ID: 1139484049

View in Genome Browser
Species Human (GRCh38)
Location 16:67246394-67246416
Sequence GGCTGACGGCGGCGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 247}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139484031_1139484049 26 Left 1139484031 16:67246345-67246367 CCAGAGTCCTGGCCCGGAAACAG 0: 1
1: 0
2: 0
3: 20
4: 127
Right 1139484049 16:67246394-67246416 GGCTGACGGCGGCGAGAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 247
1139484034_1139484049 14 Left 1139484034 16:67246357-67246379 CCCGGAAACAGCGCGCCGGAAAG 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1139484049 16:67246394-67246416 GGCTGACGGCGGCGAGAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 247
1139484029_1139484049 30 Left 1139484029 16:67246341-67246363 CCTCCCAGAGTCCTGGCCCGGAA 0: 1
1: 0
2: 0
3: 22
4: 208
Right 1139484049 16:67246394-67246416 GGCTGACGGCGGCGAGAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 247
1139484032_1139484049 19 Left 1139484032 16:67246352-67246374 CCTGGCCCGGAAACAGCGCGCCG 0: 1
1: 0
2: 1
3: 3
4: 51
Right 1139484049 16:67246394-67246416 GGCTGACGGCGGCGAGAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 247
1139484030_1139484049 27 Left 1139484030 16:67246344-67246366 CCCAGAGTCCTGGCCCGGAAACA 0: 1
1: 0
2: 2
3: 8
4: 128
Right 1139484049 16:67246394-67246416 GGCTGACGGCGGCGAGAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 247
1139484035_1139484049 13 Left 1139484035 16:67246358-67246380 CCGGAAACAGCGCGCCGGAAAGG 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1139484049 16:67246394-67246416 GGCTGACGGCGGCGAGAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 247
1139484041_1139484049 -1 Left 1139484041 16:67246372-67246394 CCGGAAAGGGCTGCCTGCGGGGG 0: 1
1: 0
2: 4
3: 21
4: 196
Right 1139484049 16:67246394-67246416 GGCTGACGGCGGCGAGAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139484049 Original CRISPR GGCTGACGGCGGCGAGAGGG AGG Intronic
900269147 1:1778347-1778369 GGCTGGCGGCGGCGCGGCGGCGG - Intronic
900996945 1:6127935-6127957 GGCTGGCTGCGGCGGGAGGGCGG + Intronic
901469952 1:9449356-9449378 GGGTGGCGGGGGCGGGAGGGGGG + Intergenic
904354627 1:29930984-29931006 GGCTGTAGGCAGCCAGAGGGTGG + Intergenic
906040347 1:42784357-42784379 GGGTGAGAGCAGCGAGAGGGAGG - Intronic
907526338 1:55056235-55056257 GGCGGAGGGCGGAGGGAGGGCGG + Intronic
910387862 1:86704716-86704738 GGATGAAGGCGGGGCGAGGGAGG - Intronic
912993282 1:114510333-114510355 GGGTGCCGGCTGCGAGAGGCTGG - Intronic
914704026 1:150157023-150157045 GGCTCACTGTGGGGAGAGGGAGG + Intronic
915107089 1:153541427-153541449 GGCAGAAGGCAGTGAGAGGGAGG - Exonic
915902110 1:159854782-159854804 GGCTGACTGCGCCGAGGGGCCGG - Exonic
918093663 1:181317617-181317639 GGCTGGGGGCGGCGGGCGGGGGG - Intergenic
923036399 1:230287839-230287861 GGGGGACGGCAGAGAGAGGGAGG + Intergenic
924448564 1:244157154-244157176 GGCTATCGGGGGCGGGAGGGAGG - Intergenic
