922941-8922963 AGGGCTTGAGCAAAGATGGGGGG - Intronic
1144076336 17:11722921-11722943 ATGGCTGCTACAGAGAGGGTTGG - Intronic
1144159027 17:12538888-12538910 GAGGTTTGAGCAGAGAGGGTAGG + Intergenic
1145779669 17:27553915-27553937 AGGGCTTCAGCTGCAAGGGCTGG + Intronic
1146466954 17:33093993-33094015 ATAGCTTCAGAGGAGAGGGTGGG + Intronic
1146707202 17:35009773-35009795 AAGGCTTCAGCAGAGAAAGCAGG + Exonic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147566516 17:41539533-41539555 GGGGCTTCAGAAGAAAGGGCTGG + Intergenic
1147647111 17:42040490-42040512 AGAGCTTCTGCACAGAGGGCAGG + Intronic
1147652209 17:42069125-42069147 GAGGCTGCTGCAGAGAGGGTAGG + Intergenic
1147981983 17:44280423-44280445 CGGGCTTCAGGAGAGAGGAGAGG - Intergenic
1148263289 17:46203255-46203277 AATCCTTCAGCACAGAGGGTAGG + Intronic
1148835452 17:50463534-50463556 AGGCCATCAGCAGAGAGAGGTGG + Exonic
1148848974 17:50545314-50545336 GAGGCTTCAGGAGAGAGGATTGG - Intronic
1149650059 17:58271132-58271154 AGGGCTTCAGGAGTGTGTGTGGG - Intronic
1150299341 17:64035593-64035615 AGGGCTTCAGGAGACAAGGTGGG + Intergenic
1151822838 17:76506427-76506449 AGGCCTCCAGCAGGGAGAGTCGG + Intergenic
1152146798 17:78573233-78573255 AGGGCTTCAGCAGATGGATTTGG - Intronic
1152226193 17:79094008-79094030 GGGGCTGCAGCAGTGCGGGTGGG + Intronic
1152336143 17:79701122-79701144 AGGGGTGCAGGTGAGAGGGTGGG + Intergenic
1203170792 17_GL000205v2_random:146467-146489 AGGGACTAAGGAGAGAGGGTGGG + Intergenic
1153230985 18:2935810-2935832 AGGGGTTGAGGAGAGAGGGAGGG + Intronic
1153781101 18:8495741-8495763 GGGGCTCCTGCAGAGAGGGCAGG - Intergenic
1154061954 18:11070673-11070695 AGGGCTTCAGCCCAGAAGGAAGG + Intronic
1154346125 18:13545088-13545110 AGGTCCTCAGCTGAGAGAGTGGG + Intronic
1155086028 18:22458877-22458899 AGTGTTTCAGCAGAGCGGGGAGG + Intergenic
1155248668 18:23935380-23935402 TGGGCTTCAGCAGATAGGGTGGG + Intronic
1155341430 18:24818075-24818097 GAGGCTTCATCAGAGGGGGTGGG - Intergenic
1155538666 18:26843931-26843953 TGGGACTCAGCAGAGTGGGTTGG + Intergenic
1156456540 18:37297925-37297947 AGGCATTCAGCAGAGACTGTTGG + Intronic
1157198983 18:45643012-45643034 GAGGCTGCAGGAGAGAGGGTGGG + Intronic
1158333277 18:56386330-56386352 ATGGTTTCAGCAGGGAAGGTCGG + Intergenic
1159053772 18:63445385-63445407 ATGGGAGCAGCAGAGAGGGTGGG + Intergenic
1160887776 19:1359569-1359591 AGTGCTGCAGCAGGGAGGTTGGG + Intronic
1161343355 19:3754344-3754366 AGGGCGACAGCGAAGAGGGTCGG + Intronic
1161933262 19:7355476-7355498 GGGGCTTCAGCAGGGGGGCTGGG - Intronic
1162157123 19:8685893-8685915 AGGGTTTGAGCAGAGAGAGAGGG - Intergenic
