ID: 1139480869

View in Genome Browser
Species Human (GRCh38)
Location 16:67229974-67229996
Sequence GCTGCTCTGGACCATGCCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139480866_1139480869 0 Left 1139480866 16:67229951-67229973 CCCACTGTGGGCATGATTGGGGA 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1139480869 16:67229974-67229996 GCTGCTCTGGACCATGCCTGAGG 0: 1
1: 0
2: 2
3: 36
4: 270
1139480864_1139480869 1 Left 1139480864 16:67229950-67229972 CCCCACTGTGGGCATGATTGGGG 0: 1
1: 0
2: 0
3: 16
4: 132
Right 1139480869 16:67229974-67229996 GCTGCTCTGGACCATGCCTGAGG 0: 1
1: 0
2: 2
3: 36
4: 270
1139480867_1139480869 -1 Left 1139480867 16:67229952-67229974 CCACTGTGGGCATGATTGGGGAG 0: 1
1: 0
2: 1
3: 22
4: 252
Right 1139480869 16:67229974-67229996 GCTGCTCTGGACCATGCCTGAGG 0: 1
1: 0
2: 2
3: 36
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139480869 Original CRISPR GCTGCTCTGGACCATGCCTG AGG Exonic
900669565 1:3842460-3842482 TCTGGTCTGCACCAGGCCTGTGG + Intronic
901312096 1:8277405-8277427 GCTGGTCTCGAACATGCCTGTGG - Intergenic
902377513 1:16036777-16036799 GATGCTCTGCACCACCCCTGGGG + Intergenic
902382687 1:16060035-16060057 GATGCTCTGCACCACCCCTGGGG + Exonic
902883572 1:19389137-19389159 GCTGCTGTGGTCCAAGTCTGTGG - Intronic
903301129 1:22379461-22379483 CCTGGTCTGGGCCAGGCCTGGGG - Intergenic
903912878 1:26741154-26741176 GGAGCTCTGGACGATGCCGGAGG + Intronic
910841825 1:91568591-91568613 GCTGTGCTGGTACATGCCTGTGG + Intergenic
911178762 1:94843012-94843034 TCTGGTCTGGTCCCTGCCTGAGG - Intronic
913609012 1:120492673-120492695 GCATCGCTGGACCAGGCCTGGGG - Intergenic
913986432 1:143569994-143570016 GCCTCTCTGGACCAGGCCTGGGG + Intergenic
914204816 1:145517778-145517800 GCATCGCTGGACCAGGCCTGGGG + Intergenic
914423955 1:147557006-147557028 GCTGCTTGGTACCCTGCCTGAGG - Intronic
914515048 1:148367264-148367286 GGTGCAGTGGCCCATGCCTGTGG + Intergenic
914582179 1:149029165-149029187 GCATCGCTGGACCAGGCCTGGGG + Intronic
914934324 1:151964950-151964972 TCTGCTCTGGTCCATTCCTTTGG + Intergenic
915312423 1:155011254-155011276 CCTGCACTGGACCCTGCCTGAGG + Intronic
915970694 1:160353098-160353120 CCTGTTCTGGGCCATGCCTAGGG - Intronic
917978792 1:180256662-180256684 GCTGCACTGGGCCATCCGTGGGG + Intronic
918094540 1:181323933-181323955 GCTGCTCTGGACCAGGGCTCAGG - Intergenic
920174722 1:204093468-204093490 GGTGCTCAGGATGATGCCTGTGG + Intronic
920230728 1:204467996-204468018 GCTGCCCTGGCACCTGCCTGGGG + Intronic
920827347 1:209434297-209434319 GCTGCTCTGGGCCAGGCTTGGGG - Intergenic
922873748 1:228923722-228923744 GCCGCACTGGACCTTGCCTGGGG + Intergenic
923555444 1:234997249-234997271 GCAGCTCTGGACCATGCCAAGGG - Intergenic
1062787545 10:278085-278107 GCTGCTGAGGGCCATGCGTGTGG + Intronic
1063773314 10:9229590-9229612 GCTGCTCTAGAACATTCCAGCGG + Intergenic