1063146116 10:3296659-3296681 GTCTGAGGGCGCCGAGAAGGAGG - Intergenic
1067091291 10:43266873-43266895 GCCCGACTGCGGCGCGAGGGCGG - Intronic
1067438126 10:46292986-46293008 GGATGACGGAGAGGAGAGGGAGG + Intronic
1067832279 10:49617067-49617089 GGCTGGCTGGGGCGGGAGGGAGG - Intronic
1072248991 10:93567098-93567120 GGCTGACCGCGGCCAGCGTGAGG - Exonic
1076131412 10:128016578-128016600 GGCTGACGGCGGTGAGCAGAGGG + Intronic
1076824756 10:132961209-132961231 GGCGGACGGCGGAGGGAGGCAGG + Intergenic
1078561552 11:12377455-12377477 GGCAGAGGGCGGCGCGAGGGAGG + Exonic
1078579853 11:12530547-12530569 GGGTGCCGGAGGAGAGAGGGAGG - Exonic
1080520296 11:33062680-33062702 GGCTGCCAGGGGCCAGAGGGCGG - Intronic
1083609732 11:63999171-63999193 GCCTGGCGGTGGCGAGATGGGGG - Intronic
1083747633 11:64744634-64744656 GGCTGGGGGCGGCGAGCGGGTGG - Intronic
1084210440 11:67619117-67619139 GGCTGGCTGCGGCGAGTGCGGGG - Intergenic
1088530235 11:110800134-110800156 GGATGAAGGAGGCCAGAGGGTGG + Intergenic
1088597159 11:111449312-111449334 GGCTGGGGGCGGGGAGGGGGAGG - Intronic
1089311273 11:117559855-117559877 GGCTGGCTGGGGTGAGAGGGAGG + Intronic
1089347373 11:117799138-117799160 GGCTGAGGGCGGTGAGAGATGGG - Intronic
1090044225 11:123316869-123316891 GGAGGAAGGCGGGGAGAGGGAGG + Intergenic
1090056633 11:123430192-123430214 GGCTGGGGGCGGGGTGAGGGGGG - Intergenic
1091339723 11:134800937-134800959 GGCTGACAGCAGCGAGTGGGAGG + Intergenic
1091381815 12:66825-66847 GGCTGGCGGCGGGGAGCGCGAGG - Exonic
1091855340 12:3734857-3734879 GGCTGTAGGTGGCGAGAGAGGGG + Intronic
1095450527 12:42326172-42326194 GGATAACGGCGGCGAGCGGACGG + Exonic
1096784410 12:54009042-54009064 GGCGGCGGGCGGCGAGCGGGCGG - Intronic
1097173452 12:57129533-57129555 GGCTGTGGGTGGGGAGAGGGAGG + Intronic
1098254795 12:68606085-68606107 GGGAGACGGCGGCGGGGGGGGGG + Intergenic
1099228124 12:79993310-79993332 AGCCCACGGCGGGGAGAGGGGGG + Intergenic
1099989679 12:89709005-89709027 TGCGGACGGCGGCGTGAGGCCGG - Intronic
1102053621 12:109880431-109880453 CGCTGACGGCGGCGGCCGGGGGG - Exonic
1102543355 12:113638053-113638075 GGCGGCCGGCGGGGAGTGGGGGG - Intergenic
1103261634 12:119593820-119593842 GGCCGGCGGCGCCGGGAGGGCGG - Exonic
1103698553 12:122835668-122835690 GGCGGGCGGCGGCGGGCGGGCGG + Intronic
1113892185 13:113742315-113742337 GGCTCAGGGCTGCGAGAGGGTGG + Intergenic
1115346873 14:32352559-32352581 GGCTGAGGACAGAGAGAGGGAGG - Intronic
1115378257 14:32703173-32703195 GGAAGAAGGCGGGGAGAGGGGGG + Intronic
1115985809 14:39102986-39103008 GGCTGGCGGCGGCGGGCTGGGGG - Intronic
1121103268 14:91264460-91264482 GGTTGACGGCGGCGCCAGCGCGG - Intergenic
1122211213 14:100175290-100175312 GGCTGAGGGCCCCAAGAGGGAGG - Intergenic
1122221003 14:100239125-100239147 GGAGGAAGGCGGCGAGCGGGCGG - Exonic
1128497350 15:68206086-68206108 GGCTGAGGGTGGAGAGAGGAAGG - Intronic
1128522768 15:68386528-68386550 GGCTGAGGGCGATGAGAGTGAGG + Intronic
1132816001 16:1826864-1826886 GGCTGAGGGCAGCGCGAGGCGGG - Exonic
