ID: 1139480268

View in Genome Browser
Species Human (GRCh38)
Location 16:67226806-67226828
Sequence CTGGGTAACGGTTCCTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139480268_1139480286 30 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480286 16:67226859-67226881 GTCGTTTCCGCCAGGCTGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 123
1139480268_1139480271 -7 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480271 16:67226822-67226844 TACCCAGAGCTAGAAGGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 112
1139480268_1139480284 26 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480284 16:67226855-67226877 GCGGGTCGTTTCCGCCAGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 46
1139480268_1139480279 7 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480279 16:67226836-67226858 AGGTCCCGGGATCGGGAGGGCGG 0: 1
1: 0
2: 2
3: 30
4: 217
1139480268_1139480277 3 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480277 16:67226832-67226854 TAGAAGGTCCCGGGATCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 57
1139480268_1139480275 -1 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480275 16:67226828-67226850 GAGCTAGAAGGTCCCGGGATCGG 0: 1
1: 0
2: 0
3: 4
4: 61
1139480268_1139480278 4 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480278 16:67226833-67226855 AGAAGGTCCCGGGATCGGGAGGG 0: 1
1: 0
2: 2
3: 9
4: 81
1139480268_1139480280 8 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480280 16:67226837-67226859 GGTCCCGGGATCGGGAGGGCGGG 0: 1
1: 0
2: 0
3: 16
4: 251
1139480268_1139480272 -6 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480272 16:67226823-67226845 ACCCAGAGCTAGAAGGTCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 172
1139480268_1139480276 0 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480276 16:67226829-67226851 AGCTAGAAGGTCCCGGGATCGGG 0: 1
1: 0
2: 0
3: 5
4: 46
1139480268_1139480285 29 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480285 16:67226858-67226880 GGTCGTTTCCGCCAGGCTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 124
1139480268_1139480283 22 Left 1139480268 16:67226806-67226828 CCAAAGGAGGAACCGTTACCCAG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1139480283 16:67226851-67226873 GAGGGCGGGTCGTTTCCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139480268 Original CRISPR CTGGGTAACGGTTCCTCCTT TGG (reversed) Intronic
902239522 1:15079272-15079294 CTGGCAAGCAGTTCCTCCTTAGG - Intronic
902639774 1:17759638-17759660 CTGGGTGGAGGCTCCTCCTTGGG + Intronic
908946351 1:69502506-69502528 GTGGGTAACAGTTCTTGCTTTGG + Intergenic
910347560 1:86257860-86257882 CTGTGTTACGCTTCCTCCATGGG - Intergenic
917073651 1:171180284-171180306 CTGGGGCACGGTTTCTCCTCTGG + Intergenic
920806443 1:209238670-209238692 ATGGGTCACGTTTCTTCCTTTGG - Intergenic
923471056 1:234291411-234291433 CTGGGGAACTGTTCCTCCTCTGG - Intronic
924424325 1:243936964-243936986 CTGGGGAAGCGTTCTTCCTTTGG + Intergenic
1064433562 10:15291455-15291477 CTGGCTAGCGGTTCCTGCGTCGG + Intronic
1072979610 10:100088965-100088987 CTGGTTAACATTTCCTCATTAGG - Intergenic
1075996345 10:126879153-126879175 CTGGGTGACGTTTAGTCCTTGGG + Intergenic
1082847816 11:57740752-57740774 GTGGTTAAAGGTTTCTCCTTAGG - Exonic
1085225580 11:74917789-74917811 CTTGGTAAAAGTACCTCCTTAGG - Intronic
1090964550 11:131586593-131586615 CTGGCTCAGGGTTCCTCCTAAGG - Intronic
1092116448 12:6012001-6012023 CTGGTTAATTTTTCCTCCTTTGG - Intronic
1094562756 12:31570766-31570788 CTGTGTAACTGTCCCTTCTTAGG + Intronic
1097174869 12:57136661-57136683 GTGGGTGACTGTTCCTCCTGTGG + Intronic
1101835949 12:108295565-108295587 CTGGGTAACAGCCCCTCCTCTGG - Intronic
1118710449 14:68514526-68514548 CTGGCTAAAAGTTCCTCCTGTGG + Intronic
1128096863 15:64963425-64963447 CTGTGTAACTGTTCCCTCTTTGG - Exonic
1132120235 15:99169559-99169581 CTGGGTTACTGATGCTCCTTGGG - Intronic
1139480268 16:67226806-67226828 CTGGGTAACGGTTCCTCCTTTGG - Intronic
1153911999 18:9712587-9712609 CTGGGAAACTTTTCCACCTTTGG - Intronic
1160874204 19:1289767-1289789 CTGGGGGACGGCTCCTCCCTCGG - Intronic
1161571335 19:5032326-5032348 CTGGGTCAAGGTTCCTGCTAGGG + Intronic
1166845934 19:45728531-45728553 CTGGGCAAGGGTTCTTCTTTTGG - Intronic
926336432 2:11866016-11866038 TTGGGTAACGGGTGCTGCTTTGG + Intergenic
934650888 2:96090924-96090946 CTGAGTAAAGGATCCTGCTTGGG + Intergenic
953240800 3:41147865-41147887 CTGGGGAAGGGTTGCTTCTTGGG - Intergenic
954124597 3:48521053-48521075 CAGGGTAACTGGTCCTGCTTGGG + Intronic
954544169 3:51418659-51418681 CAGGGTAAGGGTTCCTTCCTAGG - Exonic
961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG + Intronic
982228386 4:153186237-153186259 CTGGGTCACTTTTCCTCCTTGGG + Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
997669176 5:135656416-135656438 CTGGGTCCTGGTTCCTGCTTTGG + Intergenic
998546570 5:143033295-143033317 CTGAGTAAATGTTCCTCCTTTGG - Intronic
1001435394 5:171695672-171695694 CTGGGTCAAGGTCCCTTCTTGGG + Intergenic
1028941417 7:96526246-96526268 CTGGGCACAGGTACCTCCTTAGG + Intronic
1033418046 7:141181788-141181810 CTTGGTAAGTCTTCCTCCTTGGG + Intronic
1039493326 8:37964060-37964082 CTTGGTAAGGATCCCTCCTTGGG + Exonic
1042705753 8:71664425-71664447 CTGGGCAAAGGCTCCTTCTTTGG - Intergenic
1044729892 8:95221224-95221246 CTGGGCAAAGGCTCCTACTTAGG + Intergenic
1060156134 9:121321060-121321082 CTGGGTCAGGGTTCCTGCCTGGG - Intronic