1162359121 19:10206952-10206974 TGGGCTGCAGCGGAGAAGGTAGG - Intronic
1162782027 19:13011490-13011512 TGGACTTCAGGAGTGAGGGTGGG + Intronic
1165077823 19:33290518-33290540 AGGGCAAAAGCAGAGAGGGGTGG + Intergenic
1165426788 19:35750256-35750278 GGGGGTTCAGGAGAGAGGCTGGG + Intronic
1167268368 19:48494247-48494269 AGGGCTTCTCCAGGCAGGGTGGG + Intronic
1167492938 19:49802299-49802321 AGGGCGTGAGCAGGGAGGCTGGG - Intronic
1168199388 19:54803994-54804016 AGGGAGGCAGCACAGAGGGTGGG + Intronic
924998050 2:382089-382111 AGGGCTGCAGCTGTGAGGGCCGG - Intergenic
927965117 2:27263306-27263328 TGGGCTTCAGGAGCGAGGCTTGG - Intronic
928890241 2:36196195-36196217 AGGGTTTCAGCAGTGAGGCCAGG + Intergenic
930007492 2:46909737-46909759 TGGGCTGCAGCCTAGAGGGTAGG + Intronic
932574252 2:72954215-72954237 AGGGGCTCAGCTGAGAGGGAGGG + Intronic
933812082 2:86039070-86039092 GTGGCCTCAGCAGAGCGGGTAGG + Intronic
934475010 2:94587856-94587878 AGGGTTTCAGCAGTCAGGGCTGG + Intergenic
936346106 2:111676616-111676638 AACGCTTCAGCAAAGAGGATAGG + Intergenic
937254874 2:120547963-120547985 AGGGCTTACGCAGGGAGGGAGGG + Intergenic
937865525 2:126748551-126748573 TGGGCTCCTGAAGAGAGGGTAGG + Intergenic
937871477 2:126789274-126789296 TGGCCTACAGGAGAGAGGGTGGG - Intergenic
938117845 2:128613855-128613877 AGGGCTTCAGCATAGGGATTTGG + Intergenic
939627589 2:144497003-144497025 AGGGCATGAGCAAAGAGGATGGG - Intronic
940322412 2:152390767-152390789 AGGGCATCAGGAGAAAGGCTGGG + Intronic
941946700 2:171106627-171106649 GGTGCTCTAGCAGAGAGGGTCGG - Intronic
942444808 2:176070899-176070921 AGGGCTGCTGCTGGGAGGGTGGG - Intergenic
942678856 2:178455560-178455582 AGGGCATCAGGAGAAAGGCTGGG + Intronic
944317670 2:198300778-198300800 AGGGCTCCTGAAGAGAAGGTAGG + Intronic
946029871 2:216695285-216695307 TTGGCTGCAGCCGAGAGGGTGGG + Exonic
946368678 2:219266869-219266891 AGGACTTGAGCAGAAAGTGTAGG + Intronic
947049951 2:226031086-226031108 TGGGATTCTGCAGAGAGGGGAGG - Intergenic
948452176 2:238082544-238082566 AGGGCATCTGCAGAGGGTGTGGG + Intronic
948482574 2:238259449-238259471 AGGGCTGCTGCAGTGGGGGTGGG + Intronic
948710532 2:239822300-239822322 AGGGCATCAGCTGAGAGTGAGGG + Intergenic
1169980215 20:11376280-11376302 AGGTCTTTAGCAGGGAAGGTGGG + Intergenic
1170106949 20:12762037-12762059 GGGGCTGCTACAGAGAGGGTTGG - Intergenic
1171024153 20:21613722-21613744 AGGGCTGCCGCAGCCAGGGTGGG - Intergenic
1171180177 20:23085836-23085858 AGGGCTTCAGCTGGGTGGGCGGG - Exonic
1171202919 20:23256200-23256222 AGGGCTTCAGCTGTGAGGAAGGG + Intergenic
1172450851 20:35021627-35021649 AGGGCATAAGCAGGGAGGGATGG - Intronic