1064166324 10:12989329-12989351 GCTGCTCTGGACTAAGTCAGTGG - Intronic
1064256095 10:13743837-13743859 TCTGCTCTGGAACTTGCCAGAGG + Intronic
1065048189 10:21763068-21763090 GGTGTTGTGGCCCATGCCTGTGG - Intronic
1066277965 10:33887361-33887383 CCTGGTCTGGAGCATGCCAGTGG + Intergenic
1067746059 10:48937456-48937478 GCTGCTCTGTGCCAGGCCTAGGG + Intronic
1069604863 10:69732695-69732717 CCTGCTCTGTGCCAGGCCTGGGG + Intergenic
1069828282 10:71267630-71267652 CCTCCTCTTGACCATGCCTGTGG - Intronic
1069835677 10:71306555-71306577 GCGGCTCCTGACCAAGCCTGGGG + Intergenic
1070559958 10:77558843-77558865 GCTGTTGGGGACCATGCCAGAGG - Intronic
1072003950 10:91224154-91224176 CATGCTCAGGACCCTGCCTGGGG + Intronic
1072254979 10:93612917-93612939 GCTGCTGTGGACCGTGCAGGAGG + Exonic
1075374488 10:121967334-121967356 GCTGTAGTGGCCCATGCCTGTGG - Intronic
1075724700 10:124605302-124605324 CCTGCTCTGGGTCAGGCCTGTGG + Intronic
1076413326 10:130267065-130267087 GGTGCTCTGGGCCTTTCCTGTGG + Intergenic
1076729783 10:132432475-132432497 GCTGCCCCGGAGCATCCCTGGGG - Intergenic
1076868758 10:133182488-133182510 GCGGCTCAGGAACCTGCCTGGGG - Intronic
1076880045 10:133235679-133235701 GCTGCTCTAGCCCAGGCTTGGGG - Intergenic
1077096943 11:803069-803091 GCAGCTGTGGACCAAGCCTGTGG + Intronic
1077293546 11:1812891-1812913 GCTTCTTTAGACCATGGCTGGGG + Intergenic
1077369170 11:2173575-2173597 GCTCCTCTGGAACATCCCTGGGG + Intergenic
1077539252 11:3138965-3138987 GCTGCTGTGGGCCAAGACTGAGG + Intronic
1078844844 11:15111518-15111540 ACAGCTCTGGACCAGTCCTGAGG + Intergenic
1085262025 11:75211603-75211625 GCTGCCTTGGATCATCCCTGTGG - Intergenic
1085641956 11:78198220-78198242 CCTGCTCTGTGCCTTGCCTGGGG + Intronic
1087154072 11:94884033-94884055 GCTTCCCTGGACTATGCCAGAGG - Intergenic
1087759060 11:102086355-102086377 GCAGCCCAGGAACATGCCTGTGG + Intergenic
1088259809 11:107933517-107933539 GGTGCTGTGGCGCATGCCTGTGG - Intronic
1089124809 11:116169365-116169387 CCAGCTCTGGACAAGGCCTGGGG - Intergenic
1089615531 11:119692637-119692659 GCTGATCTGTGCCAGGCCTGGGG + Intronic
1091007111 11:131963239-131963261 GCTGCTCTGGGTCACACCTGTGG - Intronic
1091277532 11:134362618-134362640 GCTGTTCTGGGCCAGGCCGGCGG + Intronic
1092106131 12:5922744-5922766 CCCCCTCTGGACCCTGCCTGAGG + Exonic
1094653360 12:32399146-32399168 GCTACTCTGGACCATGTCCAGGG - Intergenic
1098872687 12:75834683-75834705 GCTGCTCTGGGCAATGTCTGTGG - Intergenic
1101901447 12:108794015-108794037 CCTCCTCTGGGCCTTGCCTGGGG + Intronic
1102240687 12:111322720-111322742 GCTGCACTGGAACATGGCGGGGG + Intronic
1103909603 12:124344985-124345007 GCTGGTCTGGGCTATGGCTGTGG - Intronic
1106248756 13:27968680-27968702 GCTGCTGTAGCCCATGGCTGCGG + Exonic
1106462028 13:29979411-29979433 GCTTCTCAGGACCATGACTTTGG - Intergenic
1107843012 13:44479244-44479266 GCTGTCCTGGGCCATGCCCGTGG - Intronic
