ID: 1139490005

View in Genome Browser
Species Human (GRCh38)
Location 16:67280868-67280890
Sequence CTTCCTCCCCACAGGGACTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139490000_1139490005 0 Left 1139490000 16:67280845-67280867 CCCAATACGGCAGGAGTTCACTG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1139490005 16:67280868-67280890 CTTCCTCCCCACAGGGACTCGGG 0: 1
1: 0
2: 3
3: 38
4: 335
1139489996_1139490005 25 Left 1139489996 16:67280820-67280842 CCTAGAGGCGGTGGAGGTGGAGT 0: 1
1: 0
2: 2
3: 25
4: 264
Right 1139490005 16:67280868-67280890 CTTCCTCCCCACAGGGACTCGGG 0: 1
1: 0
2: 3
3: 38
4: 335
1139490001_1139490005 -1 Left 1139490001 16:67280846-67280868 CCAATACGGCAGGAGTTCACTGC 0: 1
1: 0
2: 0
3: 0
4: 45
Right 1139490005 16:67280868-67280890 CTTCCTCCCCACAGGGACTCGGG 0: 1
1: 0
2: 3
3: 38
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139490005 Original CRISPR CTTCCTCCCCACAGGGACTC GGG Exonic
900139208 1:1132430-1132452 CTTCCTCCACACATGGGCTCAGG - Intergenic
900214837 1:1475840-1475862 GTTCCTACCCCCAGTGACTCTGG - Intronic
900222050 1:1514194-1514216 GTTCCTACCCCCAGTGACTCTGG - Intronic
900226955 1:1537395-1537417 CTTCCTCCCCTGAGGGCCTCTGG - Intronic
900555337 1:3277455-3277477 TCTCCTCACCACAGGGTCTCTGG + Intronic
900601225 1:3503503-3503525 CTTCCTCCTCTCAGGAACTGGGG + Intronic
900677130 1:3894668-3894690 CTGCCACCCCACAGGGTTTCTGG - Intronic
901143752 1:7051963-7051985 CTTCTTCCGCTCAGGGGCTCTGG + Intronic
901654145 1:10759731-10759753 CTTCCTCCCCATGGTCACTCTGG - Intronic
902223180 1:14979671-14979693 CTGCCTCCCCACAAGTCCTCAGG - Intronic
902330921 1:15730931-15730953 CATCCTCCCCTGAGGCACTCAGG - Intronic
902334536 1:15747446-15747468 CTTCCTCCCCCTTGGGCCTCTGG - Intronic
902948920 1:19865656-19865678 TTTCCTCCATACAGTGACTCAGG + Intergenic
903035075 1:20487462-20487484 CCTCCTCCCCCCATGGATTCTGG - Intergenic
903141783 1:21343663-21343685 CCACTTCCCCACAGGGACTTTGG - Intronic
903277851 1:22233083-22233105 CTTCCTCCCTGGTGGGACTCAGG - Intergenic
903281088 1:22250393-22250415 CATCTTCCCCACAGGGTGTCTGG - Intergenic
904556235 1:31366615-31366637 CTGCCTAACCACAGGGCCTCAGG - Intronic
904786687 1:32988192-32988214 GGTCCTCCGCACAGAGACTCTGG - Intergenic
906228524 1:44140710-44140732 CTTGCTCCCCACAGAGGGTCTGG + Intergenic
906676191 1:47695122-47695144 CCTCCTCCCCTCTGGGTCTCGGG + Intergenic
907491144 1:54809700-54809722 CTTGGTCTCCACAGAGACTCAGG - Intronic
908801590 1:67886067-67886089 CTTCTTCCCCACAGTGGCTGTGG + Intergenic
911063613 1:93768694-93768716 CTACTTCCCCACAGGGGCCCTGG - Intronic
914841794 1:151254748-151254770 CTCCCTCCCGACCGGGTCTCCGG - Exonic
915028494 1:152855659-152855681 CTCCCTGCCCACAGAGATTCTGG + Intergenic
915584928 1:156839343-156839365 CTTCCTGCCCCCAGGGGCTTGGG - Intronic
915586208 1:156845288-156845310 CTCGCTCTCCCCAGGGACTCAGG - Exonic
915902529 1:159856693-159856715 CCCCCACCCCACAGGGACTGAGG - Intronic
916864880 1:168845660-168845682 TTAGCTCCCCAGAGGGACTCTGG - Intergenic
917679525 1:177351567-177351589 GTTTCTCCCCACAGGCACTTTGG - Intergenic
918187753 1:182142988-182143010 CTTCCTCCCCTTAGGAATTCAGG - Intergenic
918423621 1:184387250-184387272 CCTCCTCCCCACAGTGTGTCCGG - Exonic
919778412 1:201208350-201208372 CTTCCTGCCCTCAGAGACCCTGG - Exonic
920092616 1:203465073-203465095 CCTCCTCCCCACATGGTCCCTGG - Intergenic
920555295 1:206899906-206899928 CTTCCTCACCACATGGAATATGG + Intronic