1133147823 16:3803251-3803273 GGCTGACGGCGGGGAGGGGGGGG + Intronic
1134449688 16:14355514-14355536 AGCTGACAGCGGTGAGATGGTGG - Intergenic
1134696988 16:16232538-16232560 GGCTGGCGGCGGCGGTGGGGCGG + Exonic
1135382830 16:22008443-22008465 GGCTGAGGGCGACGCGAGAGAGG + Intronic
1136384079 16:29911866-29911888 GGCTGGCGGGGGAGAGAGGATGG + Exonic
1138507695 16:57486380-57486402 GGCTGGCGGGGGCGGCAGGGCGG + Exonic
1139484049 16:67246394-67246416 GGCTGACGGCGGCGAGAGGGAGG + Intronic
1139754545 16:69132281-69132303 GGGGGAGGGCGGCGGGAGGGCGG - Intronic
1141910103 16:87053112-87053134 GGCTGGGGGCGGGGGGAGGGGGG - Intergenic
1142492480 17:287949-287971 GTCTGACGGTGGAGAGAGGGTGG - Intronic
1142763755 17:2055187-2055209 GGCTGACGGCGGATCCAGGGGGG - Intronic
1143019209 17:3907930-3907952 GGCTGAAGGTGCCGAGAGGGAGG - Intronic
1143590956 17:7885532-7885554 GCCGGACGGCGGCGTGGGGGAGG + Intronic
1144500957 17:15786476-15786498 GGCTGACGGCGGCGGGGGTTGGG + Intergenic
1144598166 17:16589106-16589128 CGCTGACGGCGGGAAGGGGGTGG - Intergenic
1144692955 17:17280894-17280916 GGCTCCCGGCGGCCCGAGGGAGG + Intronic
1145041280 17:19579892-19579914 GGCTGGCGGCGGCGCGGGCGCGG - Intergenic
1146187202 17:30731770-30731792 GGCTGACCGAGGGGAGAAGGAGG - Intergenic
1147172440 17:38630222-38630244 GGGAGACGGTGGGGAGAGGGAGG - Intergenic
1147774330 17:42889939-42889961 GGCGGGCGGCGGGGAGGGGGCGG + Intergenic
1150291883 17:63987134-63987156 GGCTGCTGGAGGAGAGAGGGGGG - Intergenic
1150561885 17:66302204-66302226 GGCGGAGGAGGGCGAGAGGGAGG + Intergenic
1152049111 17:77958848-77958870 CGGTGACGGCGGCGGGAGCGCGG - Intergenic
1152247286 17:79191632-79191654 GGCGGCCGGCGGCGGGAGGTAGG + Intronic
1152891555 17:82884449-82884471 GGGTGATGGAGGCGAGTGGGAGG + Intronic
1156228059 18:35128783-35128805 GGCAGACGGGGAAGAGAGGGAGG - Intronic
1158509757 18:58080030-58080052 GGCTGAGGGAGGTGAGAGGATGG - Intronic
1158953997 18:62523097-62523119 CGCGGACGGCGGAGAGAGGGAGG + Exonic
1159770717 18:72543258-72543280 GGCTGTGGGCGGCGAGGGGGCGG - Intronic
1160653381 19:246356-246378 GGCTGAGGGCACCGCGAGGGCGG - Intergenic
1160682562 19:418427-418449 GGCTCACGGCGGCCAAAAGGCGG + Intronic
1161112046 19:2475985-2476007 GGCCGACGGAGGGGAGGGGGAGG - Intergenic
1161313273 19:3606641-3606663 GGCTGGGGGCGGGCAGAGGGAGG + Exonic
1161791820 19:6364552-6364574 GGGTGCCGGCGGCGAGAAGCAGG - Exonic
1162034439 19:7931635-7931657 TGCTGGGGGCAGCGAGAGGGAGG + Intronic
1162174939 19:8823593-8823615 GGCTGACTGAGGCAGGAGGGGGG - Intronic
1162515569 19:11145378-11145400 GCCTGAGGGAGGAGAGAGGGAGG - Intronic
1162718411 19:12647893-12647915 GCCTGGGGGCGGTGAGAGGGCGG + Intronic
1163427131 19:17245857-17245879 CGGTGGCGGCGGCGAGAGCGAGG - Exonic
1163477011 19:17532426-17532448 GGCTGACGGGGGTGGGAAGGAGG - Intronic
1163696350 19:18765497-18765519 GGGTGACAGCGGGGACAGGGTGG - Exonic
1164069205 19:21750780-21750802 TGCTGAGGGCGGCGAGTAGGGGG + Intronic
1164895709 19:31875731-31875753 CGCTGACGACGGCGACAGGGAGG + Intergenic