1108437083 13:50411252-50411274 GATGCTCTGCCCCATGCCAGAGG + Intronic
1113111816 13:106831469-106831491 GGTTCTCTGGACCCTCCCTGGGG + Intergenic
1113389523 13:109882174-109882196 GCTGCTCTTTTCCATGCCTGGGG + Intergenic
1114832263 14:26159164-26159186 GCTTCTCTTGACCATGCTTTTGG + Intergenic
1115034260 14:28838213-28838235 GATGCTGTGGTGCATGCCTGTGG - Intergenic
1116231984 14:42229305-42229327 GCTCCTCAGCACCATGCATGTGG + Intergenic
1117375096 14:55112398-55112420 GGTGCTGTGGTGCATGCCTGTGG - Intergenic
1118319917 14:64747068-64747090 GCTGCCCTGGACCAGGCCAGGGG + Exonic
1119425517 14:74532341-74532363 GCTGCCCTGGGCCTGGCCTGTGG + Intronic
1120617137 14:86721108-86721130 GGTGCTCTGGAGGATGCCAGGGG - Intergenic
1120974470 14:90236461-90236483 GGTGTTCTGGCACATGCCTGTGG - Intergenic
1121000872 14:90451348-90451370 GCTGCTGTGTACCCTGCCTGAGG - Intergenic
1121120161 14:91371525-91371547 GCTCCTCGGGACCAAGACTGTGG - Intronic
1121269896 14:92631146-92631168 CTTGCTCAGGACCAGGCCTGTGG - Intronic
1121323209 14:93004847-93004869 TCTCCCCTGGCCCATGCCTGTGG - Intronic
1121440197 14:93944107-93944129 GCTGGTCTGGGCCGTGGCTGAGG - Exonic
1121827115 14:97019331-97019353 GCTGCCCTGGAACCCGCCTGGGG + Intergenic
1121843017 14:97150402-97150424 GCTGCACAGGCCCATTCCTGTGG - Intergenic
1122070153 14:99200839-99200861 GCTGCTCTGTGCCAGGCCTCGGG - Intronic
1122289625 14:100673341-100673363 GCTGCTCTGTACCTGGCCGGGGG + Intergenic
1122671007 14:103372061-103372083 GCTGCTCAGGGCCAGGCCTGAGG + Intergenic
1122824227 14:104361945-104361967 GCTGCTCTGGAGCATGGTGGCGG + Intergenic
1123037776 14:105478413-105478435 GCGGGTCAGGACCCTGCCTGAGG - Intronic
1124404642 15:29382572-29382594 CCTGCCCTTGACCTTGCCTGGGG + Intronic
1125968268 15:43891600-43891622 GCTGTTCTGGAGCATCTCTGTGG - Intronic
1127868920 15:63054042-63054064 GCTGATCTGGACAATGCCTAGGG + Intronic
1128225526 15:65998825-65998847 GCTGCTGTGGGCCACGCCTGAGG - Intronic
1128731394 15:70023865-70023887 GCTGCCTTGGCCCAGGCCTGTGG + Intergenic
1128862969 15:71090181-71090203 GATGCCCTGGACCAAGGCTGTGG - Intergenic
1130926628 15:88390366-88390388 GCAGCTGTGGACAATGCCTAAGG - Intergenic
1132252416 15:100343470-100343492 CCTGCTCTTGGCCAGGCCTGGGG + Intergenic
1132386525 15:101404542-101404564 GCTGCTCTGTATCTTGCCGGCGG - Intronic
1132386885 15:101407120-101407142 GCTGCTCTGTATCTTGCCAGGGG - Intronic
1132504020 16:297823-297845 GCTGCTCTGGGCCCTGCGGGTGG + Exonic
1132566617 16:626362-626384 GCTGCACTCTGCCATGCCTGTGG + Intronic
1132661386 16:1062993-1063015 CCTGCCCCTGACCATGCCTGCGG - Intergenic
1133033281 16:3021583-3021605 GCTGCTTTGGCCCATCCTTGGGG + Exonic
1136137115 16:28263075-28263097 GCTGTTCTGGCCAATGCATGTGG - Intergenic
1136370299 16:29831842-29831864 CCTGCTCAGGCCCAGGCCTGAGG - Intronic
1136514369 16:30759132-30759154 GCTGGGCTGGGCCAGGCCTGGGG - Exonic