922218648 1:223540935-223540957 CTTCCTCCCGACTGGGTCTTGGG + Intronic
922782376 1:228263670-228263692 AGTCCTCCCGACAGGGACCCAGG + Intronic
923437190 1:233978577-233978599 TTTCTTCCCCACAGGGATCCTGG - Intronic
923664980 1:235991765-235991787 CTCCCTGCCCACAGGGAGCCAGG + Intronic
1062840147 10:663902-663924 CCTCCTCCCCACAAGGGCTCCGG + Intronic
1062841547 10:677266-677288 TTTCCTGCCCACAGTGACTGTGG - Intronic
1062991909 10:1827227-1827249 CTTCCTCCCAACATGGAGGCTGG - Intergenic
1063406098 10:5796807-5796829 CTTCCTCTCCCCATTGACTCGGG + Exonic
1065417065 10:25499850-25499872 CTCCCTTCCCACAGTGACGCAGG - Intronic
1065834648 10:29645704-29645726 CTTCCCTCCCATAGAGACTCAGG + Intronic
1066190100 10:33048250-33048272 ATTCTTCCCAACAGGGACTTGGG + Intergenic
1066963499 10:42241913-42241935 GTTCCGCCCCACGGGGACTGGGG + Intergenic
1067772246 10:49135146-49135168 CATCCTCCCCTCACGGGCTCTGG + Intergenic
1070307185 10:75246570-75246592 CTTCCTGCCCCCAGTGGCTCAGG + Intergenic
1070809582 10:79290900-79290922 CTTCCTCTCCACACTGCCTCGGG + Intronic
1070967850 10:80540462-80540484 CTGCCACCCCGCAGGGACACGGG - Intronic
1071358999 10:84826926-84826948 CTTCCCCACCACAGGCATTCAGG - Intergenic
1071372416 10:84965944-84965966 CTTCCTTCCCACAGGCATTGGGG + Intergenic
1071372683 10:84968572-84968594 CTTCCTTCCCACAGGCACTGGGG + Intergenic
1072967180 10:99983661-99983683 CTGACTCACCACACGGACTCTGG + Intronic
1073727246 10:106247694-106247716 CTTCATACCCACAGGGCCTAGGG + Intergenic
1075031694 10:119028883-119028905 CTTCCTCCCAACAGGTGCTCAGG - Intergenic
1075411308 10:122230332-122230354 CCTCCTGCCCACAGGGAGTGTGG - Exonic
1076646344 10:131957542-131957564 CTTCATCTCCACAGGGGCACGGG - Intronic
1076646617 10:131958573-131958595 CTTCATCCCCACAGGGGGACAGG - Intronic
1076751806 10:132547062-132547084 TTTCCTCTCCACAGGGACTTGGG - Intronic
1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG + Intronic
1076865704 10:133165268-133165290 CCTCCTCCCCTCAGGGAAGCCGG - Intronic
1077340880 11:2025831-2025853 CCTCCTCCCCACAGTGGCTGTGG + Intergenic
1078130466 11:8610110-8610132 CTTCCTCCCCACCTGGCCTATGG - Intergenic
1078565465 11:12410363-12410385 TTTCCCCCCGGCAGGGACTCCGG + Intronic
1079699128 11:23521153-23521175 AGTCCTCTCCACAGAGACTCTGG - Intergenic
1080451134 11:32379858-32379880 CAACCTCCCCACAGTGAGTCAGG - Intergenic
1082791263 11:57348075-57348097 CTTCCCCCCATCAGGGACCCTGG - Intronic
1083521861 11:63321011-63321033 ATACCTCCCCTTAGGGACTCAGG - Intronic
1083800978 11:65046106-65046128 CTTGTTCCTCACAGGGCCTCTGG - Exonic
1083866335 11:65455520-65455542 CTTCCACCCCACACTGACCCAGG - Intergenic
1085507637 11:77069221-77069243 CTGCCTATTCACAGGGACTCGGG + Intronic
1088742700 11:112780112-112780134 TTTCCCCACCCCAGGGACTCTGG - Intergenic
1089329421 11:117679344-117679366 CTTCCTCCCCAGAGAGGGTCAGG + Intronic
1089498989 11:118922001-118922023 CTTCCTCTCCACAAGGATGCGGG + Intronic
1090186178 11:124740407-124740429 CTTCCTCCCCAGTGAGACGCTGG + Intronic
1090767889 11:129892852-129892874 TTTCTTCTCCACAGGTACTCTGG + Exonic
1202823865 11_KI270721v1_random:81020-81042 CCTCCTCCCCACAGTGGCTGTGG + Intergenic
1092138454 12:6166427-6166449 CTCCCTCTCCACAGGAACACAGG + Intergenic
1092204318 12:6606443-6606465 CCTCCCCCGCACAGTGACTCGGG - Exonic
1092628559 12:10354595-10354617 ACCCCTCCCCATAGGGACTCAGG + Intergenic
1092881520 12:12891169-12891191 CCGCCTCCCCGCAGGCACTCGGG - Exonic
1093941212 12:25056890-25056912 CTCCCTCCCCAGAGTCACTCTGG + Intronic