1165923911 19:39315289-39315311 AGCGGGCGGCGGCGAGAGGAGGG + Exonic
1166043935 19:40218453-40218475 GGCTGCCGGAGGTGAGGGGGCGG - Intergenic
1166231431 19:41427468-41427490 GGCTGAGGCAGGAGAGAGGGAGG + Exonic
1167103789 19:47419214-47419236 CGCTGACGGCGGCGGGGGTGGGG - Exonic
1167436269 19:49480497-49480519 GGGTGAGGGGGCCGAGAGGGTGG + Intronic
1167578248 19:50328027-50328049 GGGGGATGGCTGCGAGAGGGGGG + Intronic
926313044 2:11688288-11688310 GGGTGACTGTGGGGAGAGGGAGG - Intronic
928927929 2:36597737-36597759 GGAGGAAGGAGGCGAGAGGGCGG + Intronic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
931881868 2:66577097-66577119 AGCTGATGGCTGGGAGAGGGAGG + Intergenic
932042986 2:68319541-68319563 GGCGGACGGCGGCGACGGCGCGG - Exonic
932184870 2:69685833-69685855 GGTTGGGGGCGGAGAGAGGGAGG + Intronic
935046642 2:99489532-99489554 GGCTGGCGGCGGCGCGGGGCCGG + Intronic
937261168 2:120587456-120587478 GGCTGGCGGCGGCGAAGTGGCGG - Intergenic
941819175 2:169827708-169827730 GGCTGCCGGCGGCGAGGACGCGG + Exonic
944154183 2:196593399-196593421 GGCAGGGAGCGGCGAGAGGGTGG - Intronic
944715975 2:202376436-202376458 GGCGGGGGGCGGCGGGAGGGCGG - Intergenic
944831204 2:203535300-203535322 GGCGGGCGGCGGCGGGAGCGGGG + Exonic
947377735 2:229513888-229513910 GGCTGAGGACAGGGAGAGGGAGG - Intronic
948861627 2:240755337-240755359 GGCTGAGTGTGGCGGGAGGGAGG + Intronic
948903365 2:240966945-240966967 GGCTGGCAGCGGTGGGAGGGTGG - Intronic
948993170 2:241564763-241564785 GGCCGACGCCGGCGCGTGGGTGG + Intronic
949032861 2:241805242-241805264 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949032941 2:241805437-241805459 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949032958 2:241805476-241805498 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949032975 2:241805515-241805537 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033006 2:241805589-241805611 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033022 2:241805628-241805650 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033053 2:241805702-241805724 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033099 2:241805815-241805837 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033115 2:241805854-241805876 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033131 2:241805893-241805915 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033221 2:241806113-241806135 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033329 2:241806375-241806397 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033361 2:241806452-241806474 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033377 2:241806491-241806513 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033454 2:241806678-241806700 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033500 2:241806791-241806813 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033608 2:241807056-241807078 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033624 2:241807095-241807117 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033671 2:241807212-241807234 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033761 2:241807446-241807468 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033793 2:241807523-241807545 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033844 2:241807648-241807670 GGCTGAGGGGGGAGGGAGGGAGG - Intergenic