1136554473 16:30999703-30999725 GGTGCTCTGTGCCATGCCGGGGG + Intronic
1139187290 16:64821940-64821962 TGTGATCTGGCCCATGCCTGCGG + Intergenic
1139480869 16:67229974-67229996 GCTGCTCTGGACCATGCCTGAGG + Exonic
1139515418 16:67449801-67449823 CCTGCTCTGGGCCAGGCCTGGGG - Intronic
1139912132 16:70404186-70404208 GCGGCTCAGGACAAAGCCTGGGG + Intronic
1141571168 16:84934384-84934406 GCTGTTCTGTGCCAAGCCTGGGG + Intergenic
1141843455 16:86590232-86590254 GCTGCTGTGGACCATGGAGGTGG + Intergenic
1142673689 17:1500085-1500107 GGTGCCCTGGCACATGCCTGTGG - Intronic
1143262290 17:5608435-5608457 GCTGCTCTTGTGCATACCTGAGG - Intronic
1143712401 17:8743865-8743887 TCTGCTCTGGGCCAGGCATGGGG - Intronic
1144330680 17:14221294-14221316 GCTATTCTGTACCCTGCCTGCGG - Intergenic
1144460096 17:15451546-15451568 GCTGCTCTGGCCAAGGCTTGTGG - Intronic
1145993839 17:29094562-29094584 GATCCTCTGGCCCATGCCTGAGG + Intronic
1146008612 17:29177818-29177840 GATGCTCTGGCTCCTGCCTGTGG + Intronic
1146162759 17:30568896-30568918 GCGGCTCAGGTCCATGCCTGGGG + Intergenic
1146402358 17:32509891-32509913 GCTCCTCAGCAGCATGCCTGCGG + Intronic
1146636880 17:34513127-34513149 GCTGCTCTGAACAATGCCCTGGG - Intergenic
1146884554 17:36462424-36462446 GCTGCTCTGCCCCATGGTTGAGG - Intergenic
1147579764 17:41621674-41621696 GCGGCTCAGGTCCACGCCTGGGG + Exonic
1147644397 17:42025169-42025191 GCTGCTCTTTATCCTGCCTGTGG + Exonic
1148017398 17:44531776-44531798 GATGTTCTGCACCATACCTGGGG + Intergenic
1148023081 17:44566419-44566441 GGTGCCCTGAGCCATGCCTGTGG + Intergenic
1148805228 17:50260617-50260639 GCTGCTGTGGAAGATGCCAGTGG + Intergenic
1154942530 18:21128918-21128940 GGTGCACTGGCACATGCCTGTGG + Intergenic
1155024787 18:21931217-21931239 GCTGTTCTGCAGCCTGCCTGGGG + Intergenic
1156842627 18:41627566-41627588 TCTGATCAGGACCATTCCTGGGG - Intergenic
1157616805 18:48991969-48991991 GCTGCTCAGGACTCTGCCTCAGG + Intergenic
1157804729 18:50649649-50649671 GTTGCTCTGGCCCATGCATTGGG + Intronic
1161053054 19:2175438-2175460 GATGCAGTGGCCCATGCCTGGGG - Intronic
1161314199 19:3610321-3610343 GCAGCGCTTGGCCATGCCTGGGG - Intergenic
1162178432 19:8848878-8848900 GCTTCTTTGGACCCTGGCTGGGG + Exonic
1163728146 19:18934091-18934113 GAGGGTCTGGACCTTGCCTGGGG - Intronic
1165382241 19:35489635-35489657 GCTGCTAAGGACCAAGCCAGTGG - Intronic
1165721231 19:38081477-38081499 GCTGCCCTGAACAATGGCTGAGG + Exonic
1166538917 19:43593060-43593082 GGTGCTCTGGACCGTGCCTCTGG - Exonic
1167077636 19:47258967-47258989 TCTGCTCTGGGGCATCCCTGAGG - Intronic
925599218 2:5590877-5590899 GCTGCTCTGCGCTGTGCCTGCGG - Intergenic
928163412 2:28950733-28950755 CCTGCCCAGGACCAGGCCTGGGG - Intergenic
928361431 2:30665115-30665137 GCTCCTCTGAAGCATTCCTGGGG + Intergenic
928414670 2:31082262-31082284 GCTGCCTTGGCCCCTGCCTGAGG - Intronic