1173859306 20:46271878-46271900 TGGGCTTCAGAGGAGAGGTTAGG - Intronic
1174102396 20:48137600-48137622 AGTCCAGCAGCAGAGAGGGTGGG - Intergenic
1174506619 20:51021638-51021660 AGGGAGTCAGCAAAGGGGGTGGG + Intronic
1175377746 20:58541059-58541081 AGGGCTGCAGAGGAGAAGGTGGG - Intergenic
1175735845 20:61386452-61386474 AGGGCTTCCGCAGGGAAGGCTGG - Intronic
1175806268 20:61830870-61830892 AGGGCATCAGGAGAGAGGAGCGG - Intronic
1175952845 20:62592581-62592603 TGGGTTTCATCAGAGAGGATGGG + Intergenic
1176140447 20:63542575-63542597 GGGCCTTCTGCAGGGAGGGTGGG + Exonic
1176659024 21:9616421-9616443 ATGGCTGCAGCAGTGAGGGAGGG + Intergenic
1179193670 21:39144676-39144698 AGGGCTTCAGCAGGGATGGCTGG - Intergenic
1181175014 22:21030348-21030370 ATGGCTGTAGCAGAGAGAGTGGG + Exonic
1181432006 22:22887635-22887657 AGGGCTTGAGCTCAGGGGGTTGG - Intronic
1182343047 22:29639907-29639929 AGGACTTCAGCCGGGCGGGTTGG + Intronic
1183094542 22:35544267-35544289 GGGCCTTCAGCAGAGATGGGGGG - Intronic
1183179898 22:36252985-36253007 AGGGCAGCAGCAAGGAGGGTGGG + Intergenic
1183541250 22:38430654-38430676 AGGGCTCCAGGAGAAAGGCTTGG + Intronic
1183669217 22:39262511-39262533 GGGGCTGCAGCAGAGAGAGGTGG - Intergenic
1183934462 22:41254358-41254380 AGAGCCTCAGCAGCGAGGGCAGG - Exonic
1183956419 22:41382763-41382785 GGGGCTTCTGCTGAGCGGGTGGG + Intronic
1184232043 22:43163476-43163498 TGGGCTTCAGCAGAGGGAGGGGG + Intergenic
1184279773 22:43430352-43430374 AGGGCTCCAGCTGTGAAGGTTGG + Intronic
1184502359 22:44881843-44881865 AGGGCTTCTGCATCCAGGGTGGG - Exonic
1184760226 22:46539416-46539438 AGGCTTTAAGCAGAGTGGGTTGG + Intergenic
950455063 3:13087965-13087987 AGGGCAGCAGCGGTGAGGGTTGG - Intergenic
950467816 3:13165734-13165756 GGGGCTGCAGCAGCGAGGGGTGG - Intergenic
951582303 3:24178759-24178781 AGGTCTGCAGCGGGGAGGGTAGG + Intronic
951891057 3:27568539-27568561 AAGGCTTTAGCAGACAGCGTGGG - Intergenic
952746078 3:36781803-36781825 TTGGCTTCAGAAGAGAGAGTGGG - Intergenic
954234357 3:49244833-49244855 AGGGTTTCAGATGAGAGGATGGG + Intronic
956741568 3:72279939-72279961 AGGGCAGCAGGAGAGAAGGTTGG + Intergenic
957080586 3:75632940-75632962 AGGGACTAAGGAGAGAGGGTGGG - Intergenic
958727909 3:97928397-97928419 CCTGCTTGAGCAGAGAGGGTGGG + Intronic
959387977 3:105736233-105736255 AGGGATTGAGCAGTGAGGGAGGG - Intronic
960909383 3:122633888-122633910 AGAGCAGCAGCAGAGAAGGTAGG - Intronic
962247287 3:133806141-133806163 GCTGCTTCAGGAGAGAGGGTGGG - Intronic
962314743 3:134352297-134352319 AAGGCTTCAGAAGAGAGACTGGG + Intergenic
963069158 3:141288317-141288339 AGGACTTCAGCAGGGATGGAGGG + Intronic