1095441034 12:42238579-42238601 TTTCCTCCTCAGAGGGGCTCTGG - Intronic
1096187486 12:49591221-49591243 CTTCCTCCTCTCTGGTACTCTGG - Intronic
1096196124 12:49649855-49649877 CTTCCTGCCCACAGAGGCTGAGG - Exonic
1096742140 12:53701759-53701781 CTGGCTCCCCTCTGGGACTCTGG - Intergenic
1097087133 12:56477072-56477094 AATCCTCCCCTCAGGGACTCAGG - Exonic
1097177722 12:57152934-57152956 CCTCCTCCCCACAGGGATTCAGG - Intronic
1099623181 12:85030526-85030548 CTTCTTCCCCACAGAGAGTCAGG + Intronic
1101997555 12:109535747-109535769 CTTCCTCAGCACAGGGAACCCGG + Exonic
1102047822 12:109840793-109840815 CTTCCTCTCCACCTGGCCTCAGG - Intergenic
1102842550 12:116141643-116141665 CACCCTCACCACAGGGACTCTGG + Intronic
1103226951 12:119295944-119295966 CCTGCTCCCCCCAGGGACTGTGG - Intergenic
1103331841 12:120159734-120159756 CCACCTCCCCACAAGCACTCAGG + Intronic
1103733099 12:123041758-123041780 CTTCCTCCCTGAAGGGCCTCTGG - Intronic
1103999429 12:124850944-124850966 GTTCTTGCCCACAGAGACTCAGG - Intronic
1104512390 12:129392470-129392492 CTTCCTCCTCAAAGAGATTCTGG + Intronic
1105546098 13:21352123-21352145 CCTCATCACCGCAGGGACTCAGG + Intergenic
1106099101 13:26679205-26679227 CTGCCTCCCCACTGGGAGTGGGG + Intronic
1106249360 13:27972045-27972067 CTGCCTCCTCCCAGGGACACAGG - Intergenic
1107159533 13:37209902-37209924 CTTCTTCCCAACATGGGCTCTGG - Intergenic
1112341036 13:98553175-98553197 CACGCACCCCACAGGGACTCTGG - Intronic
1114550734 14:23531469-23531491 CTTCTTCCTCACCGGGAGTCCGG + Exonic
1119173784 14:72554557-72554579 CCTCCTTCCCAAATGGACTCTGG - Intronic
1119719750 14:76882953-76882975 CTCCCTCCCCTCAGGAACGCTGG + Intergenic
1120157106 14:81105553-81105575 CCTCCTCCCCTCCTGGACTCTGG + Intronic
1120920087 14:89746826-89746848 CTTCCTCCACACAGTCATTCAGG + Intergenic
1121671318 14:95712565-95712587 CATGCTCCTCTCAGGGACTCTGG + Intronic
1121815264 14:96924015-96924037 TCTCCTCCCCTCAGGGGCTCAGG + Intronic
1121815273 14:96924053-96924075 ACCCCTCCCCTCAGGGACTCAGG + Intronic
1121815283 14:96924092-96924114 CCCCTTCCCCTCAGGGACTCAGG + Intronic
1121846363 14:97175738-97175760 CTTCCTCCATACAGTGATTCAGG + Intergenic
1122540965 14:102497455-102497477 CTCCGTCCCCGCAGGGACCCTGG + Intronic
1122751006 14:103933046-103933068 ATTGTTCCCCACAGGCACTCCGG - Intronic
1122778979 14:104135757-104135779 CTTCCAGCCCTCAGGGAGTCGGG + Intergenic
1123053495 14:105559025-105559047 CTTCCTCCTCTCTGGGGCTCTGG + Intergenic
1123078072 14:105679439-105679461 CTTCCTCCTCTCTGGGGCTCTGG + Intergenic
1123441589 15:20295517-20295539 CTTCCGCCCCACGGGGACTGGGG - Intergenic
1126830837 15:52602978-52603000 CTTCCCCCACACAGAGATTCTGG - Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1132119474 15:99164412-99164434 CTTCCTCCCCAAAGAGACATGGG + Intronic
1132414878 15:101612874-101612896 CTCCCTCCCCACATGGCCTTGGG + Intergenic
1132890830 16:2203777-2203799 CTGCCTGCCCGCAAGGACTCAGG - Intergenic
1133306752 16:4814503-4814525 CTCCCTCCCCTCAGCAACTCCGG - Intronic
1134819123 16:17231349-17231371 CTTTCTCCCCACAGGCAGTGGGG + Intronic
1135612626 16:23881829-23881851 CTTCCTCCCCACCGAGCCTCTGG + Intronic
1135701603 16:24637592-24637614 CTTCCTTCCCACAGTAACTGTGG - Intergenic
1136059670 16:27717912-27717934 CTTAATCCCCCCAGGGAATCTGG - Intronic
1136417897 16:30114521-30114543 CGCCCTCCCCACGGGGCCTCGGG - Exonic
1136537833 16:30910681-30910703 GCTCCGCCCCACAGGGACCCAGG + Intergenic