928550221 2:32363054-32363076 GGTGCTGTGGCTCATGCCTGGGG + Intronic
928990473 2:37228058-37228080 GCTGCTTTGTAACAAGCCTGAGG - Exonic
931456283 2:62411920-62411942 GCTGTTCTGGACCTGGCCCGTGG - Intergenic
932212763 2:69945862-69945884 GATGCTCTTGGCCTTGCCTGGGG + Intergenic
933226881 2:79759952-79759974 CCTGCTTTGGAGCATGGCTGAGG - Intronic
935387007 2:102510411-102510433 GCAGCTTTGGCTCATGCCTGAGG - Intronic
935874990 2:107496813-107496835 GCTTCTCTGTACCTTGACTGTGG - Intergenic
937428481 2:121818671-121818693 GCAGCTCTGGCCCTTGGCTGGGG - Intergenic
937500208 2:122470275-122470297 CCTCCTCTGGTCCATGCGTGGGG + Intergenic
937976138 2:127583187-127583209 GCTCCTCTGGGCCCTGTCTGAGG + Intronic
937983521 2:127628396-127628418 GCTGCTCTCCACGATGCATGAGG + Exonic
940666150 2:156612271-156612293 GCTACTGTGGACCAGGCATGTGG + Intronic
942159339 2:173165809-173165831 GGTGTTCTGGCACATGCCTGTGG - Intronic
946842835 2:223835780-223835802 GCTCCTCTGGACAATACCTGTGG - Intronic
948075744 2:235164054-235164076 GCTGCACTGGACCCTGCCCAAGG - Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
948482195 2:238257218-238257240 GATGCTCTGGCCCAGGCATGGGG + Intronic
948632364 2:239310306-239310328 GGAGCTCTGGACCAGGCTTGAGG - Intronic
1168794252 20:600721-600743 GCTGGGCTGGACCATCCCGGAGG + Intergenic
1168849466 20:966713-966735 GCTGTTGTGGTACATGCCTGTGG + Intronic
1168869871 20:1118963-1118985 GGCGCTCTGGACCAGGCCTCCGG - Intronic
1168901437 20:1368449-1368471 GCTTCTCTGGACCCTGCCCTGGG - Intronic
1169274062 20:4221383-4221405 GCTGCTCTGTGACATCCCTGAGG - Exonic
1171237465 20:23539253-23539275 ACTTCTCTGGACCATGCCAGTGG - Intergenic
1172034182 20:32000173-32000195 GGAGCTCGGGACCAGGCCTGAGG + Exonic
1173617442 20:44412424-44412446 GCTGCTGTGGTCACTGCCTGGGG - Intronic
1174483340 20:50845914-50845936 GCTGGTGTGGACATTGCCTGTGG + Intronic
1175216143 20:57392487-57392509 GCTCCTCTGAACCCTACCTGGGG - Intronic
1175569194 20:60006289-60006311 GCTCATCTGGCCCATGTCTGTGG - Intronic
1176251061 20:64120172-64120194 GCTGCTCTGGACCTGGTCTGGGG + Intergenic
1178836383 21:36100984-36101006 GCTGTTCTTGCCCATCCCTGGGG - Intergenic
1179647914 21:42786389-42786411 GCAGCGATGGGCCATGCCTGAGG - Intergenic
1179793247 21:43767839-43767861 GCTGCCCTGGGCCCTGCCTCAGG + Intergenic
1180131366 21:45829184-45829206 GCTGCTCTGGGCCAGGGCTCTGG + Intronic
1184287976 22:43482752-43482774 GCAGCTCTGTCCCATGGCTGTGG - Intronic
1184350439 22:43940078-43940100 GCTGCCCTGTACCCTGCCTGTGG + Exonic
1184819078 22:46895164-46895186 GGTGCTCTGGGTCAGGCCTGAGG - Intronic
1185022071 22:48382411-48382433 GCAGCTGTGGATCATTCCTGGGG - Intergenic
1185130091 22:49033979-49034001 GCTGCCCTGGAGCAGGGCTGGGG - Intergenic
949243367 3:1896357-1896379 GCAGCTCTGAACCCTGCTTGGGG - Intergenic
949935200 3:9110767-9110789 GCAGCTCTTGACCCTGGCTGTGG - Intronic