963487475 3:145953455-145953477 ACGTCATCTGCAGAGAGGGTTGG - Intergenic
963871939 3:150426156-150426178 TGGGCTACTGCAGAAAGGGTTGG - Intronic
966155782 3:176914953-176914975 AGGGCTTCCTCAGAGAGTATGGG + Intergenic
966945648 3:184775438-184775460 AAGCCTTCAGCAGAGAGGAGAGG - Intergenic
967130723 3:186468181-186468203 AGGGCTGTAGCAGAGAGGTGAGG - Intergenic
967566398 3:190978748-190978770 AGGGCAACAGGAGAGAGGTTGGG - Intergenic
967943848 3:194786909-194786931 GGGGCGGCAGTAGAGAGGGTGGG + Intergenic
968445978 4:652220-652242 CGGGCCTCAGCAGGGAGGGAGGG + Intronic
968660482 4:1796797-1796819 ATGGCTGCAGGAGTGAGGGTAGG - Intronic
970824553 4:20254787-20254809 AGGGGTTCAGCAGGAAGGGCCGG - Intronic
973290512 4:48465843-48465865 AGGGAGTTAGAAGAGAGGGTAGG + Intergenic
974892499 4:67898743-67898765 AGGGTTTCATCAGATTGGGTAGG - Intergenic
974984475 4:69003908-69003930 AAGGATTCAGAGGAGAGGGTGGG + Intergenic
976606405 4:86987516-86987538 AGGACTTCCACACAGAGGGTTGG - Intronic
977871527 4:102096139-102096161 AGAGAAGCAGCAGAGAGGGTGGG - Intergenic
980034681 4:127870464-127870486 AGGCCTGGAACAGAGAGGGTAGG - Intergenic
980991268 4:139740595-139740617 ATGACTTCATCAGAAAGGGTGGG - Exonic
981126460 4:141112573-141112595 AGGGTTTCTGCAGAGAGAGCTGG + Intronic
982135095 4:152267725-152267747 AGAGCTTCTTCAGAGATGGTGGG - Intergenic
982803994 4:159740341-159740363 AGGGATTCAGGGGAAAGGGTGGG - Intergenic
983515735 4:168654715-168654737 AGAGCTGCAGCAGAGCGGGGAGG - Intronic
985416302 4:189739012-189739034 ATGGCTGCAGCAGTGAGGGAGGG - Intergenic
985665782 5:1180957-1180979 AGGGCCCCAGCAGATGGGGTCGG - Intergenic
986324506 5:6662009-6662031 AGGGTCCCAGCAGAGAGGGAGGG - Intronic
987895212 5:23937019-23937041 ATGGTATCAGCAGAGAGAGTTGG - Intergenic
988628779 5:32906578-32906600 AGGAGTTCAGGAGAGAAGGTGGG + Intergenic
988968918 5:36446356-36446378 AGGCCTGGAGCAGAGAGAGTGGG + Intergenic
990173160 5:53077934-53077956 AGGGGATGAGCAGTGAGGGTAGG - Intronic
990531770 5:56681409-56681431 TGGCCTTCTGCAGAGAAGGTGGG - Intergenic
991918006 5:71624258-71624280 AGGGCTTCAGCAGATGAGTTCGG + Intronic
994839769 5:104908647-104908669 AGGGCTTTTGCAGGGAGGATGGG - Intergenic
996464221 5:123781006-123781028 AGGGCTTGAGCAATGTGGGTGGG + Intergenic
998057341 5:139089452-139089474 GAAGCTTCAGGAGAGAGGGTGGG - Intronic
998613651 5:143716463-143716485 TGGGCCTCGGCAGAGATGGTTGG - Intergenic
999821513 5:155233551-155233573 AGGGCTTCTGCCCAGAGGGCTGG + Intergenic
1001933127 5:175687127-175687149 AGGGCTTTGGCAGAGAAGGGTGG + Intergenic
1004296177 6:14413545-14413567 AGGGGTTCAGGGGAGAGAGTGGG - Intergenic