1136724647 16:32348393-32348415 GTTCCGCCCCACGGGGACTGGGG + Intergenic
1136842974 16:33554433-33554455 GTTCCGCCCCACGGGGACTGGGG + Intergenic
1136866637 16:33763957-33763979 CTGCCTCACCACAAGAACTCTGG + Intergenic
1137586488 16:49666928-49666950 CTTCCTCCCCACTGGGCCATGGG - Intronic
1138597242 16:58035567-58035589 ATTCCTCCTCACAGGAACCCAGG + Intronic
1139419571 16:66842242-66842264 TTTCCTCTTCAGAGGGACTCAGG - Intronic
1139490005 16:67280868-67280890 CTTCCTCCCCACAGGGACTCGGG + Exonic
1140127783 16:72132464-72132486 CTTCCTGGCCACAGGGAGGCAGG - Intronic
1140675461 16:77324543-77324565 CTTCCTCCCCACAAGAATTTAGG - Intronic
1142187959 16:88703446-88703468 CGTCCTCCCCGGAAGGACTCAGG + Intronic
1142409949 16:89910933-89910955 CTTCCTCCTCACAGGGACCTGGG + Intronic
1203001783 16_KI270728v1_random:169362-169384 GTTCCGCCCCACGGGGACTGGGG - Intergenic
1203133386 16_KI270728v1_random:1705768-1705790 GTTCCGCCCCACGGGGACTGGGG - Intergenic
1203148173 16_KI270728v1_random:1816557-1816579 GTTCCGCCCCACGGGGACTGGGG + Intergenic
1203153139 16_KI270728v1_random:1854731-1854753 GTTCCGCCCCACGGGGACTGGGG + Intergenic
1143134446 17:4703820-4703842 CATCCTCCCCACAGGGCCGCGGG + Intronic
1143219411 17:5248974-5248996 CTTCTTGCCCACAGAGTCTCTGG - Intergenic
1143551246 17:7631708-7631730 ATTTCTCCCTCCAGGGACTCAGG + Exonic
1143953691 17:10653094-10653116 CTTCCTCCCCATTGGGCCTGAGG + Intronic
1144812846 17:18011780-18011802 AGTCCTCCACACAGAGACTCTGG - Intronic
1145911735 17:28547156-28547178 CTTCCTCCCAACATTGACTCAGG + Exonic
1146559840 17:33858553-33858575 CTGACTGCTCACAGGGACTCAGG - Intronic
1147000502 17:37359031-37359053 GTTCCTCCACGCAGGGGCTCCGG - Exonic
1148447082 17:47744364-47744386 CCTCCTCCCCACCGGGGCTCAGG - Intronic
1149070660 17:52538325-52538347 CTTACTCCACATAGGGTCTCAGG - Intergenic
1149298774 17:55285133-55285155 CTCTCACCCCACAGGGACCCAGG - Intronic
1151599282 17:75096386-75096408 CTTCCTCACGCCAGAGACTCTGG - Intronic
1151696959 17:75722625-75722647 TCTCCTCCCCTCAGGGACCCAGG - Intronic
1153747057 18:8190273-8190295 CTCCCTCCCCACACAGCCTCTGG + Intronic
1156193483 18:34746628-34746650 TAGTCTCCCCACAGGGACTCTGG + Intronic
1156370513 18:36468169-36468191 GTGCATCCCCACAGGGACCCAGG + Intronic
1156589451 18:38469330-38469352 CTTCCTCCTCACTGTGCCTCTGG - Intergenic
1157647177 18:49286606-49286628 TTTCCTCCCCAGCAGGACTCTGG - Exonic
1158430888 18:57386268-57386290 ACTCCTCCCCACAGGGACAGGGG - Intergenic
1160431944 18:78818903-78818925 TCTCCTCTCCACAGGGAGTCAGG - Intergenic
1160511374 18:79455426-79455448 CTGCCTCCCCAGAGGGGCCCCGG - Intronic
1160775987 19:855946-855968 CTGCCTCCACAGGGGGACTCCGG + Exonic
1160786261 19:901378-901400 CTCCCTCCACACGGGGACCCCGG - Intronic
1160912846 19:1482831-1482853 CAACCTCCCCCCAGGGGCTCTGG - Intronic
1162000313 19:7740556-7740578 CTTGCTCCACTGAGGGACTCAGG + Exonic
1162125599 19:8498205-8498227 CTTCCTCCCCACACTCACTGCGG + Exonic
1162211290 19:9094179-9094201 CTTCCTGACCACCAGGACTCAGG + Exonic
1162515252 19:11143440-11143462 CTTCCTCCCCGAAGGGACACTGG + Intronic
1163142646 19:15360819-15360841 CTTCCTCCCCACACTGCCTGGGG - Intronic
1163601853 19:18254064-18254086 CGTCATCCCCACAGGGCCTGGGG - Intronic
1164210392 19:23093356-23093378 CTTTCTTCCCATGGGGACTCAGG + Intronic
1164541827 19:29127240-29127262 CTTCCACCAGACAGGCACTCAGG + Intergenic
1164892699 19:31838655-31838677 CTTGCAACCCACAGGCACTCTGG - Intergenic
1165145106 19:33725654-33725676 GGTCCTCACCACTGGGACTCTGG + Intronic