950655297 3:14432736-14432758 GCTGCTCTCGGCCCTGCCTCTGG + Intronic
953418152 3:42734681-42734703 GCTGCTTTGCAACATGCCTTTGG + Intronic
953814088 3:46139845-46139867 ACTGCTTTGAACCTTGCCTGGGG - Intergenic
954107541 3:48417518-48417540 GCAGCCCAGGACAATGCCTGGGG + Intronic
954449637 3:50564673-50564695 CCTGCCCTGGACCAGGCCTTTGG - Intronic
954630984 3:52047498-52047520 GCTGCCCTCGCCCAGGCCTGGGG - Intergenic
954656903 3:52199374-52199396 GCTGCAGTGGACAATGCCCGAGG - Exonic
956213788 3:66827610-66827632 GCTGCTCTGGAGCATCTCTGGGG - Intergenic
957723235 3:84031703-84031725 GCACCTGTGGATCATGCCTGGGG + Intergenic
959584305 3:108011925-108011947 ACTGCTCTGGGGGATGCCTGTGG - Intergenic
961611912 3:128146171-128146193 AATGCTCTGGTCCATGCTTGGGG + Intronic
961646947 3:128397785-128397807 GCTGCTCTGGCCCATGGATGGGG + Intronic
961989029 3:131167861-131167883 GCTGTTCTGGACAAAGACTGTGG + Intronic
962033011 3:131621304-131621326 GCTGCAGTGAACCATGACTGTGG - Intronic
962570507 3:136708941-136708963 GCTGCAGTGGTACATGCCTGTGG - Intronic
962579386 3:136784129-136784151 GATGCCCTGGAACATGCCTTCGG + Intergenic
962938268 3:140101716-140101738 GAAGCTCTGAACCATGCCTTAGG - Intronic
964378829 3:156075513-156075535 ACTGCTCTGGACAATGCCAATGG - Intronic
966762063 3:183427743-183427765 GCTGCTCTGGGTCCTGCCTGCGG - Intronic
967896016 3:194396881-194396903 GCCGCTCTGGGCCCTGCCGGGGG - Exonic
968902104 4:3436667-3436689 GCTGCTCTGGCCTAGGCCTGGGG - Intronic
968959547 4:3736001-3736023 GAAACCCTGGACCATGCCTGTGG - Intergenic
969469968 4:7381948-7381970 GCCTCTCTGGGCCAGGCCTGTGG + Intronic
969516732 4:7652276-7652298 GCGGCTCTGGGCCTTGCCCGTGG + Intronic
969540342 4:7784627-7784649 GCTGCTCTGGACCTGCCCTGGGG - Intronic
969608002 4:8211877-8211899 CCTACTCTGGGCCATCCCTGTGG - Intronic
971351853 4:25862735-25862757 GCCACTCGGGACCATGGCTGCGG + Exonic
975714254 4:77190214-77190236 GGGGCCCTGGACCATGCCTGAGG - Intronic
979798269 4:124875088-124875110 GCTGCTCTGAAACTTGCCTTTGG - Intergenic
979843789 4:125481894-125481916 GTTACTCTGGCCAATGCCTGGGG - Intronic
983559540 4:169086994-169087016 GGTGCACTGGGGCATGCCTGGGG + Intergenic
983944129 4:173567364-173567386 CCTGCTCTAGACCATGCTTTGGG + Intergenic
985616180 5:923226-923248 GGTCCTCAGGCCCATGCCTGGGG - Intergenic
986430104 5:7673297-7673319 GGTGTTGTGGAACATGCCTGTGG + Intronic
986538145 5:8814245-8814267 GCTGCTCTTGATCTTCCCTGAGG - Intergenic
987508771 5:18808025-18808047 CCTGCTCTGAACCATCTCTGAGG + Intergenic
988466766 5:31499089-31499111 CCTGATGTGGACCGTGCCTGAGG - Intronic
991363312 5:65843188-65843210 GGTGTTGTGGCCCATGCCTGTGG - Intronic
992133703 5:73721173-73721195 GCTGCTCTCCACCATGTATGAGG + Intronic
995760025 5:115552809-115552831 GCTATTGTGGAGCATGCCTGAGG + Intergenic
996340827 5:122437301-122437323 GATTCTGGGGACCATGCCTGTGG - Intronic