949033861 2:241807687-241807709 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033908 2:241807804-241807826 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033925 2:241807843-241807865 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033960 2:241807929-241807951 GGCTGAGGGGGGAGGGAGGGAGG - Intergenic
949033977 2:241807968-241807990 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949034025 2:241808093-241808115 GGCTGAGGGGGGAGGGAGGGAGG - Intergenic
1172099683 20:32477732-32477754 GGCTGGCAGCGGCAGGAGGGAGG - Intronic
1172104346 20:32507318-32507340 GGCTGGAGGTGCCGAGAGGGTGG + Intronic
1172107866 20:32527518-32527540 GGTTGAAGGGGGTGAGAGGGAGG - Intronic
1173593826 20:44246197-44246219 GGCGGTCGGGGGTGAGAGGGAGG + Intergenic
1175385582 20:58592934-58592956 GGCTCACGGCTGCCAGAGTGAGG - Intergenic
1175828827 20:61951112-61951134 GGCTGGGGGAGGGGAGAGGGTGG - Intergenic
1175828846 20:61951147-61951169 GGCTGGGGGAGGGGAGAGGGTGG - Intergenic
1175870380 20:62206526-62206548 GGCTGAGGAGGGCGGGAGGGTGG + Intergenic
1176242227 20:64080367-64080389 GGCTCACGGAGGCGAGGGGTGGG - Intronic
1176412377 21:6455956-6455978 CGCTGAGGGCGGGCAGAGGGAGG + Intergenic
1176548801 21:8212910-8212932 GGGTGGCGGGGGGGAGAGGGGGG + Intergenic
1176556696 21:8257119-8257141 GGGTGGCGGGGGGGAGAGGGGGG + Intergenic
1176567732 21:8395945-8395967 GGGTGGCGGGGGGGAGAGGGGGG + Intergenic
1176575635 21:8440161-8440183 GGGTGGCGGGGGGGAGAGGGGGG + Intergenic
1178504575 21:33152396-33152418 GGCTGGAGGAGGCGAGCGGGGGG - Intergenic
1179687871 21:43064278-43064300 CGCTGAGGGCGGGCAGAGGGAGG + Intronic
1179810184 21:43865180-43865202 GGCGGAGGGCGGCGGGATGGGGG + Intronic
1180065828 21:45411750-45411772 GGCTGATGGCGGGGGGTGGGGGG + Intronic
1180085623 21:45506818-45506840 GGGGGCCGGTGGCGAGAGGGAGG - Intronic
1180186912 21:46144677-46144699 GGCAGATGGCGGAGAGAGAGAGG - Intronic
1180682868 22:17640743-17640765 GGAAGACTGAGGCGAGAGGGAGG + Intronic
1180908364 22:19431572-19431594 GGCGGGCGGCGGCCGGAGGGCGG - Exonic
1182445469 22:30387166-30387188 GGCGGACGGCAGCGAGCCGGCGG - Exonic
1183067293 22:35371932-35371954 GGCTGGGCGCGGCGAGCGGGTGG - Intergenic
1183201409 22:36387754-36387776 GGCAGGCGGCGGCGGGCGGGCGG - Intronic
1183280719 22:36930634-36930656 AGCTGAGGGCAGGGAGAGGGAGG - Intronic
1183613515 22:38927307-38927329 GGCTGCCGGGGGCGGGGGGGGGG + Intergenic
1183856407 22:40637617-40637639 GGCTGAGGGCGGGGAGCGGGTGG + Intergenic
1184276465 22:43411899-43411921 GGCGGGCGGCGGCGGGCGGGGGG + Intronic