1165386584 19:35513721-35513743 GTCCCTCCCCGCAGTGACTCAGG + Intergenic
1166321424 19:42021507-42021529 TTTCCTCCCCACCTGGGCTCTGG - Intronic
1166345282 19:42161777-42161799 CTCCCTCCCCTCAGGGACCAGGG - Intronic
1166964481 19:46520170-46520192 GTTCCTCCCCACTGGGCCTGTGG + Intronic
1167756724 19:51417457-51417479 CTGTCTCCCCACAGGGTCCCAGG - Exonic
1168318121 19:55493139-55493161 CTTCCTCCCCAAAGGACATCAGG + Intronic
926170602 2:10550549-10550571 CCTCCTCTCCACAGGGACACTGG - Intergenic
927135655 2:20094359-20094381 CTGCCTCCCCACTGGGACCCAGG - Intergenic
929815737 2:45229922-45229944 CTTCATCCCCATAGGCACTCAGG + Intergenic
931791512 2:65667751-65667773 CCTCCTCCCCAAAGGGTCCCCGG - Intergenic
931867304 2:66426419-66426441 CTTTCTCCCCAGCTGGACTCGGG - Intergenic
932770376 2:74497838-74497860 CTTCCTCCACCCTGGAACTCTGG + Exonic
933310946 2:80660684-80660706 ATTCTTCCCCAAAGGGACTTGGG - Intergenic
934321503 2:91975243-91975265 ATTCCGCCCCACAGGGACTGGGG - Intergenic
934635339 2:95982546-95982568 CTGCCTCACCACAAGAACTCTGG + Intronic
934798293 2:97122677-97122699 CTGCCTCACCACAAGAACTCTGG - Intronic
934835133 2:97580752-97580774 CTGCCTCACCACAAGAACTCTGG + Intronic
935203672 2:100879911-100879933 GTCCCTCCACACAGGGACACCGG + Intronic
935263612 2:101375873-101375895 CTTCCTCTCCACAGTCACTGGGG + Intronic
936518333 2:113196540-113196562 CTACCTTACTACAGGGACTCTGG - Intronic
936617844 2:114066699-114066721 CTCCCTCACCAGAGGGACTTAGG - Intergenic
936907457 2:117553611-117553633 CATCCTCCCAACATGGACCCAGG - Intergenic
936972527 2:118188836-118188858 CTTCCTCCAGCCAGGGAGTCTGG + Intergenic
938293483 2:130162571-130162593 CTTACTGCCCACAGGGCCACTGG + Intronic
938463070 2:131510390-131510412 CTTACTGCCCACAGGGCCACTGG - Intergenic
946026553 2:216675170-216675192 GTTCCTCCCCACATCGACTCTGG + Exonic
947463021 2:230319496-230319518 CCTCCTCCCCACCCAGACTCAGG - Intergenic
947722953 2:232380406-232380428 CTCCCTCCCCACAGGGTGCCCGG + Exonic
948143466 2:235691521-235691543 CTTCCTCCACACAGCAACACTGG + Intronic
948698797 2:239747853-239747875 CCTCTTCACCCCAGGGACTCTGG + Intergenic
948804613 2:240448149-240448171 CTGCCTCTCCACAGGGCCTGCGG - Intronic
948850270 2:240702258-240702280 CTTCCTCTCCACAGTGGCCCTGG + Intergenic
949062168 2:241967514-241967536 CCTCTTTCTCACAGGGACTCTGG - Intergenic
1168997488 20:2144213-2144235 CTGCCTCCCCATAGGGAATCTGG + Exonic
1169261534 20:4142319-4142341 CTTCCTCCACATAGTGATTCAGG - Intronic
1169627025 20:7582520-7582542 CTTCCTCCCCATTGGGAATGTGG - Intergenic
1169680670 20:8209130-8209152 CGTCCTGACCACAGGAACTCTGG + Intronic
1169738211 20:8860638-8860660 ATTCATCTCCACAGGGACTCAGG + Intronic
1169950499 20:11038099-11038121 GTTCCTCCACACAGGGACACTGG + Intergenic
1170212281 20:13857536-13857558 CTGCCTGTCCCCAGGGACTCAGG + Intronic
1171364035 20:24611521-24611543 CATCCTCCCCACGGGGTCTCGGG + Intronic
1172014572 20:31865252-31865274 ATCCCTCCCAACAGGGACCCAGG + Intronic
1172208228 20:33179799-33179821 CTTCCCCTCCACAGGCACCCGGG + Intronic
1172665088 20:36593536-36593558 ATTCTTCCCCACTGGGCCTCAGG - Exonic
1173334802 20:42103733-42103755 CTTCATCCCTGGAGGGACTCAGG - Intronic
1173791998 20:45833981-45834003 GTTCCTCCCCGGAGGGGCTCAGG - Intronic
1175367914 20:58467979-58468001 CTTCCTCCCCCGCTGGACTCTGG + Intronic
1175788841 20:61728968-61728990 TTTCCTCCCTGCAGTGACTCAGG + Intronic
1175844496 20:62051438-62051460 CTCCCTCCCCACAGGGCCCTGGG + Intronic