997307623 5:132851065-132851087 GCTGCTTTGGACTATGGCAGTGG - Intergenic
997381565 5:133441742-133441764 GCTGCACTGGAGCATGCCTGTGG - Intronic
998568892 5:143239661-143239683 GCTTCTCTGCCCCATCCCTGTGG + Intergenic
999754348 5:154653431-154653453 GCGCCTCTGGGCCCTGCCTGGGG - Intergenic
1001082746 5:168679018-168679040 GCCACTCTGGCCAATGCCTGTGG - Intronic
1001656587 5:173355445-173355467 GCTGCTCTGGACCAGGCCCTGGG - Intergenic
1001895535 5:175376713-175376735 GCTGATGTGGACCAGGCCTGAGG + Intergenic
1002102575 5:176864735-176864757 CCTGCTCTGTGCCATGCCTTGGG + Intronic
1002576366 5:180176408-180176430 GCTGCTCTGGGCTCTGCATGAGG + Intronic
1003897115 6:10617706-10617728 GGTGCAGTGGCCCATGCCTGTGG - Intronic
1005871025 6:29974666-29974688 CCTGCTCTGGGCCCTGCCTCAGG - Intergenic
1007986939 6:46216576-46216598 GCTTCTCTCAACCATCCCTGTGG - Intergenic
1010575676 6:77527163-77527185 ACTGCTCTGGACTCTGGCTGTGG - Intergenic
1011655437 6:89547401-89547423 GATGCTCTTGCCCATGACTGAGG + Intronic
1011718096 6:90128050-90128072 GCACCTGTGGACCATGGCTGGGG - Intronic
1012262252 6:97100939-97100961 GCTGCAGTGGCACATGCCTGTGG - Intronic
1013635488 6:112025482-112025504 ACAGCTCTGCACCATGCATGGGG + Intergenic
1013991062 6:116253932-116253954 GCTGCTCCCGACCATGCCTCAGG - Exonic
1014506381 6:122264341-122264363 GCTGCTCTGGAAATTGCCTATGG - Intergenic
1019319423 7:408886-408908 CCTGCTCTGCACCACGCGTGGGG + Intergenic
1020207595 7:6130974-6130996 GCAACTCTGGACCACACCTGTGG - Intronic
1020824806 7:13013450-13013472 GCTACACTGTACCATGCCTGGGG + Intergenic
1021554311 7:21904152-21904174 AGTTCTGTGGACCATGCCTGCGG - Exonic
1022074993 7:26959484-26959506 GCTCCTCTAGACTCTGCCTGTGG - Intronic
1022895050 7:34741500-34741522 GCTGCTGTGGACAATTCCTTTGG + Intronic
1022960376 7:35420150-35420172 GCTGCTCTGTGCCAAACCTGGGG - Intergenic
1023629788 7:42152720-42152742 GCTGCTGTTGACCTTGCTTGGGG - Intronic
1023888365 7:44376246-44376268 ACTGCCCTGAACAATGCCTGAGG - Intergenic
1024110811 7:46144732-46144754 GCTTCTCTGAACCGTCCCTGAGG - Intergenic
1025281559 7:57629573-57629595 CCTGCTCTCGGCCCTGCCTGCGG + Intergenic
1025303171 7:57835942-57835964 CCTGCTCTCGGCCCTGCCTGCGG - Intergenic
1025639469 7:63353448-63353470 GCTGCTGTGGAACTGGCCTGAGG - Intergenic
1025643230 7:63394644-63394666 GCTGCTGTGGAACTGGCCTGAGG + Intergenic
1025712689 7:63926996-63927018 GCTGCTGTGGAACTGGCCTGAGG + Intergenic
1026678454 7:72447540-72447562 GCTGCACGGGACACTGCCTGGGG + Intergenic
1029672707 7:102044919-102044941 GCTGCCCTGGACCTTTGCTGGGG + Intronic
1031265232 7:119572596-119572618 CCTGCTCTGGAGCAGGCTTGGGG + Intergenic
1031967289 7:128035892-128035914 GCTGCTCAGGATAATGCCTCAGG - Intronic
1033550071 7:142438882-142438904 GCTACCCTGGACCATGTCAGGGG + Intergenic
1034437999 7:151072230-151072252 GCTGGTCTGGAGCATCCCCGGGG + Intronic
