ID: 1139489060

View in Genome Browser
Species Human (GRCh38)
Location 16:67276909-67276931
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139489050_1139489060 26 Left 1139489050 16:67276860-67276882 CCAAAGGCAAGAGAGGTCTGGAA No data
Right 1139489060 16:67276909-67276931 ATTTGGGGTAGTACTGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139489060 Original CRISPR ATTTGGGGTAGTACTGAAGA GGG Intergenic
No off target data available for this crispr