1184751314 22:46488051-46488073 AGCTGACAGGGGCGTGAGGGAGG + Intronic
1184794363 22:46722978-46723000 GGCGAGCGGCTGCGAGAGGGTGG + Intronic
1184850320 22:47116060-47116082 GGGGGCCGGCGGGGAGAGGGCGG - Intronic
1185321946 22:50205477-50205499 GGCAGGCTGAGGCGAGAGGGTGG + Intronic
1203253686 22_KI270733v1_random:129215-129237 GGGTGGCGGGGGGGAGAGGGGGG + Intergenic
1203261742 22_KI270733v1_random:174294-174316 GGGTGGCGGGGGGGAGAGGGGGG + Intergenic
951108210 3:18770288-18770310 GGCTGAGGGTGGCGGGCGGGGGG + Intergenic
951485361 3:23203507-23203529 GGAGGACGTCAGCGAGAGGGAGG - Intronic
953569164 3:44057740-44057762 GGCTGATGACCTCGAGAGGGAGG - Intergenic
954256647 3:49411980-49412002 GGCGGGCGGCGGCGGGAGGGCGG + Exonic
954391646 3:50270789-50270811 GGCTGATGCCGAAGAGAGGGAGG + Intronic
954583319 3:51715259-51715281 GGCTCACTGCAGCGAGAGGCGGG - Exonic
954912680 3:54122370-54122392 GGCGGGCCGCGGCGGGAGGGCGG - Intergenic
956761298 3:72447203-72447225 GGCGGCCGGCGCCGCGAGGGCGG + Intergenic
961236804 3:125374843-125374865 GGGTGGCGGAGGCGAGAAGGCGG - Intronic
963236730 3:142963641-142963663 GGCTGACTGCGGCGGCAGCGCGG + Exonic
965590663 3:170357774-170357796 GGCTTACGGCGGCGACGCGGCGG + Intronic
968230583 3:197002877-197002899 TGCTGGCGGCGGCGGGAGGGAGG - Exonic
968471825 4:786091-786113 GGCTGCGGGCGGGGCGAGGGCGG - Exonic
969461404 4:7331095-7331117 GGCTAGGGGCGGCGAGAGGCTGG + Intronic
973663956 4:53138871-53138893 GGGAGACGGAGACGAGAGGGAGG - Intronic
976873829 4:89830255-89830277 GGCTGACAACGGTAAGAGGGAGG + Intronic
979715489 4:123832357-123832379 GGCGGAGGGGGGGGAGAGGGGGG + Intergenic
979754975 4:124328916-124328938 GGCTGAAGGTGGAGAGGGGGTGG + Intergenic
983533290 4:168832634-168832656 GGCAGCTGGCGGGGAGAGGGTGG + Intronic
983537873 4:168877824-168877846 GGCGGGCGGCGGCGGGAAGGGGG - Intronic
984910627 4:184671277-184671299 GGCTGACGGCTGTGAGAGCCAGG + Intronic
985719106 5:1480130-1480152 GGCTGTCGGAGGCGTGAGTGTGG - Intronic
985724196 5:1507092-1507114 GGCTGAATGCGGAGAGGGGGAGG + Intronic
987658197 5:20836434-20836456 GGGTGGTGGCGGGGAGAGGGAGG - Intergenic
988765487 5:34369501-34369523 GGGTGGTGGCGGGGAGAGGGAGG + Intergenic
990210890 5:53480646-53480668 GGCGGCCGGCGGCGAGCGCGGGG + Exonic
991351256 5:65722338-65722360 GGCTGGCGGCGGCGGGCGCGTGG - Exonic
992231587 5:74669705-74669727 GGCTGGCAGAGGAGAGAGGGAGG + Intronic
997614236 5:135235715-135235737 GGCTGAGGGAGGGCAGAGGGAGG + Intronic
1001265080 5:170268400-170268422 GGCTGGTGGGGGCGGGAGGGCGG + Exonic
1002636547 5:180611619-180611641 GGCTGAGGGCAGGGCGAGGGCGG - Intronic
1008545259 6:52577508-52577530 GGCTGAGGGCGGCGCGGGTGCGG + Intergenic
1011642107 6:89425404-89425426 GGATGAAGGAGGTGAGAGGGAGG - Intergenic
1016386844 6:143537310-143537332 GGCTGGCGGCGGGGTGGGGGTGG + Intronic
1016434151 6:144018371-144018393 GGCTGGCGGGGGTGAGAGGATGG + Intronic
1017726545 6:157280322-157280344 GGCTGAGGGAGGAGAAAGGGCGG + Intergenic
1018228764 6:161655498-161655520 TGCTGACGGAGGTGAGAGGCTGG - Intronic