1035473329 7:159125465-159125487 GCTGCCCTGGACCAGCTCTGTGG - Intronic
1036709187 8:11067433-11067455 GTTGAACTGGACCATCCCTGAGG + Intronic
1037321819 8:17650956-17650978 TCTGCTCTGGACCAATCCTTAGG + Intronic
1037375581 8:18224201-18224223 TCTGACCAGGACCATGCCTGTGG + Intergenic
1037544031 8:19900170-19900192 GGTGCGTTGGCCCATGCCTGTGG + Intergenic
1038398864 8:27267846-27267868 GCTGAGCTGGGCCCTGCCTGTGG + Intergenic
1038688718 8:29742193-29742215 GCTGCTCTGCTCCATGCCTTAGG + Intergenic
1039854122 8:41397974-41397996 GGTGCTCTGGACAATGCAGGAGG - Intergenic
1039936624 8:42051745-42051767 GCTGCTCTGCGCCAGGCCTCGGG - Intronic
1047818413 8:128490740-128490762 GCTTCTCTAGGCCATGCGTGTGG + Intergenic
1048880006 8:138864248-138864270 GGTGGACTGGACCATTCCTGGGG + Intronic
1049269163 8:141685011-141685033 CCAGCTCTGGGCCATGGCTGGGG + Intergenic
1049549248 8:143249214-143249236 GCTGCTGTGGTCCATGGCAGGGG + Intronic
1049754916 8:144306635-144306657 GCTGCGCTGGTTCACGCCTGCGG - Intronic
1051347184 9:16162744-16162766 ACTACTCTGGACTGTGCCTGTGG - Intergenic
1053131531 9:35618294-35618316 GCTGCTCAGGACCATGGCTGAGG - Exonic
1055121284 9:72663541-72663563 GCTGCCCTTGTCCATTCCTGGGG - Intronic
1056734030 9:89189664-89189686 CCTGCCCTGGACCAAGCCTCTGG - Intergenic
1057218253 9:93241600-93241622 GCTGCTCTGGAAGGTTCCTGCGG + Intronic
1057222776 9:93266830-93266852 GATGCTCTAGGCCCTGCCTGGGG - Intronic
1058439227 9:104991856-104991878 GCTGCTCTGGGCGAAGGCTGCGG + Intergenic
1060044468 9:120328769-120328791 GCTACTCTGGAAGATGCTTGTGG + Intergenic
1060148382 9:121270456-121270478 GCTGCTCTGACCCATCCCAGTGG - Intronic
1060680888 9:125563227-125563249 GCAGCTCTGGTCCCTGCCTCAGG + Intronic
1061008791 9:127943291-127943313 GCTCCACTGGACCAGGCCTCTGG + Intronic
1061401742 9:130372250-130372272 GCTGCTCAGAGCCATGCTTGGGG + Intronic
1061943428 9:133894852-133894874 TCAGCTCTGGACCCTGCCTAGGG - Intronic
1062066653 9:134531577-134531599 CCTACTCTTGACCAGGCCTGAGG - Intergenic
1185812760 X:3125930-3125952 GGTGCCCTGGCTCATGCCTGTGG + Intergenic
1186241009 X:7566380-7566402 GCTGCAGTGAACCATGACTGCGG - Intergenic
1186289792 X:8084039-8084061 GCTGCTGTGTGCCTTGCCTGTGG - Intergenic
1186529945 X:10285302-10285324 GCTGCTCTGGAGCATGGGAGGGG + Intergenic
1190641907 X:52488220-52488242 GCTGCTATGGAACTGGCCTGAGG - Intergenic
1190645765 X:52524646-52524668 GCTGCTATGGAACTGGCCTGAGG + Intergenic
1191226937 X:58053959-58053981 GCTCCTCAGTACCATGGCTGTGG - Intergenic
1196584139 X:117409652-117409674 CCTGCTGTTGACTATGCCTGTGG - Intergenic
1196982613 X:121231807-121231829 CCTGCTCATGACCGTGCCTGTGG + Intergenic
1198134780 X:133738101-133738123 GGTGTTCTGGTGCATGCCTGTGG - Intronic
1200696057 Y:6361698-6361720 CCAGATCTGGACCCTGCCTGTGG + Intergenic
1201039220 Y:9813008-9813030 CCAGATCTGGACCCTGCCTGTGG - Intergenic