ID: 1139484926

View in Genome Browser
Species Human (GRCh38)
Location 16:67249996-67250018
Sequence CACAACAGGGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 759
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 696}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139484926_1139484935 -6 Left 1139484926 16:67249996-67250018 CCCTCCTCCTTCTCCCTGTTGTG 0: 1
1: 0
2: 3
3: 59
4: 696
Right 1139484935 16:67250013-67250035 GTTGTGCTGGCTCTGCTGTGGGG 0: 1
1: 0
2: 1
3: 24
4: 276
1139484926_1139484934 -7 Left 1139484926 16:67249996-67250018 CCCTCCTCCTTCTCCCTGTTGTG 0: 1
1: 0
2: 3
3: 59
4: 696
Right 1139484934 16:67250012-67250034 TGTTGTGCTGGCTCTGCTGTGGG 0: 1
1: 0
2: 0
3: 20
4: 344
1139484926_1139484936 -5 Left 1139484926 16:67249996-67250018 CCCTCCTCCTTCTCCCTGTTGTG 0: 1
1: 0
2: 3
3: 59
4: 696
Right 1139484936 16:67250014-67250036 TTGTGCTGGCTCTGCTGTGGGGG 0: 1
1: 0
2: 2
3: 29
4: 259
1139484926_1139484933 -8 Left 1139484926 16:67249996-67250018 CCCTCCTCCTTCTCCCTGTTGTG 0: 1
1: 0
2: 3
3: 59
4: 696
Right 1139484933 16:67250011-67250033 CTGTTGTGCTGGCTCTGCTGTGG 0: 1
1: 0
2: 5
3: 112
4: 699

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139484926 Original CRISPR CACAACAGGGAGAAGGAGGA GGG (reversed) Intronic
900526521 1:3131864-3131886 CCCAGGAGGGAGGAGGAGGAAGG - Intronic
900553657 1:3269218-3269240 GACAGCTGGGAGGAGGAGGACGG + Intronic
900799770 1:4729973-4729995 CACAATGGGGAGTAGAAGGAAGG - Intronic
900966230 1:5960632-5960654 CATGACAGGTAGAAGGAGGCTGG + Intronic
900966276 1:5960916-5960938 CACAGCAGCCAGAAGGCGGAAGG + Intronic
900967326 1:5967768-5967790 CACAACAGGGCCAGGGAGCAGGG + Intronic
900987258 1:6080366-6080388 CACATCCGGGAGGAGGAGGCTGG + Intronic
901198983 1:7456140-7456162 CATAACAGAGGGATGGAGGAAGG + Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902179907 1:14679974-14679996 GACAAGAGGGAGAAGGTGGCTGG + Intronic
902762284 1:18590028-18590050 CACCAGGAGGAGAAGGAGGAGGG - Intergenic
903222738 1:21878117-21878139 CACAGCTGGGAGGAGGAAGAAGG - Intronic
903774905 1:25786774-25786796 GACAAAAGTGAAAAGGAGGATGG - Intergenic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904428525 1:30447070-30447092 GACATCAGGGAACAGGAGGAGGG + Intergenic
904698110 1:32341852-32341874 CACAACCAGGGGAAGGGGGAGGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904990704 1:34590387-34590409 CACTTCAGGGAAAAGGAAGAAGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905220273 1:36441361-36441383 CACCACAGGCACAAAGAGGAAGG + Intronic
905388987 1:37624294-37624316 CATAACAGGCAGCAGCAGGAGGG - Intronic
905675861 1:39824616-39824638 CACAACAGTGAGTAGGAGGAAGG + Intergenic
905715738 1:40148171-40148193 CAAAACAGAAAGAAGGAGGAGGG - Intergenic
905825769 1:41025004-41025026 CACATCAGGGAGAAGGGGGTTGG - Intergenic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
908607720 1:65818399-65818421 GACAATAGGAAGAAGGAGGATGG - Intronic
908800172 1:67871900-67871922 TCCAACTGTGAGAAGGAGGAGGG - Intergenic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
910240926 1:85085412-85085434 CTGAACAGGGATATGGAGGAAGG + Intronic
910353273 1:86324331-86324353 CACAAGGCGGAGAAGGAGGTGGG + Intergenic
911675294 1:100651907-100651929 CACCACAGAAAGAAAGAGGATGG - Intergenic
912314459 1:108654402-108654424 CTCTAAAGGGAGATGGAGGAGGG + Intronic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
913144780 1:115977825-115977847 CTCAACAGGAAGATGGGGGAAGG + Intronic
914434303 1:147646711-147646733 CTCAGCAGGAAGAAGCAGGAAGG - Exonic
914510852 1:148330595-148330617 CCCAGCAGGGAGGAGCAGGAAGG - Intergenic
914739056 1:150447965-150447987 CAAAACTGGGAGAAGGAGAAAGG - Intronic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915328901 1:155097066-155097088 GACAACAGGCAGAATGGGGAGGG - Intergenic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
917123794 1:171668014-171668036 CACGACTGGAAGAAGGAGGAAGG + Intergenic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918054993 1:181013313-181013335 CACAACAGGAAAAAGGATGATGG - Intronic
918128690 1:181606369-181606391 AACAAGAGGGTGAAGGAGTAGGG - Intronic
919074594 1:192798047-192798069 AACAAGAGGGAGAGGGAGGGAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920017406 1:202924412-202924434 TACCAGAGGGATAAGGAGGAAGG - Intronic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920300023 1:204982901-204982923 CCTAACAGTGAGATGGAGGAAGG + Intronic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
921591901 1:217013863-217013885 CACACCAGAGTGAATGAGGAGGG + Intronic
921889434 1:220339079-220339101 CAAACCAGGAAGGAGGAGGATGG - Intergenic
922800787 1:228363941-228363963 CCAAACAAGGAGAAGGAGAAGGG - Intronic
923192283 1:231630857-231630879 CACACCAAGTAGAAGCAGGAAGG + Intronic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
924051140 1:240080506-240080528 CACAACTGTAAGCAGGAGGATGG - Intronic
924260978 1:242231230-242231252 CTCAACAGGGAGGAGGAAGAGGG - Intronic
924517507 1:244779094-244779116 CACAGCAGGAAGATGGAGGGTGG + Intergenic
1064229830 10:13520336-13520358 CACCACAGGGAGAAGGAATGGGG - Intronic
1064409959 10:15096763-15096785 GATAAAAGGGAGAAGGAGTATGG - Exonic
1064995151 10:21290253-21290275 CCCAACATTGAGATGGAGGATGG - Intergenic
1065233899 10:23626806-23626828 CGCAACAGGGAGAGAGTGGATGG + Intergenic
1065321864 10:24517564-24517586 AACAAAAAGGAGAACGAGGAGGG - Intronic
1066390653 10:34975250-34975272 CTCAAAGGGGAGAATGAGGAGGG + Intergenic
1066435266 10:35391803-35391825 GATAACAGGAAGAGGGAGGAGGG - Intronic
1066698385 10:38099536-38099558 CACAACAGTTAAAAGGAGGAAGG - Intronic
1066994129 10:42547610-42547632 CACAACAGTTAAAAGGAGGAAGG + Intergenic
1067469704 10:46527614-46527636 GGCAGCAGGGAGGAGGAGGATGG + Intergenic
1067734709 10:48840586-48840608 CACACCAGTGAGAAGGAAGCGGG + Intronic
1067971241 10:50973448-50973470 TGCAACAGAGAGAAGGAGAAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070381112 10:75881332-75881354 CACAATAGGGATAATGAGGCAGG + Intronic
1070543834 10:77437279-77437301 CAAGACAGGGAGAAAAAGGAAGG + Intronic