1018876653 6:167827296-167827318 GGCGGGCGGCGGCGGGGGGGAGG - Intronic
1019587752 7:1814237-1814259 GGCTGCTGGCGGTGAAAGGGTGG + Intergenic
1022410376 7:30135102-30135124 GGCGGGCGGCGGCGGGAGGCGGG + Exonic
1023838545 7:44082514-44082536 GGCTGACGGAAGCGGGTGGGCGG + Intronic
1024639357 7:51316841-51316863 GGCTGGCGGCGGCGCGGGGCGGG + Intergenic
1025829384 7:65036684-65036706 GGCTTACCCCGGGGAGAGGGAGG - Intergenic
1029646089 7:101856980-101857002 GGCTGAAGGATGGGAGAGGGAGG - Intronic
1032494690 7:132352268-132352290 GGCACACGTAGGCGAGAGGGGGG - Intronic
1034901320 7:154909683-154909705 GGAGGACGGAGGAGAGAGGGAGG + Intergenic
1035385319 7:158468479-158468501 AGCTGAGGGCGGCGAGGGGCGGG - Intronic
1035512904 8:206090-206112 GGCTGAGGGCACCGCGAGGGCGG - Intergenic
1036676020 8:10833780-10833802 GGCTGCGGGAGGCAAGAGGGCGG + Intronic
1038266770 8:26044237-26044259 GGAGGCCGGCGGCCAGAGGGTGG - Intronic
1045063665 8:98427607-98427629 GCCTGTCTGCGGCGAGCGGGCGG + Intronic
1045488745 8:102654531-102654553 GGCTGCCGGCGGGAGGAGGGCGG - Intronic
1045661791 8:104445637-104445659 GGATGGCGGTGGGGAGAGGGGGG + Intronic
1048944170 8:139429057-139429079 GGCTGATGGGGGAGGGAGGGAGG - Intergenic
1049354818 8:142182442-142182464 GGCTGTGGACGGTGAGAGGGAGG + Intergenic
1049363427 8:142225108-142225130 GGCTGACAGCAGGGAGAGGTTGG - Intronic
1049418302 8:142505493-142505515 GGCTGAGGGCGACGTGAGGTGGG + Intronic
1050618969 9:7433240-7433262 GGCTGTCGGGGGCAAGACGGTGG + Intergenic
1053139873 9:35675828-35675850 GGCAGAAGGCGGCGAGCTGGGGG - Exonic
1056992357 9:91423747-91423769 GGCGGGCGGCGGCGAGGGCGCGG + Exonic
1058888818 9:109343555-109343577 GGCCTACGGGGGCTAGAGGGTGG - Intergenic
1059191812 9:112333761-112333783 GGCTGCCAGCGGGGCGAGGGTGG - Intergenic
1060139899 9:121201273-121201295 GGGGAACAGCGGCGAGAGGGGGG + Intronic
1060700985 9:125748170-125748192 GGCCGACTGCGGCCAGCGGGAGG - Intronic
1060823090 9:126672656-126672678 GCCTGAATGGGGCGAGAGGGAGG - Intronic
1060977099 9:127771235-127771257 GGTTGCCGGCGGCGACAGCGGGG - Intronic
1061643584 9:131980204-131980226 GGGTGGCGGGGGGGAGAGGGAGG + Intronic
1061852353 9:133423665-133423687 GGCTGATGGGGGCCAGAGGCAGG + Intronic
1061870378 9:133517169-133517191 GGCAGAAGGAGGCGAGAGGCGGG + Intronic
1061961533 9:133991528-133991550 GGCGGAGGCCGGCGAGGGGGCGG + Intronic
1062472458 9:136712494-136712516 GGCCGACGGCGGCGCGGCGGGGG - Intergenic
1203470086 Un_GL000220v1:112363-112385 GGGTGGCGGGGGGGAGAGGGGGG + Intergenic
1203477907 Un_GL000220v1:156335-156357 GGGTGGCGGGGGGGAGAGGGGGG + Intergenic
1186410757 X:9342761-9342783 GGCGGCCGGCGGCGTGGGGGCGG - Intergenic
1190862717 X:54359002-54359024 GCCTGGCGGCGGCGAGGGGGCGG - Intergenic
1192033990 X:67544450-67544472 GGCCGACGGGGGCGGGGGGGCGG - Intronic
1195716980 X:107826804-107826826 GGCTGCCGGCTGCGGGAGCGTGG - Intronic
1197195916 X:123700510-123700532 GGCTGGGGGCGGCGGGGGGGAGG + Intronic
1198517842 X:137427146-137427168 GGCCGACGCCGACGGGAGGGAGG - Intergenic