1005004913 6:21278317-21278339 AGGGAGGCAGGAGAGAGGGTGGG + Intergenic
1005107826 6:22244525-22244547 AGGGACTCAGGAGAAAGGGTGGG + Intergenic
1006133350 6:31881624-31881646 ACAGCTTCAGCAGAGTGGGAAGG + Intronic
1006601682 6:35230763-35230785 AGGATCTCAGCAGAGAGGATGGG + Intronic
1006638681 6:35477465-35477487 TGGGCCTCAGCAGAAAGGCTGGG - Intronic
1006728171 6:36215032-36215054 TTGGCTGCAGCAGAGGGGGTGGG + Intronic
1006831483 6:36970769-36970791 AGGAGCTCAGCACAGAGGGTGGG - Intronic
1007235352 6:40387322-40387344 AGGGCTTCAGCAAGCTGGGTGGG - Intergenic
1007294587 6:40812310-40812332 AGTGCTACAGCAGGGAGGGCTGG - Intergenic
1007785631 6:44277733-44277755 AGGGCTTCAGCTCATAGGATAGG - Exonic
1008427917 6:51380749-51380771 AGGGTTTGAGCAGAGAGGGCTGG + Intergenic
1008515978 6:52319514-52319536 AAGGGTTCAGGAGAGAGGGTAGG - Intergenic
1009329175 6:62394247-62394269 AGAGCTTCAGTTGTGAGGGTTGG - Intergenic
1009454367 6:63838451-63838473 AGGGCTTCTCCAGAGACAGTCGG + Intronic
1011023034 6:82835596-82835618 ATGGCTTCAGCAGTGTAGGTTGG - Intergenic
1011686717 6:89829692-89829714 AGGGCTTTAAGAGAGAGGGGCGG - Intergenic
1011743793 6:90389328-90389350 AGGTGGTCAGAAGAGAGGGTGGG - Intergenic
1012070516 6:94607745-94607767 AGGGCTTCAGCAAAATGGATTGG + Intergenic
1013160478 6:107538999-107539021 AGAGGTTCTGCAGACAGGGTGGG + Intronic
1013426768 6:110019311-110019333 TGGGCTTCAGAACAGAAGGTGGG - Intergenic
1013954296 6:115822653-115822675 TGGGCTTCTGGAGAGAGGGCTGG + Intergenic
1014077992 6:117258953-117258975 AGGGCTTTCCCAGAGAAGGTAGG + Intergenic
1019174177 6:170151654-170151676 AGAGCCACAGCAGGGAGGGTGGG + Intergenic
1019342142 7:513337-513359 ACGGCTACAGCAGACAGGCTGGG + Intronic
1021328458 7:19303930-19303952 AGGGATTCAGCAGAGGCTGTAGG + Intergenic
1021471104 7:21003198-21003220 CTGGCTGCAGCAGACAGGGTGGG - Intergenic
1021998577 7:26202415-26202437 CGGGCTTCAGCGGCGGGGGTCGG + Intronic
1022445782 7:30469680-30469702 AGGATTTCAGCAGAGAAGGGAGG - Intronic
1023753397 7:43393167-43393189 AGAGCTTCAACAGAGAGAGGGGG + Intronic
1024314853 7:48006314-48006336 AGGGCTTCAGAAGAGACCCTAGG - Intronic
1024600218 7:50974022-50974044 AGGGGTTGAGCACTGAGGGTAGG + Intergenic
1027560626 7:79724440-79724462 AGGTCTTCAGAAGAGAAGGGAGG + Intergenic
1028093369 7:86730479-86730501 AGGGCTTCACTAGAAAGGGATGG + Intronic
1029175902 7:98664309-98664331 AGGGCTGGAGGAGAGAGGTTGGG - Intergenic
1030440637 7:109584200-109584222 AGGGCTTCAGCACACAGCTTTGG + Intergenic
1031602941 7:123734627-123734649 AGGATTTCAGCAGGGAGGGGCGG + Intronic