1179585677 21:42372717-42372739 CTTCATCACCTCAGGAACTCAGG + Exonic
1179658935 21:42862574-42862596 CTCCCTCCCCAGAGGGTCCCTGG + Intronic
1179800982 21:43811394-43811416 CTTCCCTCCCACAGGGTCTCAGG + Intergenic
1179879146 21:44286257-44286279 CTCCCTCCCCACAAGGAGCCAGG + Intronic
1180309755 22:11159202-11159224 GTTCCGCCCCACGGGGACTGGGG - Intergenic
1180548232 22:16521012-16521034 GTTCCGCCCCACGGGGACTGGGG - Intergenic
1181486020 22:23232246-23232268 CTAGCACCTCACAGGGACTCGGG + Intronic
1182095540 22:27622998-27623020 CTTCCTCCCCACTGGGGTTGGGG - Intergenic
1182951495 22:34380477-34380499 GTTCCTTCCCACACTGACTCTGG + Intergenic
1183080437 22:35452386-35452408 GCTCCACGCCACAGGGACTCTGG + Intergenic
1183469887 22:37999586-37999608 CTTCCCCTCCCCAGGGCCTCAGG + Intronic
1183485846 22:38087332-38087354 CATCCTCCCCTCAGGGTCACTGG + Intronic
1183803424 22:40187635-40187657 CCTCCACCACACAGGGACGCTGG - Intronic
1184416586 22:44355406-44355428 CTTCCTCCCCCAAGGGACACTGG + Intergenic
1184866490 22:47204484-47204506 CCTCCTCCCCACAGGCACACAGG + Intergenic
1184895233 22:47402866-47402888 AGCCCTCCCCACAGGGCCTCGGG + Intergenic
1185146579 22:49140209-49140231 TGTCCCACCCACAGGGACTCGGG + Intergenic
950138959 3:10602003-10602025 CTTCTTCACCACTGGGCCTCAGG - Intronic
950270899 3:11614098-11614120 CCTCCTCCCCACACACACTCTGG + Intronic
950408114 3:12817080-12817102 CTTCCTTGCCACAGTGACCCAGG + Exonic
952301762 3:32109637-32109659 CAACCTCCCCAGAGGGATTCAGG + Intronic
953149497 3:40310924-40310946 CTTACTCCCGGCAGGGACTGAGG + Exonic
953545060 3:43858225-43858247 CTTCATCTCTACAGGGATTCTGG + Intergenic
954493347 3:50929312-50929334 CTTCTTCCCCACAGTGACACTGG + Intronic
954621774 3:52000560-52000582 CATCTTCCCCACAAGGCCTCAGG + Intergenic
955338128 3:58103945-58103967 CTTCCTTCCCACAGAGGGTCTGG + Exonic
957916419 3:86693448-86693470 CATCATCCCCACAGAGACCCAGG - Intergenic
961696338 3:128707893-128707915 CATCCTCCCCCCAGGGAAGCTGG + Intergenic
961744783 3:129057552-129057574 CTTCCTGACCACAGGGGCACGGG + Intergenic
962389179 3:134957391-134957413 CTTCATCCCCTCAGGCACCCAGG - Intronic
966454622 3:180101298-180101320 CTTCCTGCCTACATGGACTCTGG + Intergenic
966724711 3:183099243-183099265 CGTCCTCCCCACACCGACCCTGG + Intronic
968277345 3:197450513-197450535 CTTCCTCCACAAAGGGGCCCTGG - Intergenic
968290222 3:197533294-197533316 CTTCCTCCCCACATGGATGGGGG + Intronic
969071870 4:4546239-4546261 TTTTCCCCCCTCAGGGACTCTGG + Intergenic
969102286 4:4778203-4778225 CTTCCTCCAGGCAGTGACTCAGG + Intergenic
969293474 4:6255320-6255342 CTTCCTCCACATGGTGACTCAGG + Intergenic
970014952 4:11503255-11503277 CTTCCTTACCACAGGGACATTGG - Intergenic
970145514 4:13031652-13031674 CTCCCTCCCCACAAGGAATAGGG + Intergenic
971268046 4:25111903-25111925 TTACCTCCCCACAGGGTCACTGG - Intergenic
971913615 4:32829061-32829083 TTTCTTCCCCAAAGGGAGTCTGG + Intergenic
972148907 4:36064642-36064664 GTCCCTCCCCACAGGGAACCAGG - Intronic
972312191 4:37891486-37891508 CTTCCTCCCCCGAGAGACCCTGG - Intronic
972321661 4:37977702-37977724 CGTCCTCCCCACAGGGATCTGGG - Intronic
973246695 4:48017209-48017231 CGTCCTTCTCAGAGGGACTCGGG - Intronic
975738137 4:77401614-77401636 CTCCCTCACCACTGGGACTCAGG - Intronic
976689752 4:87856040-87856062 CTGGCTCCCCACATGGTCTCTGG - Intergenic
977011678 4:91643057-91643079 CCTCCTCCCCACAGGGACATTGG - Intergenic
978940386 4:114429288-114429310 ACTCCTCCCCTTAGGGACTCAGG + Intergenic