1070711312 10:78685278-78685300 TCCAACAGGGAGAAGGTAGAGGG - Intergenic
1070825149 10:79386457-79386479 CTCTGCAGAGAGAAGGAGGAAGG + Exonic
1070841372 10:79490314-79490336 CACAAGATGGAGAAAGGGGAAGG + Intergenic
1073339632 10:102735182-102735204 AGCAACATGGAGAGGGAGGAAGG - Intronic
1074064040 10:109996492-109996514 CAAAAATGGGGGAAGGAGGAAGG + Intronic
1074512432 10:114127954-114127976 CAAAGCAGAGAGGAGGAGGAAGG + Intronic
1074852489 10:117449847-117449869 CTAAACAGGAAAAAGGAGGAAGG + Intergenic
1075514524 10:123098406-123098428 CACAACAGGGAAAAGGACTGAGG + Intergenic
1075798471 10:125137197-125137219 GACAACAGGAAGAAGGATGCAGG + Intronic
1076348327 10:129796140-129796162 TACAACAGGGAGACTGAGGCTGG + Intergenic
1076506803 10:130983312-130983334 CACAAATGCGAGAAGGAGAAGGG - Intergenic
1076754008 10:132558630-132558652 AGCTCCAGGGAGAAGGAGGAAGG - Intronic
1077271963 11:1685596-1685618 CACTCCTGGGAGCAGGAGGAGGG - Intergenic
1077557245 11:3231597-3231619 AACAGGAGGGAGGAGGAGGAGGG + Intronic
1077702676 11:4456289-4456311 CACAACAGGGAAAAGATGAAGGG + Intergenic
1077921861 11:6647340-6647362 CAGAGCTGGAAGAAGGAGGAGGG + Intronic
1078487235 11:11734973-11734995 TTCAACAGGGAGAAGGGAGATGG + Intergenic
1078646746 11:13147824-13147846 AGCAAGAGAGAGAAGGAGGAAGG + Intergenic
1078827292 11:14941336-14941358 AACAAGAGGGTGGAGGAGGATGG - Intronic
1078971575 11:16418685-16418707 AACAACAGGGAGTGGGAGGGGGG + Intronic
1079303080 11:19296749-19296771 GACAAAGAGGAGAAGGAGGATGG + Intergenic
1079454692 11:20626384-20626406 GACCACAGAGAGAAGGAGGGAGG - Intronic
1080858765 11:36135039-36135061 TACAACAGTGAGGAAGAGGAGGG - Intronic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1081710414 11:45212413-45212435 TACAAAAGGGAGAAGGAGGGAGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083253680 11:61483632-61483654 TACAACAGGGAGAAGCAGGGAGG + Intronic
1083477130 11:62921837-62921859 CACAGCAGGGAGGAAGAGCAGGG - Intergenic
1083796725 11:65021270-65021292 CACCACAGTGAGAAAGAGCAGGG + Intronic
1083894235 11:65612152-65612174 CACAGCAGGGACCAGGAGCAGGG - Intronic
1084190421 11:67496139-67496161 GATAAAGGGGAGAAGGAGGAGGG - Intronic
1084551919 11:69849169-69849191 CACAACAGGAAGTAGAAGGTGGG + Intergenic
1084864689 11:72046108-72046130 CACAGGAGGGAGGAAGAGGAGGG - Intronic
1085018092 11:73188455-73188477 CCCAACAGGGATAGGGAGGGGGG - Intergenic
1085256609 11:75177116-75177138 CACCATAGGGAGGAGGAGGAGGG + Intronic
1085284780 11:75352341-75352363 CACAACAGGGACAGGAAGAAGGG + Intergenic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1085458798 11:76680895-76680917 CCCAGCAGGGAGAGGGAGGAGGG - Intergenic
1085769730 11:79313993-79314015 CTCAACAGGGAGATGAATGACGG - Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086167150 11:83791854-83791876 CACAAGCTGGAGGAGGAGGAAGG - Intronic
1086168250 11:83805574-83805596 GACAAAAGGGAGAGGGAGGATGG - Intronic
1086213409 11:84348651-84348673 CACAACAGGTACTAGGAGGTAGG - Intronic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1087199732 11:95333291-95333313 CACACCAGGGATAAGGAAGGGGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088715163 11:112542721-112542743 CCCACCAGGAAGAGGGAGGAAGG + Intergenic
1089159193 11:116424495-116424517 CACAGCAGGGAGACGGGGCAGGG + Intergenic
1089654678 11:119938442-119938464 CCCAACATGGAGAGGGAGGGAGG - Intergenic
1089684495 11:120138141-120138163 CACACCTGTGAGGAGGAGGAGGG + Exonic
1090083942 11:123634259-123634281 CACAAGATGGGGAAGGAGCAGGG + Intronic
1090357805 11:126151580-126151602 GACCACAGGTAGAGGGAGGAAGG + Intergenic
1091079880 11:132656466-132656488 TTAAAAAGGGAGAAGGAGGAAGG - Intronic
1091562147 12:1622998-1623020 CACAGCGGGGAGAAACAGGATGG + Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1091826301 12:3515302-3515324 CACACCAGTGAGCAGGTGGAGGG - Intronic
1091900632 12:4141282-4141304 CCCACCAGGAAGCAGGAGGATGG - Intergenic
1091991265 12:4957868-4957890 AACTACAGGGAGAAAGAGAAGGG - Intergenic
1092061100 12:5551240-5551262 GACAACCGTGAGAAGGAGGCAGG + Intronic
1092158136 12:6298236-6298258 CAAAACAGTGAAAAGGAGGCCGG + Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092417090 12:8298521-8298543 CTCAACAGGCTGAAGCAGGAGGG - Intergenic
1092722189 12:11452168-11452190 CTCAACAGGGAGCAGGAAAAAGG - Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1092826452 12:12404417-12404439 CTCAACTGGCAGAAGGAGAATGG + Intronic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093170911 12:15859376-15859398 CACAAGAGAGAGAAGAAGCACGG + Intronic
1094334386 12:29332029-29332051 CACAACATGGGGGAGGAGTAGGG - Intronic
1094500913 12:31020178-31020200 CACAACAGGAGAAAGGAGGTCGG + Intergenic
1094656012 12:32419926-32419948 CACTGCTGGGAGAAGGGGGAGGG + Intronic
1095372164 12:41481463-41481485 AAAAACAGGGAGAGGGAGTAAGG - Intronic
1096160342 12:49371474-49371496 CACAACAGCCAAAAGGTGGAAGG - Intronic
1096380505 12:51153799-51153821 CACAACAGCCAAAAGGTGGAAGG - Intronic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096586845 12:52628392-52628414 CACAAAAGGGAGGAGGAGAGAGG - Intergenic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1096883773 12:54696578-54696600 CGCAACAAGGAGAAGAAAGAGGG - Intergenic
1097145514 12:56936903-56936925 AACAAGAGGGAGGAGGAGGCAGG - Intergenic
1097265868 12:57744638-57744660 CAGAACAGGGGGAAGGGGGTGGG + Intronic
1097894438 12:64810253-64810275 GAAAACATGGAGAAGGAGAATGG - Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098236408 12:68422498-68422520 ATCATCAGGGAGAAGGGGGAAGG - Intergenic
1098390917 12:69969098-69969120 CACAAAAGAGAAAAGGAGAATGG - Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1101384198 12:104241785-104241807 CCCAACAGGGAGGCTGAGGAAGG - Intronic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1102318645 12:111911805-111911827 CACAAGAGGCTGAAGTAGGAGGG - Intergenic
1102529152 12:113533250-113533272 CACAGCCGGGAGATGGAGGAAGG - Intergenic
1102531262 12:113548097-113548119 TTCAAAAGGGAGAAGGAGCATGG - Intergenic
1102624042 12:114220324-114220346 AACAAGAGGGAGCAGGAAGATGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG + Exonic
