ID: 1139484045

View in Genome Browser
Species Human (GRCh38)
Location 16:67246383-67246405
Sequence TGCCTGCGGGGGGCTGACGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139484032_1139484045 8 Left 1139484032 16:67246352-67246374 CCTGGCCCGGAAACAGCGCGCCG 0: 1
1: 0
2: 1
3: 3
4: 51
Right 1139484045 16:67246383-67246405 TGCCTGCGGGGGGCTGACGGCGG 0: 1
1: 0
2: 0
3: 24
4: 199
1139484035_1139484045 2 Left 1139484035 16:67246358-67246380 CCGGAAACAGCGCGCCGGAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1139484045 16:67246383-67246405 TGCCTGCGGGGGGCTGACGGCGG 0: 1
1: 0
2: 0
3: 24
4: 199
1139484030_1139484045 16 Left 1139484030 16:67246344-67246366 CCCAGAGTCCTGGCCCGGAAACA 0: 1
1: 0
2: 2
3: 8
4: 128
Right 1139484045 16:67246383-67246405 TGCCTGCGGGGGGCTGACGGCGG 0: 1
1: 0
2: 0
3: 24
4: 199
1139484031_1139484045 15 Left 1139484031 16:67246345-67246367 CCAGAGTCCTGGCCCGGAAACAG 0: 1
1: 0
2: 0
3: 20
4: 127
Right 1139484045 16:67246383-67246405 TGCCTGCGGGGGGCTGACGGCGG 0: 1
1: 0
2: 0
3: 24
4: 199
1139484029_1139484045 19 Left 1139484029 16:67246341-67246363 CCTCCCAGAGTCCTGGCCCGGAA 0: 1
1: 0
2: 0
3: 22
4: 208
Right 1139484045 16:67246383-67246405 TGCCTGCGGGGGGCTGACGGCGG 0: 1
1: 0
2: 0
3: 24
4: 199
1139484034_1139484045 3 Left 1139484034 16:67246357-67246379 CCCGGAAACAGCGCGCCGGAAAG 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1139484045 16:67246383-67246405 TGCCTGCGGGGGGCTGACGGCGG 0: 1
1: 0
2: 0
3: 24
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139484045 Original CRISPR TGCCTGCGGGGGGCTGACGG CGG Intronic