979653476 4:123163669-123163691 CTCCCTTCCCTCAGGGACTGTGG - Intronic
981491602 4:145346250-145346272 CCGCCTGCCCCCAGGGACTCCGG - Intergenic
984092145 4:175387568-175387590 GTCCCTCCCCTCAGGGGCTCAGG - Intergenic
984715068 4:182917467-182917489 CTCCCTCCCCTCAGGGCTTCGGG - Intronic
984877980 4:184386322-184386344 CTTCTTCCCAACACAGACTCAGG - Intergenic
985611354 5:891422-891444 CTCCCTCCTCACAGAGACCCTGG + Intronic
985682343 5:1263013-1263035 CTCCCTCCCCACAAGGATGCCGG - Intronic
985793768 5:1947090-1947112 CTGCCTCCTCCCAGGGGCTCTGG + Intergenic
986307881 5:6528981-6529003 CTTCCCACCCACCTGGACTCAGG + Intergenic
987283941 5:16437641-16437663 TTTCCTACCCACAGGGACTCAGG - Intergenic
990620075 5:57550067-57550089 ACTCCTCCCCACAGGGGCTCAGG + Intergenic
992358540 5:76011174-76011196 TTTACTTCCCACAGAGACTCTGG + Intergenic
994187414 5:96830759-96830781 CTTCCTCTCCAGAGGCAATCAGG - Intronic
995715711 5:115080328-115080350 CTTCCTCCCCAAAGAAACTGGGG - Intergenic
996083999 5:119285390-119285412 ACTCCTTCCCACAGGGACCCAGG - Intronic
997677547 5:135724541-135724563 CCTCCACCCCACAGGAACCCTGG + Intergenic
998441873 5:142169434-142169456 CCTCCTCCCCACAGGGGTTGTGG + Intergenic
999802347 5:155049784-155049806 CTTCCTCACCACAGAGAGGCTGG + Intergenic
1001454068 5:171847412-171847434 CTTTCTCCCAATAAGGACTCTGG + Intergenic
1002195828 5:177500783-177500805 CTCCCTCCACACATGGAATCTGG - Intergenic
1002982827 6:2158824-2158846 CTTCCTCCCCACAGTGTCCACGG + Intronic
1003191301 6:3877741-3877763 CTTCCTCCACATAAGGACACAGG - Intergenic
1003405525 6:5824315-5824337 CCTCAGCACCACAGGGACTCAGG - Intergenic
1003957454 6:11177014-11177036 CTTTCTCCCCACAAAGACTAAGG - Intergenic
1006129674 6:31861874-31861896 CCTCTACCCCTCAGGGACTCAGG + Intronic
1006132667 6:31878505-31878527 CCTCCTCCTTACAGGGACCCTGG + Intronic
1006501019 6:34458823-34458845 CTTCCTTCCCCCAGGGTCTGGGG + Intergenic
1007119340 6:39367304-39367326 CTCCATCCCCACGGGGACTCTGG + Intronic
1007575926 6:42925247-42925269 GTTCCTCCTCGCAGGGACACCGG + Exonic
1007613788 6:43168298-43168320 CTTTGTCACCACAGGGAGTCAGG - Intergenic
1007643729 6:43364245-43364267 CGTCCTCTGCACAGAGACTCTGG - Intronic
1007723299 6:43898906-43898928 CTTCCCTCCCACAGTAACTCTGG + Intergenic
1007951620 6:45877776-45877798 CCTCCTCCTCAAAGGGGCTCTGG - Intergenic
1012476124 6:99616281-99616303 CTTCCTCCCCATATACACTCTGG + Intergenic
1012929073 6:105298150-105298172 CTTCTTCACAACAGGGACTGGGG - Intronic
1013617453 6:111858226-111858248 CTGCCTCCTCTCTGGGACTCTGG - Intronic
1014143003 6:117965549-117965571 CTCCCTCCCCAAAAGGATTCTGG + Intronic
1015251947 6:131135901-131135923 CCTCCTTCCCAAAAGGACTCAGG + Intronic
1016978311 6:149830744-149830766 CTTCCTCTCCCCAGGGAATAAGG - Intronic
1017456259 6:154604012-154604034 CTTCCTCCCCTAAGCGCCTCTGG - Intergenic
1017958925 6:159204926-159204948 CTTCATCCCCCCAGGGAAGCAGG - Intronic
1018721900 6:166579391-166579413 CTTCCTCCCCAGATGGCCTGTGG - Intronic
1018907751 6:168085220-168085242 CTGGCTCCCCACAGGCCCTCAGG - Intergenic
1020152744 7:5696149-5696171 CTTCGTCACCACATGGACTGTGG - Intronic
1023131367 7:37006359-37006381 CTTAATCCCCACAGTGACTCTGG + Intronic
1027946289 7:84749372-84749394 CTTTCACAACACAGGGACTCAGG + Intergenic
1028231515 7:88311256-88311278 CTTTCTCCTCACAGTGACCCAGG - Intergenic
1028518021 7:91699066-91699088 CACCCTCCCCATAGGGGCTCAGG - Intronic
1029186613 7:98743502-98743524 TTTCCTCCACACAGTCACTCAGG + Intergenic