1104062198 12:125277978-125278000 CACAACTGGGAGAAGCAGGCTGG - Intronic
1104103705 12:125639504-125639526 GACAGCAGGGAAAAGGAGAAAGG + Intronic
1105780939 13:23704859-23704881 AAAAACAGGAAGAAGAAGGAAGG - Intergenic
1105863165 13:24434949-24434971 CACAATAGGGTGAAGAAGGTGGG + Exonic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1107196540 13:37659311-37659333 CATCACAGGGGGAAAGAGGAAGG - Intronic
1107999432 13:45892731-45892753 AGCAACAGGAGGAAGGAGGAGGG + Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108431292 13:50356643-50356665 CACAACAGGCATCAGGAGGAAGG + Intronic
1109443150 13:62400449-62400471 GACTAGAGGGATAAGGAGGAGGG - Intergenic
1112182732 13:97100918-97100940 AACTACAGGGAGAAAAAGGAGGG - Intergenic
1112806406 13:103167795-103167817 CACAGCAGGGAGGAGAAGGGCGG + Intergenic
1112926416 13:104680263-104680285 CACCCCAGGAAGAAGGATGAAGG - Intergenic
1113439860 13:110319890-110319912 TACAACAGGAAGGAGGAGGCCGG - Intronic
1113508814 13:110835183-110835205 CACCATAGGGAGAAGTGGGATGG - Intergenic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1113841467 13:113363914-113363936 CAAAACCGAGAGAAGGAGGCCGG + Intronic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115762247 14:36586291-36586313 CACAACAGTGATAAAGAGGGGGG - Intergenic
1116085010 14:40224409-40224431 CAAAAAGGGGTGAAGGAGGAAGG + Intergenic
1116479938 14:45385468-45385490 CATACCCGGAAGAAGGAGGAAGG + Intergenic
1117579580 14:57138704-57138726 CAAATGAGGGGGAAGGAGGATGG + Intergenic
1118707199 14:68491236-68491258 CACAACAGAAAGGAGGAGGAAGG - Intronic
1118866830 14:69711021-69711043 TCCCACAGGGAGAGGGAGGAAGG - Exonic
1119199540 14:72742464-72742486 AAGAACGGGGAGATGGAGGAAGG - Intronic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1119432036 14:74574848-74574870 CTCAAATGGGAGAAGGGGGAAGG + Intronic
1119885739 14:78139870-78139892 CCCAGCAGAAAGAAGGAGGAAGG + Intergenic
1120393423 14:83937553-83937575 AAGAACTCGGAGAAGGAGGATGG - Intergenic
1121066212 14:90968299-90968321 CACAATAGGAAGAGGGAGGGAGG - Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1122076944 14:99242064-99242086 GACATCAGGGAGAGGGAGCAGGG + Intronic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1124083561 15:26524085-26524107 AACAACAGGAAAAAGGAAGAGGG - Intergenic
1125825315 15:42671550-42671572 CACATAAGGGAGAGGGGGGAAGG + Intronic
1126145012 15:45465903-45465925 CAAAACAGGCAGAAGAAGGAGGG + Intergenic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127267428 15:57373637-57373659 CACCCAAGGGAGAAAGAGGAGGG - Intergenic
1127585873 15:60377253-60377275 AATATCAAGGAGAAGGAGGAAGG + Intronic
1128458504 15:67847795-67847817 CACAACAACAAGAAGGAGGAAGG + Intergenic
1128923642 15:71634320-71634342 CACTACAGTGACAGGGAGGATGG + Intronic
1128930986 15:71704768-71704790 CAGACCAGGGAGAAGCATGATGG + Intronic
1130607361 15:85330092-85330114 GACATCAGTGAGAAGGAGGCTGG - Intergenic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131025222 15:89135873-89135895 CAGAACAGGAAGAAGGCCGAAGG + Intronic
1131494929 15:92900120-92900142 CCCAACAGGGGGAGGGGGGAGGG - Exonic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1132274286 15:100553495-100553517 CACATCTGGAAGAAGCAGGAAGG - Intergenic
1132746006 16:1436588-1436610 CCACACAGGGAGAGGGAGGAGGG + Intronic
1132765282 16:1531410-1531432 CAGAACAGGGACACGGAGGGAGG - Intronic
1132792268 16:1698196-1698218 CACAAGAGAGGGATGGAGGATGG + Intronic
1133076584 16:3285008-3285030 CACAACAGGGCCCAAGAGGAAGG - Intronic
1133681494 16:8124346-8124368 GACTACTGGGACAAGGAGGATGG + Intergenic
1133692567 16:8230695-8230717 CACAGCAGGGGAAAGGAGAAGGG + Intergenic
1133770357 16:8863999-8864021 CACAGCTGGGGGAGGGAGGAAGG + Intronic
1133961260 16:10495550-10495572 AAAAAGAGGGAGAAGGAGGGAGG - Intergenic
1134277715 16:12791624-12791646 CCCACCTGGGAGAAGGAGGCTGG + Intronic
1134407177 16:13970641-13970663 CACTGCTGGGGGAAGGAGGAAGG + Intergenic
1135046270 16:19158527-19158549 CCCAAAAGGGAGGAGAAGGAAGG + Intronic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1135964041 16:27021306-27021328 CACAGCAGTGAGAGGAAGGATGG - Intergenic
1136172099 16:28495699-28495721 GACAACCGGGAGATGGAGCAGGG + Exonic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137628895 16:49928249-49928271 CACAGCAGGTAGAAGGGAGATGG - Intergenic
1137773111 16:51033979-51034001 CCAAACAGGGAGAAGGGTGAGGG - Intergenic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138229007 16:55324297-55324319 GGCAAGAGGGAGAAGGAGGAGGG - Exonic
1138231523 16:55340516-55340538 CACATGAGGCAGAAGGAGTAGGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139654390 16:68378529-68378551 GACTGCAGGGAGAAGGAGGCAGG - Intronic
1141028905 16:80571021-80571043 CCCAAAATGGGGAAGGAGGAAGG + Intergenic
1141155196 16:81592504-81592526 CACCGCAGGAGGAAGGAGGAGGG - Intronic
1141775660 16:86121427-86121449 GATTGCAGGGAGAAGGAGGAGGG - Intergenic
1142780137 17:2175229-2175251 GACGACAGTGAGAAGGAAGAAGG + Intronic
1142863660 17:2777890-2777912 TGCAACAGGAAGAAGGGGGAGGG - Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1142958162 17:3535196-3535218 GACAGAAGGGAGAAGGAGGAGGG - Intronic
1143035240 17:3991396-3991418 AACAAGAGGAAGGAGGAGGAAGG - Intergenic
1143655454 17:8291107-8291129 AAAAACAGTGAGAAGGAGGAAGG + Intronic
1144124977 17:12194864-12194886 GACAGCATGGAGAAGGTGGATGG - Intergenic
1144740891 17:17581693-17581715 CACAGGAGGGAGAGGGGGGAGGG - Intronic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145773777 17:27512132-27512154 CACTACAGGGAGAAAGAGCAGGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1145973850 17:28972890-28972912 GAGCACTGGGAGAAGGAGGAAGG + Intronic
1146073408 17:29705071-29705093 AACAACTGGGAGAATGAGGCTGG - Intronic
1146553368 17:33801428-33801450 CAAAACAGGGATTGGGAGGAAGG - Intronic
1147606214 17:41775234-41775256 CACAACAGACAGAAGAAGGCTGG + Intronic
1147792072 17:43020202-43020224 GACACCAGGAAGGAGGAGGAGGG + Intronic
1148546957 17:48526463-48526485 GAAAGCAGGGAGGAGGAGGAAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148778219 17:50107771-50107793 CTCAACAGGGGTAGGGAGGAGGG + Intronic
