ID: 1139489548

View in Genome Browser
Species Human (GRCh38)
Location 16:67279156-67279178
Sequence CACCCACGCGGCCTTCCTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139489534_1139489548 15 Left 1139489534 16:67279118-67279140 CCCCGTCCCGCGGTGCCCCCCGC 0: 1
1: 0
2: 3
3: 28
4: 244
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489543_1139489548 -4 Left 1139489543 16:67279137-67279159 CCGCGCACTCACCCTCGCTCACC 0: 1
1: 0
2: 2
3: 21
4: 359
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489533_1139489548 18 Left 1139489533 16:67279115-67279137 CCGCCCCGTCCCGCGGTGCCCCC 0: 1
1: 0
2: 0
3: 47
4: 496
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489542_1139489548 -3 Left 1139489542 16:67279136-67279158 CCCGCGCACTCACCCTCGCTCAC 0: 1
1: 0
2: 1
3: 21
4: 205
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489527_1139489548 25 Left 1139489527 16:67279108-67279130 CCCCGCCCCGCCCCGTCCCGCGG 0: 1
1: 7
2: 80
3: 433
4: 1567
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489530_1139489548 23 Left 1139489530 16:67279110-67279132 CCGCCCCGCCCCGTCCCGCGGTG 0: 1
1: 0
2: 11
3: 98
4: 709
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489538_1139489548 8 Left 1139489538 16:67279125-67279147 CCGCGGTGCCCCCCGCGCACTCA 0: 1
1: 0
2: 3
3: 6
4: 127
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489539_1139489548 0 Left 1139489539 16:67279133-67279155 CCCCCCGCGCACTCACCCTCGCT 0: 1
1: 0
2: 0
3: 13
4: 257
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489540_1139489548 -1 Left 1139489540 16:67279134-67279156 CCCCCGCGCACTCACCCTCGCTC 0: 1
1: 0
2: 0
3: 14
4: 214
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489535_1139489548 14 Left 1139489535 16:67279119-67279141 CCCGTCCCGCGGTGCCCCCCGCG 0: 1
1: 0
2: 9
3: 13
4: 186
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489532_1139489548 19 Left 1139489532 16:67279114-67279136 CCCGCCCCGTCCCGCGGTGCCCC 0: 1
1: 0
2: 4
3: 69
4: 721
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489531_1139489548 20 Left 1139489531 16:67279113-67279135 CCCCGCCCCGTCCCGCGGTGCCC 0: 1
1: 0
2: 5
3: 74
4: 676
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489536_1139489548 13 Left 1139489536 16:67279120-67279142 CCGTCCCGCGGTGCCCCCCGCGC 0: 1
1: 1
2: 2
3: 25
4: 235
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489541_1139489548 -2 Left 1139489541 16:67279135-67279157 CCCCGCGCACTCACCCTCGCTCA 0: 1
1: 0
2: 0
3: 18
4: 229
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489537_1139489548 9 Left 1139489537 16:67279124-67279146 CCCGCGGTGCCCCCCGCGCACTC 0: 1
1: 0
2: 1
3: 22
4: 146
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147
1139489529_1139489548 24 Left 1139489529 16:67279109-67279131 CCCGCCCCGCCCCGTCCCGCGGT 0: 1
1: 0
2: 30
3: 156
4: 968
Right 1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139489548 Original CRISPR CACCCACGCGGCCTTCCTGG CGG Exonic