1032531471 7:132624225-132624247 AGAGTCTCAGCAGTGAGGGTAGG - Intronic
1032958735 7:137004537-137004559 AGGTCTTCGGAAGAGAGGGTGGG + Intronic
1033553776 7:142470507-142470529 ATGGCTGCAGTAGAGAGGGGCGG - Intergenic
1033614935 7:143004892-143004914 AGGGCATCAGCAGCTAGGGATGG + Intergenic
1034092174 7:148373786-148373808 AGGGGTTCAGCAGTGAGAATAGG + Intronic
1034967585 7:155400736-155400758 GGGGCTTCTGCAGAGGGAGTGGG - Intergenic
1035019429 7:155792033-155792055 AGGGATTATGGAGAGAGGGTGGG - Intergenic
1035066522 7:156109243-156109265 GGGTCTTCAGAAGGGAGGGTGGG - Intergenic
1035887445 8:3307305-3307327 AGGGCCTCAGCTGGGATGGTTGG - Intronic
1036552653 8:9828748-9828770 CAGGCTTCAGCAGAGCGGGTGGG - Intergenic
1036966930 8:13309388-13309410 AGGGTCTCAACATAGAGGGTTGG - Intronic
1038606851 8:29015329-29015351 AGAGCTTCAGGATGGAGGGTGGG - Intronic
1039044777 8:33439905-33439927 AGGGTTTCATCAGACAGGGTGGG - Intronic
1039371256 8:36986288-36986310 AGGGGATCAGCAGACAAGGTGGG + Intergenic
1041919571 8:63167412-63167434 AGAGCAACAGCAGAAAGGGTTGG + Intergenic
1042446298 8:68889191-68889213 AGGGCTTCTGGAGCGATGGTTGG + Intergenic
1043515282 8:80990039-80990061 GTGGCCTCAGCAGGGAGGGTGGG - Intronic
1044312780 8:90713189-90713211 AGGACTTCAGCAGTTAGGATAGG + Intronic
1045084078 8:98661724-98661746 AGGGCTGTAGCAGAGAATGTGGG - Intronic
1045117821 8:99002988-99003010 AGGGCTGTTGCAGGGAGGGTGGG + Intergenic
1045144315 8:99323053-99323075 AGATCTTCAGCCTAGAGGGTGGG + Intronic
1045251369 8:100485821-100485843 ATGTCTTCAACAGAAAGGGTTGG + Intergenic
1046437906 8:114217626-114217648 AGTTGTTCAGCAGAGTGGGTAGG - Intergenic
1047060313 8:121218427-121218449 AGGGCATCAGGAGAGAGAATGGG + Intergenic
1047522441 8:125605451-125605473 AGGGCTTCAGCAGATAAATTTGG + Intergenic
1047537068 8:125729668-125729690 AGGGCCACAGGAGAGAGGTTGGG + Intergenic
1048136024 8:131747128-131747150 ACTGCTTGAGCAGGGAGGGTGGG + Intergenic
1048592243 8:135831636-135831658 AGGACATCAGCACAGAAGGTGGG - Intergenic
1049010266 8:139882639-139882661 AGGGAGTCAGCACAGGGGGTAGG + Intronic
1049037475 8:140087641-140087663 AGGGCGGCAGCAGAGGAGGTTGG - Intronic
1049268972 8:141684143-141684165 AGGGCTTCCCCAAGGAGGGTGGG - Intergenic
1049573008 8:143378363-143378385 AGGGCTGCAGGAGGGTGGGTGGG - Intronic
1049623418 8:143609453-143609475 AGGGCCTCATCAGAGCAGGTGGG - Exonic
1050362095 9:4839898-4839920 AGGGTTTCAGGAGAGAGATTGGG + Intronic
1051370520 9:16355296-16355318 AGGGCTTGGGCAGGGAGTGTGGG - Intergenic
1051466014 9:17378780-17378802 CTGGCTTCAGCAGAGTGTGTTGG + Intronic
1052989817 9:34512564-34512586 AAGGGTTCAGCAGACAGGGCCGG - Intronic