1148807753 17:50272777-50272799 CAAACCAGGGACAAGGAGAAGGG + Intronic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1149516161 17:57282594-57282616 CAGAACAGGGAGAGGAAGCAGGG - Intronic
1149696968 17:58623714-58623736 CACAAATAGGAGGAGGAGGAAGG + Intronic
1150004926 17:61463559-61463581 CCCAGCAGGGAGAAGGAGAGGGG + Intronic
1150632123 17:66887169-66887191 CACAGCAGGGTGGAGGAGAAGGG + Intergenic
1150641780 17:66954204-66954226 CCCATCAGGGAGAATGAGGGAGG - Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151115838 17:71733916-71733938 CTACACAGGGAGGAGGAGGAGGG - Intergenic
1151444965 17:74157475-74157497 CACAGCAGGCAGAAGGAGGTGGG + Intergenic
1151635805 17:75347084-75347106 TACGACAGGGAGAAGGAAGGGGG - Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152276079 17:79358278-79358300 AACAACAGGCACAAGGGGGAAGG + Intronic
1152318234 17:79593243-79593265 AAGAGCTGGGAGAAGGAGGAAGG - Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152517999 17:80837333-80837355 CACACCAGGGAGCAGCAGGGGGG + Intronic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1154980676 18:21500088-21500110 GGCAGCAGGGAGGAGGAGGATGG - Exonic
1155012321 18:21792180-21792202 CACAGCAAGGTGGAGGAGGAAGG - Intronic
1155147291 18:23094631-23094653 CACCCCAGGGAGGGGGAGGAAGG + Intergenic
1155435798 18:25811624-25811646 GACTACGGGGAGATGGAGGAAGG - Intergenic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1156399086 18:36724693-36724715 CACTGCAGGGAGAGGGAGCAGGG - Intronic
1157103749 18:44753772-44753794 GACAGCAGGGTGAGGGAGGAAGG + Intronic
1157112034 18:44830179-44830201 CACAAAAGGGAGAAGAGGGGAGG + Intronic
1157444628 18:47735330-47735352 CACCACAGGGAGGGGCAGGAGGG + Intergenic
1157486317 18:48089974-48089996 CAGAACTGGGTGAAGGAGGTGGG + Intronic
1157799010 18:50603273-50603295 CACACCAGGGAGATGGAAGCTGG - Intronic
1157890088 18:51407234-51407256 CCCAACAGGGAGAAGGAATATGG - Intergenic
1158091170 18:53715406-53715428 AACAAAAGGAGGAAGGAGGAAGG + Intergenic
1158095319 18:53763636-53763658 CAAAAAAGGTAGAAAGAGGAAGG + Intergenic
1158561085 18:58514289-58514311 AAAAACTGGGAGAAGGAAGAAGG - Intronic
1158865859 18:61637005-61637027 CAAAGCAGGAAGAAGTAGGATGG + Intergenic
1159247470 18:65828021-65828043 AACTACGTGGAGAAGGAGGAGGG - Intronic
1159900381 18:74039490-74039512 CACAGCCAGGAGCAGGAGGAAGG - Intergenic
1159959661 18:74545653-74545675 AACAGCAGAGAGGAGGAGGAGGG - Intronic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1160367023 18:78335346-78335368 GGCTACAGGGAGGAGGAGGAGGG + Intergenic
1160853089 19:1203509-1203531 CAAAACAGGAAGAAGGCAGATGG - Intronic
1161415644 19:4145196-4145218 GGCAAGAGGGAGGAGGAGGAAGG + Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162439997 19:10686947-10686969 CACAGCAGGGAGGAGGGGGGTGG + Intronic
1162529995 19:11230420-11230442 CACAACAGGCAGGAGGAGTGTGG + Intronic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1164706451 19:30323678-30323700 CCCAACCATGAGAAGGAGGATGG - Intronic
1164809092 19:31141827-31141849 CCCAACAGGGAACATGAGGAAGG - Intergenic
1164880291 19:31727272-31727294 CAACCCAGGGACAAGGAGGAGGG + Intergenic
1165076503 19:33282539-33282561 CCCACCAGGGACCAGGAGGAGGG - Intergenic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1165929172 19:39344924-39344946 CTCAAAGGGGAGAAGGAAGAAGG - Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166783644 19:45354972-45354994 CACGCCCGGGAGGAGGAGGAGGG - Intronic
1166992456 19:46700820-46700842 CACGCCAGTGAGGAGGAGGAAGG - Exonic
1167049365 19:47069091-47069113 CAGGACCGGGAGAATGAGGAAGG - Exonic
1167137094 19:47623327-47623349 CACAGCAGGGAGGAGCAGCAGGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167224081 19:48225159-48225181 CACAACAGAGGGAAAGAAGAGGG + Intronic
1167697555 19:51024263-51024285 CACAACCTCCAGAAGGAGGAGGG - Exonic
1168152450 19:54456304-54456326 CACTGCAGGAAGAAGCAGGAGGG - Exonic
925053314 2:834228-834250 TAGAACAGGGAGAAGGGAGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925681947 2:6431722-6431744 CACAGCAGGCAGCAAGAGGAGGG + Intergenic
925844633 2:8024372-8024394 GACACCAGGGAAAAGCAGGAAGG + Intergenic
926569479 2:14513691-14513713 AACAACTGGGAGAAGGCAGAAGG + Intergenic
927284716 2:21344952-21344974 CACAGCATGGATATGGAGGAGGG - Intergenic
927844446 2:26464218-26464240 CCCAACAGTGAAAAGGAGGTGGG - Intronic
928979305 2:37121810-37121832 CACGACATGGAGATGGAGGTGGG + Intronic
930035735 2:47083996-47084018 GAGATCAGCGAGAAGGAGGAGGG + Intronic
930198453 2:48530651-48530673 AACAGCAGTCAGAAGGAGGAGGG - Intronic
930429760 2:51259807-51259829 AATAACAGAGAGGAGGAGGACGG + Intergenic
931140624 2:59453660-59453682 CCAGACCGGGAGAAGGAGGAAGG - Intergenic
931196198 2:60054225-60054247 CACTGCAGAGAGAAGGAGAAAGG - Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931590131 2:63873984-63874006 AACAGCAGGAAGAAGGAAGATGG + Intronic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932518990 2:72388048-72388070 CACAACTGGCAGGAGGTGGAAGG + Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933855634 2:86411577-86411599 GATAACAGGGAGAAGGAGCTAGG - Intergenic
933998402 2:87686583-87686605 CCCAACTGGGAGGAGGCGGATGG - Intergenic
935347674 2:102123929-102123951 AACAAGAGGGAGAAGGAGAGAGG + Intronic
936295447 2:111264290-111264312 CCCAACTGGGAGGAGGCGGATGG + Intergenic
938070108 2:128303942-128303964 CAGAACAGGAAGGTGGAGGAAGG + Intronic
939605813 2:144253951-144253973 CACAGCAGGGAGCAGGAGTTTGG - Intronic
939698499 2:145358746-145358768 TCTAACAGGGAGAAGTAGGAGGG + Intergenic
940205489 2:151197339-151197361 GTCAGCAGAGAGAAGGAGGAGGG + Intergenic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
942166912 2:173250370-173250392 CACAGCAGGGAGAAGGAAATAGG + Intronic
942388770 2:175470147-175470169 CAAAAAAGAGAGGAGGAGGAGGG - Intergenic
942752466 2:179303447-179303469 CAAAGCAGGGAGAATGAGTAAGG - Intergenic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943280330 2:185924073-185924095 CAGAACAGGGAGAGAGAGTATGG - Intergenic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