1029515519 7:101020844-101020866 CTTCATGGCCACAGGGACCCCGG + Intronic
1029707806 7:102284967-102284989 CCTCCTGCCCTCAGGGACCCAGG + Intergenic
1029733379 7:102452057-102452079 CTGCTGCCCCACAGGGACTTGGG - Exonic
1032691891 7:134295428-134295450 CCTCCTCCAGAAAGGGACTCTGG + Intronic
1037553903 8:20003919-20003941 GTTCCTACCCACACTGACTCTGG - Intergenic
1037752826 8:21693703-21693725 CTGCCTCCTCACTGGGACGCAGG - Intronic
1038017978 8:23530557-23530579 CTAACTCCCCACTGGGACACTGG - Intronic
1038481079 8:27902224-27902246 CAGCCTCCCCTCAGGGACTGAGG - Intronic
1040743456 8:50610385-50610407 CTTCCTCCCCACTGTGATTTGGG + Intronic
1041800325 8:61791045-61791067 CTTGCTCCACACAAGCACTCAGG + Intergenic
1043233361 8:77830424-77830446 ACTCCTCCCCCTAGGGACTCAGG - Intergenic
1043761555 8:84075400-84075422 CTTCCTCCACAGAGTGGCTCTGG - Intergenic
1045248483 8:100463628-100463650 CTTCCTCCACCCAGCTACTCAGG - Intergenic
1045381989 8:101636373-101636395 CTTACTCCCCAAAGGGGCCCGGG - Intronic
1046779118 8:118196177-118196199 CTGCCTCCGCTCAGGGTCTCAGG - Intronic
1048236172 8:132692809-132692831 TTTCCTCCCCTCAGGGAAACAGG - Intronic
1048572467 8:135667184-135667206 CTCCCTGCCCACTGGGCCTCAGG + Intergenic
1048841751 8:138572755-138572777 CTTCCTCCTCACCTGGACTCAGG + Intergenic
1049012073 8:139893927-139893949 CTCCCTGCCCACAGGGGCACGGG + Intronic
1049614981 8:143572158-143572180 CTCCCTCCTCCCAGGAACTCTGG + Exonic
1049942684 9:563250-563272 CTTCCTGGCAACAGAGACTCTGG - Intronic
1051186098 9:14462738-14462760 GTTCCTGACCACAGGGACTATGG + Intergenic
1053367991 9:37537436-37537458 CATCCTCACCGCTGGGACTCAGG + Exonic
1053536069 9:38927585-38927607 CTTCCTCCGGATAGGGACTAGGG - Intergenic
1056449709 9:86705017-86705039 CTTCCTTCCCTCTGGGCCTCAGG + Intergenic
1057229277 9:93309020-93309042 CTTCCGCCCCACATTGGCTCAGG - Intronic
1058618499 9:106860796-106860818 GCTCCTCCCCACCGGGACCCGGG - Intergenic
1061730675 9:132611523-132611545 CTTCCTCTCCCCAGGACCTCTGG + Intronic
1061973471 9:134056760-134056782 CTCCCTCCCCACTGGGACTCTGG - Intronic
1061975088 9:134064015-134064037 CTGCCTCCTCACAGGGCCTTCGG - Intronic
1062239481 9:135527962-135527984 CGTCCTCCCCACTGTGCCTCGGG + Intergenic
1062243605 9:135552404-135552426 CTTCCCCCACACAAGGGCTCTGG + Intergenic
1062444097 9:136586141-136586163 CTCCCTCCACACAGGGCCTGAGG + Intergenic
1062708645 9:137959895-137959917 CCTCCTCCGGACAGGGGCTCTGG - Intronic
1186795663 X:13044481-13044503 CCTCTTCCCCAAAGGGCCTCTGG + Intronic
1187979139 X:24736285-24736307 CTTCCTATCCACAGGAACTCAGG - Intronic
1190300884 X:49056800-49056822 ATTCTTCCCCACAGGAAGTCAGG - Intronic
1191955500 X:66639019-66639041 CTTGCTCCCAAATGGGACTCCGG + Intronic
1197848787 X:130834231-130834253 CTGCCTCCTCTCAGGTACTCAGG + Intronic
1197886845 X:131227250-131227272 CTTCCTCCCATTAGGGAGTCAGG + Intergenic
1198631719 X:138646447-138646469 CTTCCTACCCTCTGGAACTCAGG - Intronic
1198756582 X:139988483-139988505 CTTCCTTCCCACAGGCACTGGGG - Intergenic
1199679812 X:150216706-150216728 TTTCCTCCCCAGAGGAACACTGG + Intergenic
1199695416 X:150340343-150340365 TTTCCTCCCCAGAGGAACACTGG - Intergenic
1199863380 X:151821757-151821779 CCTCCTCCCCTCAGGGCCTTGGG - Intergenic
1199966205 X:152823317-152823339 CTTCCTCCCCTCCGGCTCTCTGG + Intergenic
1199972361 X:152870757-152870779 CTCACTCCCCACAGGAAATCAGG - Intergenic
1202585353 Y:26418638-26418660 CTGCCTCACCACAAGAACTCTGG - Intergenic