ID: 1139489050

View in Genome Browser
Species Human (GRCh38)
Location 16:67276860-67276882
Sequence TTCCAGACCTCTCTTGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139489050_1139489056 11 Left 1139489050 16:67276860-67276882 CCAAAGGCAAGAGAGGTCTGGAA No data
Right 1139489056 16:67276894-67276916 TTTGTTGCCCTCAGTATTTGGGG No data
1139489050_1139489060 26 Left 1139489050 16:67276860-67276882 CCAAAGGCAAGAGAGGTCTGGAA No data
Right 1139489060 16:67276909-67276931 ATTTGGGGTAGTACTGAAGAGGG No data
1139489050_1139489054 9 Left 1139489050 16:67276860-67276882 CCAAAGGCAAGAGAGGTCTGGAA No data
Right 1139489054 16:67276892-67276914 TATTTGTTGCCCTCAGTATTTGG No data
1139489050_1139489059 25 Left 1139489050 16:67276860-67276882 CCAAAGGCAAGAGAGGTCTGGAA No data
Right 1139489059 16:67276908-67276930 TATTTGGGGTAGTACTGAAGAGG No data
1139489050_1139489061 27 Left 1139489050 16:67276860-67276882 CCAAAGGCAAGAGAGGTCTGGAA No data
Right 1139489061 16:67276910-67276932 TTTGGGGTAGTACTGAAGAGGGG No data
1139489050_1139489055 10 Left 1139489050 16:67276860-67276882 CCAAAGGCAAGAGAGGTCTGGAA No data
Right 1139489055 16:67276893-67276915 ATTTGTTGCCCTCAGTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139489050 Original CRISPR TTCCAGACCTCTCTTGCCTT TGG (reversed) Intergenic
No off target data available for this crispr