946076651 2:217079211-217079233 TACAAAAAGGAGAAGAAGGAGGG + Intergenic
946420651 2:219562721-219562743 CACAACGGGGTCAGGGAGGACGG - Intronic
946512376 2:220372572-220372594 CACATCAGGGGAAAGGAGCATGG - Intergenic
946523421 2:220491735-220491757 CCCAACAGGGAGAGGCAGGAAGG - Intergenic
946883802 2:224202816-224202838 TACAACAGGTAGGAGGAGGAGGG + Intergenic
947526197 2:230878162-230878184 CTAAGCAGGGGGAAGGAGGAGGG - Exonic
947636945 2:231684981-231685003 CACAGCGAGGAGGAGGAGGATGG + Intergenic
947738656 2:232474463-232474485 CTCCACAGGGAGAAGGAAGCTGG + Intergenic
947793984 2:232882945-232882967 GGCAGCAGGGAGCAGGAGGATGG + Intronic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1168925080 20:1572522-1572544 CAAAACAGGAGGACGGAGGACGG + Intronic
1168928957 20:1605550-1605572 CAAAACAGGAGGACGGAGGACGG + Intronic
1169486885 20:6041647-6041669 GACTACAGTGAGGAGGAGGAAGG - Exonic
1170588876 20:17756011-17756033 CACAGCAGGGGGAAGGCAGAGGG + Intergenic
1170841613 20:19928765-19928787 CACAAGAGGGAGAGGAAGGCAGG - Intronic
1171079071 20:22159656-22159678 CACTAGAGAGAGAGGGAGGAGGG - Intergenic
1171301525 20:24065136-24065158 AACAAGAGAGGGAAGGAGGAAGG - Intergenic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173351964 20:42253533-42253555 GGGAACTGGGAGAAGGAGGAGGG + Intronic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1173615422 20:44400328-44400350 CGAAACAGGGAGAGGGAGGAGGG + Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1174432014 20:50477211-50477233 CACAACAGGGGCAGGGAGGGAGG + Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174660838 20:52211710-52211732 CAAAACTGGGAGAAGGAAAAAGG - Intergenic
1175117314 20:56691649-56691671 CACCACCGAGAGAAGCAGGAGGG + Intergenic
1175233154 20:57488711-57488733 CAGAACAGGAAGAAGGCCGAAGG + Intergenic
1175248156 20:57593571-57593593 GGCTACAGGGAGGAGGAGGAGGG + Intergenic
1175529702 20:59666069-59666091 CACAACAGGCAGATGGAAGCTGG - Intronic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176160386 20:63644609-63644631 CACAGCAGGCAGGAGAAGGATGG - Intronic
1177121109 21:17138113-17138135 TACTAAAGGGAGGAGGAGGAAGG + Intergenic
1177262295 21:18747045-18747067 CACAACATGGATAATGAGTAGGG + Intergenic
1178094162 21:29196566-29196588 CACAAGAGGAAGATGGAGCAGGG - Intronic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178499043 21:33110601-33110623 TACTGCAGGGAGAGGGAGGAGGG - Intergenic
1179291283 21:40020356-40020378 CAAAACAAGGAAAAGAAGGAAGG - Intronic
1179337922 21:40475113-40475135 CACGACAGTCTGAAGGAGGAGGG - Intronic
1179482111 21:41685117-41685139 TACAAGAGGGAGATGGAGGGAGG - Intergenic
1179514448 21:41897189-41897211 CCAGACAGGGGGAAGGAGGAGGG + Intronic
1179536377 21:42055400-42055422 AATAGCAGGGAGGAGGAGGAAGG + Intergenic
1179659066 21:42863118-42863140 GACAGCAGGGAGAATGAAGAAGG - Intronic
1179791396 21:43757797-43757819 CACACCAGCAGGAAGGAGGATGG + Exonic
1180169192 21:46049116-46049138 GCCAACTGGGAGAAGGTGGACGG - Intergenic
1180953698 22:19731874-19731896 CCCAACAGGGAGGTAGAGGAGGG + Intergenic
1181829488 22:25548353-25548375 TAAAAGAGGGAGAAGGAGGGAGG + Intergenic
1181951985 22:26560820-26560842 CAGAACAGGAAGAAGGCCGAAGG - Intronic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182302629 22:29346162-29346184 CACAACAGGGAGGAGGAGCTTGG + Intronic
1182699092 22:32218541-32218563 CACCACAGCCAGGAGGAGGATGG + Exonic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1184117194 22:42429050-42429072 CTCAAGTGGGAGGAGGAGGATGG + Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184572772 22:45337051-45337073 CAAACCTGGGAGGAGGAGGAGGG - Intronic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1184921971 22:47612429-47612451 CACAGCAGGTAGAAAGAGGCAGG + Intergenic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190582 22:49433579-49433601 CCCAGCAGGGAGAGGGCGGATGG - Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949247549 3:1942780-1942802 AACAAAAGAAAGAAGGAGGAGGG + Intergenic
949900270 3:8808531-8808553 CACAAAAGCTAGAAGGAAGAAGG + Intronic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
951152551 3:19308827-19308849 AGAAAGAGGGAGAAGGAGGAGGG - Intronic
951781207 3:26364685-26364707 CAAAACAGGGAGAAGGAAAAAGG - Intergenic
953144580 3:40262581-40262603 GGCAACAGGGAAAGGGAGGAAGG + Intergenic
953566862 3:44039552-44039574 CACAACAGGGAAAAGAAATAAGG + Intergenic
953666061 3:44927497-44927519 CACCAGAGGAGGAAGGAGGAGGG + Intronic
954876485 3:53806025-53806047 AACATGAGGGAGGAGGAGGAGGG - Intronic
955123304 3:56083685-56083707 CACAACTGGGAGAATGAAGTGGG + Intronic
955197555 3:56819339-56819361 TAAAACATGGAGAAGGATGAGGG - Intronic
955566225 3:60249715-60249737 CACACACGGGAGAAGGGGGAAGG + Intronic
955730488 3:61980486-61980508 AGAAAGAGGGAGAAGGAGGAGGG + Intronic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956119759 3:65954584-65954606 ATCTACAGAGAGAAGGAGGAGGG + Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
957193374 3:77039184-77039206 CACAAGGGGGAGAAAAAGGAGGG - Intronic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958114345 3:89196026-89196048 AATGACTGGGAGAAGGAGGAAGG - Intronic
958164218 3:89858463-89858485 CACACCAGGGGGTGGGAGGAAGG + Intergenic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
958981567 3:100726287-100726309 CAAAACAGGCAGAAGAAGGTAGG - Intronic
959144938 3:102533183-102533205 GACTACATGGAGAAGGAGGGAGG - Intergenic
959252422 3:103965661-103965683 CACTCCAGGGAGAAGAAGGCAGG + Intergenic
959337328 3:105082320-105082342 CACAACATGGAGGAAGATGAAGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959840524 3:110969326-110969348 TCCAAAAGGGAGAGGGAGGAAGG - Intergenic
959904313 3:111693801-111693823 CACAAAGGGGTGAAGGAGGTGGG - Intronic
960061512 3:113327469-113327491 AATAACAGGAAAAAGGAGGAGGG + Intronic
960873397 3:122273704-122273726 TACAGCATGGAGAAGGATGATGG + Intronic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
964168674 3:153739813-153739835 AACGACAGGAAGAATGAGGAGGG + Intergenic
964453799 3:156838561-156838583 ACCAACTGGGAGAAGGAAGAAGG + Intronic