1053136115 9:35651048-35651070 AGGGCCTGGGCAGCGAGGGTGGG - Intergenic
1053683059 9:40498245-40498267 AGGGTTTCAGCAGTCAGGGCTGG - Intergenic
1053933042 9:43126561-43126583 AGGGTTTCAGCAGTCAGGGCTGG - Intergenic
1054280655 9:63126683-63126705 AGGGTTTCAGCAGTCAGGGCTGG + Intergenic
1054296159 9:63333743-63333765 AGGGTTTCAGCAGTCAGGGCTGG - Intergenic
1054394175 9:64638248-64638270 AGGGTTTCAGCAGTCAGGGCTGG - Intergenic
1054428825 9:65143447-65143469 AGGGTTTCAGCAGTCAGGGCTGG - Intergenic
1054501554 9:65878088-65878110 AGGGTTTCAGCAGTCAGGGCTGG + Intronic
1055116553 9:72611567-72611589 GGGGCATGAGCAGAGAAGGTAGG + Intronic
1056292736 9:85160346-85160368 AGGGCTGCTGCAGGGAGGGTGGG - Intergenic
1056292876 9:85161317-85161339 AGGGCTGCTGCAGGGAGGGTGGG - Intergenic
1057552674 9:96063525-96063547 AGGCCTTCAGCACACTGGGTGGG - Intergenic
1057787206 9:98096133-98096155 AGGGCCTCAGGAGGGAGGGAGGG + Intronic
1057798532 9:98175217-98175239 AGGGCCCCAGCAGAGGGGCTCGG + Intronic
1058769323 9:108215076-108215098 AGGGGTTTACCAGAAAGGGTGGG - Intergenic
1059484674 9:114617461-114617483 AGGGGCTCAGCAGAGAGTGATGG - Intronic
1059819029 9:117951242-117951264 TGTGCTTTAGCAGAGCGGGTGGG - Intergenic
1060024636 9:120160929-120160951 AGGGCTTCAGGGCACAGGGTAGG - Intergenic
1060123922 9:121023854-121023876 AGGGATTGAGGAGAGAGGGAAGG + Intronic
1060750748 9:126166889-126166911 AAGTCTCCAGCAGAGAGGGAAGG + Intergenic
1061365653 9:130171654-130171676 AGGACTTCAGCAGAGAGTGATGG - Intergenic
1061374783 9:130217428-130217450 AGGGGCTCAGCAGAGAAGGTGGG + Intronic
1061947692 9:133917917-133917939 GGGGATTCAGCCGGGAGGGTGGG - Intronic
1061953731 9:133950750-133950772 TGGGCTGCAGCAGAGAGGAGGGG - Intronic
1203435340 Un_GL000195v1:132210-132232 AGGGACTAAGGAGAGAGGGTGGG - Intergenic
1203636768 Un_KI270750v1:120029-120051 ATGGCTGCAGCAGTGAGGGAGGG + Intergenic
1186419891 X:9417144-9417166 AGCCCCTCAGCAGAGAGGGCAGG + Intergenic
1187226832 X:17380997-17381019 AGGTCATCAGCTGAGAGTGTTGG + Intronic
1187883289 X:23865645-23865667 AGGGCAGCAGCAGGGTGGGTGGG - Intronic
1192420788 X:71028339-71028361 TGGGCTTAGGCTGAGAGGGTGGG + Intergenic
1195105983 X:101601541-101601563 AGGCCATGAGCAGAGAGAGTAGG - Intergenic
1195106900 X:101612226-101612248 AGGCCATGAGCAGAGAGAGTAGG + Intergenic
1195655598 X:107328819-107328841 GGGGCTGCAGCAGAAAGGATGGG - Intergenic
1202231500 Y:22663724-22663746 AGGTTTTTTGCAGAGAGGGTGGG - Intergenic
1202311658 Y:23532441-23532463 AGGTTTTTTGCAGAGAGGGTGGG + Intergenic
1202559144 Y:26138153-26138175 AGGTTTTTTGCAGAGAGGGTGGG - Intergenic