964493138 3:157258500-157258522 CAAAAGAGGGAGAAGGAACATGG - Intergenic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
965834929 3:172840988-172841010 CAAAACAGGAGAAAGGAGGAAGG - Intergenic
966964424 3:184975992-184976014 TACAAGAGGGGGAATGAGGAAGG - Intronic
967094581 3:186166658-186166680 AAAGACAGAGAGAAGGAGGAGGG + Intronic
967312375 3:188118112-188118134 CACTACTTGGAGAATGAGGAGGG + Intergenic
968268680 3:197382671-197382693 CACATCAAGGAGAAGATGGAAGG - Intergenic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969053607 4:4388305-4388327 CACAAAAGGAACAAAGAGGAAGG - Intronic
969240844 4:5896291-5896313 CGCAACAGAGAAAGGGAGGAAGG + Intergenic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969699575 4:8760798-8760820 CACCACAGGGAGAAGCAGGGAGG - Intergenic
969707394 4:8819233-8819255 CCCAAGAGGGAGAAGGGGCAGGG + Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
970320183 4:14867800-14867822 TACTAGAGGGAGAAGGTGGAAGG + Intergenic
970634864 4:17997732-17997754 AAAAACTGGGAGAAAGAGGATGG + Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971501805 4:27326294-27326316 CTCAAGAGGGGGAAGGAGGGAGG + Intergenic
972362841 4:38344938-38344960 CAGAACAGGGTGAAAGGGGAAGG - Intergenic
972366251 4:38377897-38377919 GACAACAGAGAGAAGGATTAGGG + Intergenic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
972776097 4:42242020-42242042 AACAAAAGGCAGAAGGAGGGAGG + Intergenic
972942786 4:44217664-44217686 CAAAACAGGCAGAAGAAGGTGGG + Intronic
973686105 4:53371378-53371400 TACAACAGGGTGAAGGATAATGG + Intergenic
973871683 4:55172780-55172802 CGCAGCAGGGAGAAGGAGCCAGG - Intergenic
973872766 4:55183021-55183043 CACCACATGGAGGAGGAGGTAGG - Intergenic
974103279 4:57440581-57440603 TAAAAAAGGTAGAAGGAGGAAGG - Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974322216 4:60366063-60366085 CACAGCCGGGAGAATGATGAGGG + Intergenic
974391067 4:61269287-61269309 CACACCAGAGAAAAGGAAGAAGG - Intronic
974746308 4:66082459-66082481 CCCAAGCTGGAGAAGGAGGAAGG + Intergenic
975494247 4:75020507-75020529 GACAACAGGGAGTAGGGAGATGG - Intronic
976132981 4:81904631-81904653 CACAAAAGGAAGAAGTAGCAAGG - Intronic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
978463727 4:108985192-108985214 CTCCACAGAGAGAAGGATGAAGG - Intronic
978653117 4:111031999-111032021 CAAAGCACGGAGAAGAAGGAGGG + Intergenic
978780970 4:112553576-112553598 GTAAACAGGGAGAAGGAGAAAGG + Intronic
978872307 4:113594125-113594147 AACAAGAGAGAGAAGGAGGAAGG + Intronic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
978999857 4:115203088-115203110 AACAACAGAGAGAGGGAGGGAGG - Intergenic
979185485 4:117786289-117786311 TACTAAAGGGAGAGGGAGGAAGG - Intergenic
979551172 4:121992537-121992559 CACAAGAGGGAGAAGGAAGGTGG - Intergenic
980113633 4:128658688-128658710 TAGAACAGGGAGAAGGAAAAGGG + Intergenic
981085510 4:140679133-140679155 CACATCAGGCAGAAGCAGGGTGG + Exonic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
985121280 4:186645036-186645058 GAAAACAGGAAGCAGGAGGAAGG + Intronic
985241940 4:187939625-187939647 CATAACAGGGAGAGGGAGATTGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985632596 5:1021833-1021855 CCCAGCAGGGATAAGGCGGATGG + Intronic
985758008 5:1730644-1730666 GAAAACAGGGAGAAAAAGGAAGG - Intergenic
985876929 5:2606994-2607016 CACACCAGGCAGATGGAGCAGGG - Intergenic
986253214 5:6080147-6080169 CACTCCAGGCAGAAGGAGGTGGG + Intergenic
986961550 5:13218918-13218940 TCCAAAAGGGAGAAGTAGGAAGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988662275 5:33284748-33284770 CGCAGAAGTGAGAAGGAGGATGG + Intergenic
988868068 5:35357145-35357167 GACAAAATGGAGAAGAAGGAGGG - Intergenic
989138834 5:38182141-38182163 CCCAAGAGAAAGAAGGAGGATGG - Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
991636827 5:68714718-68714740 ACCAACAGGAGGAAGGAGGAAGG - Intergenic
992089565 5:73304888-73304910 CACAGCAGGAAGAGGTAGGAAGG + Intergenic
992093327 5:73338844-73338866 CAGAGCGGGGAGAGGGAGGAGGG + Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992761260 5:79952626-79952648 CACACATGGGAGGAGGAGGATGG - Intergenic
992788707 5:80194624-80194646 CACAACAGGAAGCAGGCAGATGG + Intronic
992871365 5:81008694-81008716 TACAAAAGGGAGAGGAAGGAGGG - Intronic
993407652 5:87531538-87531560 CACAAAAGAGAGAAGGAAGGAGG - Intergenic
993691578 5:91007436-91007458 CACAAGAGGCAGTAGCAGGATGG - Intronic
993702099 5:91130774-91130796 CCCAAAAGGGGGAAGGATGAAGG - Intronic
993736257 5:91479859-91479881 CCTAACTGGGAGAAAGAGGATGG - Intergenic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
995810169 5:116097803-116097825 AACAAGAGAGAGAGGGAGGAGGG + Intronic
996438731 5:123465086-123465108 CAAAAAAGATAGAAGGAGGATGG + Intergenic
996538596 5:124605433-124605455 CACAATAGTCAGAAGGAGCAGGG - Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997183262 5:131855522-131855544 CAAAAGAGAGAGAGGGAGGAAGG + Intronic
999266372 5:150269457-150269479 CTCAAGAGGGAGACTGAGGAGGG - Intronic
999422585 5:151457742-151457764 CACAGCAGAGAGAAAGAGAACGG + Intronic
999640462 5:153667273-153667295 CACACCAGTCAGAAGGAAGAAGG - Intronic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1000452616 5:161408716-161408738 AAAAACAGAGGGAAGGAGGAAGG + Intronic
1001220358 5:169895291-169895313 AACAAGAGAGGGAAGGAGGAGGG - Intronic
1001574751 5:172755954-172755976 TACAAGAGGGAGAGGGAGGAAGG + Intergenic
1001673590 5:173494086-173494108 CCCAGCCGGCAGAAGGAGGAAGG + Intergenic
1001683778 5:173577462-173577484 CACAGCAGGGAGGAGGAAGATGG + Intergenic
1001747896 5:174105997-174106019 TACAACTGGGAAAATGAGGAAGG + Intronic
1002568690 5:180128222-180128244 CACCCCAGGGAGAGGGAGGCTGG - Intronic
1002682771 5:180981362-180981384 CACTGCTGGGAGAGGGAGGATGG + Intergenic
1003306761 6:4935994-4936016 CACACCCGGGAGAATGGGGATGG - Intronic
1003315855 6:5011357-5011379 CACAGCAGGAGGAAGGAGGAAGG + Intergenic
1003356656 6:5379536-5379558 CACAGCTGCGGGAAGGAGGAAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003523468 6:6878864-6878886 CACAGCAGGGCAAAGGAGCAGGG - Intergenic
1003637062 6:7842099-7842121 CACAACAAGGGAAAGGGGGATGG - Intronic
1004007801 6:11652833-11652855 CACATCATGCAGGAGGAGGATGG + Intergenic
1004354795 6:14921562-14921584 CAAATGAGGGAGAAGGGGGAAGG + Intergenic
1004526743 6:16415915-16415937 CAAAACAGGAAAAAGAAGGAGGG + Intronic
1004660791 6:17707199-17707221 ACCGACAGGGAGAAGGAGAATGG - Intergenic
1004989325 6:21119143-21119165 CTCAACAGGAAGAAAGAGGAAGG - Intronic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005666807 6:28065897-28065919 GAGAACAGGGAGAAGGTGGTTGG - Intergenic
1005944971 6:30588902-30588924 GACAAGAGGGACAAGCAGGAGGG - Intronic
1006054428 6:31372487-31372509 CCCAAAAGAGAGAAGGAAGAAGG + Intergenic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006512316 6:34528369-34528391 GACAAGAGAGATAAGGAGGAGGG + Intronic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1006603485 6:35241123-35241145 CACATCTGGGGGAAGGAGTAGGG - Exonic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007519594 6:42441323-42441345 CTCAAAGGGGGGAAGGAGGAGGG + Intronic
1007783664 6:44268396-44268418 AACAACAGAGAGAAAGACGAGGG - Intergenic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1010786668 6:80010455-80010477 CACAACAGTTAGAAACAGGAGGG - Intronic
1011618422 6:89219493-89219515 AATAACAAGGAGAAGGAAGATGG + Intronic
1012252778 6:96997288-96997310 AGCAACAGGGAGAATGAAGATGG - Intronic
1012811079 6:103959059-103959081 CACAGCAGAGAGAAAGAGGAAGG + Intergenic
1012963197 6:105644469-105644491 CACAGCAGAGTGTAGGAGGATGG + Intergenic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1013457095 6:110340177-110340199 CACATCTGGCACAAGGAGGATGG + Intronic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015085011 6:129280019-129280041 GAAAACAGGGACAAGGAAGAAGG - Intronic
1015455875 6:133425534-133425556 CAAAACAGGAAGAAAGTGGAGGG - Intronic
1015806570 6:137115805-137115827 TACAACAGGCAGAGAGAGGAAGG - Intergenic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016125372 6:140395766-140395788 TACAACAGTGAGCAGCAGGAGGG - Intergenic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1016472920 6:144393701-144393723 TAGAACAGGCAGAAGGAGGTGGG + Intronic
1016740588 6:147524634-147524656 CTCCACAGGGAGAAGGAGGTAGG - Intronic
1016936716 6:149453376-149453398 CACAACTGGGAGATTGAGGTGGG + Intronic
1017022275 6:150149915-150149937 CAAAACATAGAGAATGAGGAAGG - Intronic
1017852903 6:158320876-158320898 TACAACAGGGACAAGGGGCAGGG - Intronic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018063191 6:160106255-160106277 CACAGCATGGAGGAGGAGGGAGG + Exonic
1018432185 6:163730988-163731010 CACAGCAGGAAGCAGGAGGGAGG + Intergenic
1019574658 7:1731345-1731367 CAGAAAAGGGAGAATGATGAAGG + Intronic
1021450988 7:20784137-20784159 CACAGAAGGAAGAAGGAAGAGGG + Intronic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1021629939 7:22634968-22634990 ATCAGCAGGGAGAAGAAGGAAGG + Intergenic
1021659426 7:22905037-22905059 AACAAGAGAGAGAAGGAGGGAGG + Intergenic
1021934540 7:25616738-25616760 CACAAGAAGGAAAAGGAGAAAGG + Intergenic
1022080146 7:27012385-27012407 CTCAAGCGGGAGAAAGAGGAGGG - Intergenic
1022141992 7:27500676-27500698 CAAACCAGGGAGAAGGAGGAGGG + Intergenic
1022269101 7:28788245-28788267 CACAACTTGGGGGAGGAGGAGGG - Intronic
1022846073 7:34211165-34211187 CTGACCAGGGAAAAGGAGGAAGG - Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023136496 7:37058201-37058223 AAAAACAGTGAGAAGGAGAAGGG - Intronic
1023155133 7:37242957-37242979 CAAAACAGGCAGAAGGTAGAGGG - Intronic
1023262071 7:38368306-38368328 CACAAGAGGGCGATGGAGAACGG - Intergenic
1023549799 7:41357478-41357500 CACAACAGGGAGATGATGGGTGG - Intergenic
1023728933 7:43171752-43171774 AACAACAGGGAGAAGGGATAAGG - Intronic
1024053134 7:45642157-45642179 ATCAGCAGGCAGAAGGAGGAAGG + Intronic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1025777623 7:64572934-64572956 TACAACAGGGAGGAGAAGCAAGG + Intergenic
1026443483 7:70463803-70463825 GACACCATGGAGAGGGAGGAAGG + Intronic
1028288332 7:89032711-89032733 GACATCAGGGAGTAGGAGGTAGG + Intronic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028491870 7:91421741-91421763 CAAAACAGTAAGAAGGAAGAGGG - Intergenic
1028908281 7:96178776-96178798 GACAAATGGGAGGAGGAGGAGGG - Intronic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029599656 7:101556234-101556256 CACCATAGGGACAAAGAGGAGGG - Intronic
1029806387 7:103001620-103001642 CAAAGCAGGCAGAAGGAGGTGGG + Intronic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1030414138 7:109219495-109219517 GACTACAGGGAGAGGGAGAAGGG + Intergenic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1031537149 7:122948959-122948981 AACAAGAGGGAGAGGGAGGGAGG - Intergenic
1031692370 7:124804795-124804817 CCAAGCAGGGAAAAGGAGGAAGG + Intergenic
1032017316 7:128388429-128388451 CAGAAGAGGGAGAAGCAGAAAGG + Intergenic
1032384039 7:131509213-131509235 CTAACCAGGGAGAGGGAGGAGGG + Intronic
1032472724 7:132190099-132190121 AACAGGAGGGAGAAGGAAGAAGG - Intronic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033498876 7:141927428-141927450 CAATAAAGGGAGAAGGATGAAGG + Exonic
1033529059 7:142244985-142245007 CACAATAGGGAGAGGAAGAAAGG + Intergenic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1034217618 7:149420534-149420556 CACAACACCGTGCAGGAGGAAGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034412545 7:150948807-150948829 CACAGCTGGAAGCAGGAGGATGG + Intronic
1035011838 7:155725408-155725430 CACAACTGGGCGCAGGAGGGAGG + Intronic
1035598366 8:879564-879586 GACAACGGGGAGATGGAGGAAGG - Intergenic
1035764050 8:2091556-2091578 CACGACAGAGAGAGGGTGGAGGG - Intronic
1036416048 8:8549578-8549600 TACAACAGAGAGAGGAAGGAGGG + Intergenic
1036526848 8:9542814-9542836 CACCACATGGTGAAAGAGGAAGG + Intergenic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1037315314 8:17594888-17594910 CACAACAGCCAGAAGGTGGAAGG - Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037674596 8:21042827-21042849 CTCATCAGGGAGAAAGATGATGG - Intergenic
1037903300 8:22700876-22700898 GTCTTCAGGGAGAAGGAGGAGGG + Intergenic
1038207338 8:25479240-25479262 CACAGCAGGGAGGAGGGAGAGGG - Intronic
1038609734 8:29049305-29049327 CGCAATGGGGAGGAGGAGGAGGG + Intronic
1038749783 8:30284763-30284785 CTCATCAGGGAGTAGGGGGATGG - Intergenic
1039035436 8:33354303-33354325 CACAATCTGGAGAACGAGGAGGG + Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041421663 8:57673445-57673467 AACACCCTGGAGAAGGAGGATGG + Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1043670830 8:82882101-82882123 CACAACAGGGACAAGGAATGGGG - Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1044080879 8:87881853-87881875 CACAAAAGGGAGGAGAAAGATGG + Intergenic
1044228539 8:89747397-89747419 CACACAAGGGAGCAGGAGAAAGG + Intergenic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1044857623 8:96493134-96493156 CAAAAAAGGGACATGGAGGAAGG - Intergenic
1045014041 8:97983299-97983321 CACAATAGGCAAAAGGTGGAAGG - Intronic
1045950118 8:107841939-107841961 CACACCTGGGAGAAGCAAGAGGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046481776 8:114829245-114829267 CAAATGAGGGAGAAGGAGTAGGG + Intergenic
1046877048 8:119266672-119266694 GACAGCAGGGAGAGGAAGGAAGG + Intergenic
1047497883 8:125421453-125421475 CTTAGCAGGGAGAAGAAGGAAGG - Intergenic
1047782993 8:128124839-128124861 CAATACAGGGAAAACGAGGAGGG + Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1048066131 8:130970586-130970608 CACACCAGGGTGGAGGGGGATGG - Intronic
1049125826 8:140786904-140786926 AACAACAGAGATAAGGAGGATGG + Intronic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049426424 8:142539897-142539919 GACAACGGGGAGCAAGAGGAAGG + Intronic
1049537494 8:143189098-143189120 CACAGCAGGGAGAGGTAGGAGGG - Intergenic
1049936748 9:506762-506784 CCCAAGTGGGAGGAGGAGGATGG + Intronic
1050042010 9:1505796-1505818 GACAACAGGGAGAATCAAGATGG - Intergenic
1051240985 9:15055486-15055508 CAGAAGAGGGAGAAAGAGAAAGG + Intergenic
1051643827 9:19248754-19248776 CAAAACAGAGAGAAAGTGGAAGG - Intronic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1056008458 9:82300355-82300377 CACAAAAAGGAGAAAGAGAAAGG - Intergenic
1056078147 9:83062548-83062570 CACGACAGCGAGGAGGACGAAGG - Exonic
1056222573 9:84464920-84464942 CACAGCAGGGAGAAGGACTTAGG - Intergenic
1056736927 9:89217815-89217837 CACAACAGGAAGGAGGTGTATGG - Intergenic
1057008463 9:91581353-91581375 CTCAACAGGGAGGCCGAGGAGGG - Intronic
1057016622 9:91657862-91657884 GAAAACAAGGAGATGGAGGAGGG - Intronic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057480369 9:95440563-95440585 AAAAACAGGGAGGGGGAGGAGGG + Intergenic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058217085 9:102248178-102248200 CACAAAATGGAGAATGAGGAAGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058581224 9:106460024-106460046 CAAAGCAGGAAGAAGGAGGTTGG + Intergenic
1058646425 9:107135345-107135367 GACAAGAGGGAAAGGGAGGAAGG + Intergenic
1058684078 9:107465663-107465685 TTCAACAGGGAGGAAGAGGAGGG + Intergenic
1058740212 9:107935329-107935351 GACAGCAGGGAGCAGGAGGATGG + Intergenic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059353802 9:113684580-113684602 CAAACCGGGGGGAAGGAGGATGG + Intergenic
1059428649 9:114236838-114236860 CACAGCAGGGAAAGGAAGGAAGG + Intronic
1059876890 9:118645247-118645269 GAAAAGAGGGGGAAGGAGGAAGG - Intergenic
1060851077 9:126876230-126876252 CTTAACAGGGAAAAGAAGGAAGG - Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1062321877 9:135994203-135994225 CACATCAGGGAGGAGGCAGAGGG - Intergenic
1062549648 9:137080170-137080192 CAAAACTGAGAGAAGGAAGAAGG - Intronic
1062676969 9:137752367-137752389 GACACCGGGGAGGAGGAGGAAGG + Exonic
1185895407 X:3854163-3854185 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185900524 X:3892587-3892609 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185905640 X:3931018-3931040 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1186047325 X:5550482-5550504 AACAACAAGAAGGAGGAGGAGGG - Intergenic
1186201406 X:7158605-7158627 CACAGCAGGGGGAATGAGGGAGG + Intergenic
1186584604 X:10859419-10859441 GACAACTGGGTGAAGGTGGATGG - Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1187376947 X:18764026-18764048 GTCAACTGGGAGAAGTAGGAGGG + Intronic
1187395347 X:18914650-18914672 CAGAAGAGGGTAAAGGAGGAAGG + Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188004856 X:25010229-25010251 CACAACAGAGGGAAGAGGGAGGG - Intronic
1188065998 X:25660146-25660168 CAAAACAGTGAGTAGAAGGATGG + Intergenic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189988883 X:46576209-46576231 AGCTACAGGGAGAAGGGGGAAGG - Intronic
1190364068 X:49675389-49675411 TACAACAGGGAGAAAGGTGATGG - Intergenic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1190913423 X:54792110-54792132 CACATGAGGTAGAAAGAGGAGGG + Intronic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192312331 X:70027354-70027376 CACAAAAGGGAGTGGGGGGAGGG + Intronic
1192313337 X:70034004-70034026 AACAAATGGGAGAAAGAGGAAGG - Intronic
1193087777 X:77462712-77462734 CTCACCAGGGACTAGGAGGAGGG - Intergenic
1193248451 X:79259133-79259155 CACAAAGTGGAGGAGGAGGATGG + Intergenic
1193713570 X:84908237-84908259 CATATGAGGGAGAGGGAGGAGGG + Intergenic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1196206128 X:112942081-112942103 AACAAAAAGGAAAAGGAGGAAGG - Intergenic
1196315158 X:114213664-114213686 AGCAAGAGAGAGAAGGAGGAAGG + Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1196496509 X:116329774-116329796 CACAGCAATGAGAAGGAGCATGG + Intergenic
1196583469 X:117402402-117402424 CTCAAAATGGAGAAGGAAGATGG - Intergenic
1196645994 X:118117382-118117404 CACAACATTAAGAAAGAGGAAGG + Intergenic
1197816326 X:130502347-130502369 GAAAAAAGTGAGAAGGAGGAGGG - Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1200246996 X:154531720-154531742 CCCAACAGAAGGAAGGAGGAGGG - Exonic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200957968 Y:8970565-8970587 CACAAATGGCAGAGGGAGGAGGG - Intergenic
1201437900 Y:13979192-13979214 CAAATCAGGCAGAAGGAGGTGGG - Intergenic
1201574381 Y:15446454-15446476 CACACAAGTGGGAAGGAGGATGG + Intergenic
1201576424 Y:15466097-15466119 CACAGCAGGGCGAATGAGGGAGG + Intergenic