ID: 1139490547

View in Genome Browser
Species Human (GRCh38)
Location 16:67283749-67283771
Sequence GCTCAGAGGAGAGGTCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139490542_1139490547 -2 Left 1139490542 16:67283728-67283750 CCCTTGGGTCTTGGGCCTGGAGC 0: 1
1: 0
2: 0
3: 23
4: 180
Right 1139490547 16:67283749-67283771 GCTCAGAGGAGAGGTCTAGCTGG 0: 1
1: 0
2: 6
3: 27
4: 204
1139490543_1139490547 -3 Left 1139490543 16:67283729-67283751 CCTTGGGTCTTGGGCCTGGAGCT 0: 1
1: 0
2: 2
3: 20
4: 280
Right 1139490547 16:67283749-67283771 GCTCAGAGGAGAGGTCTAGCTGG 0: 1
1: 0
2: 6
3: 27
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139490547 Original CRISPR GCTCAGAGGAGAGGTCTAGC TGG Intronic
900123793 1:1060599-1060621 GCTCAGAGAAGAGGTGGCGCTGG + Intergenic
902211440 1:14907641-14907663 GCTCAGAGGAGACTTCTTTCCGG - Intronic
903474651 1:23611134-23611156 GGGCAGAGGAGAGTTCTAGAGGG + Intronic
905323538 1:37134176-37134198 GCTCAGCAGAGAGGTCTGTCAGG - Intergenic
905626864 1:39495170-39495192 GCTGATAGGAGAGGTGGAGCTGG - Intronic
905670069 1:39785599-39785621 GCTGATAGGAGAGGTGGAGCCGG + Intronic
905790007 1:40784604-40784626 GGTCAGAAGCGAGGTCAAGCAGG - Intronic
907172347 1:52480077-52480099 GGTCAGGAGAGAGGTCTGGCTGG + Intronic
907436143 1:54449545-54449567 GCTCAGAGGAGGGGTCTGGGTGG - Intergenic
908246088 1:62228630-62228652 GCTCAGAGGGGAGGTCAGGCGGG + Intergenic
910124838 1:83829353-83829375 GCTCAGGGCAGGGGTCTGGCTGG - Intergenic
911332551 1:96542021-96542043 GCTCACAGGTGAATTCTAGCCGG + Intergenic
911455166 1:98113116-98113138 CCTCACAGGAGAGTTCTAGAAGG + Intergenic
911735434 1:101331587-101331609 GCTCAGAGGAGAGGTCTGGGTGG + Intergenic
912575316 1:110665610-110665632 GCTCAGGGGAGAGATCTAGCTGG + Intergenic
913464303 1:119123906-119123928 GCTCAGGAGAGAGGTATAGATGG - Intronic
913566088 1:120074029-120074051 GCTCAGTGGAAGGGTCTGGCTGG - Intergenic
913632043 1:120719524-120719546 GCTCAGTGGAAGGGTCTGGCTGG + Intergenic
914286676 1:146233388-146233410 GCTCAGTGGAAGGGTCTGGCTGG - Intergenic
914547707 1:148684129-148684151 GCTCAGTGGAAGGGTCTGGCTGG - Intergenic
914618804 1:149386225-149386247 GCTCAGTGGAAGGGTCTGGCTGG + Intergenic
915341508 1:155179160-155179182 GCTCAGAAGAGAGATTTAGGAGG - Intronic
918573039 1:186021414-186021436 GCTCAAAGGAGAGTTCTGGCTGG + Intronic
923334056 1:232951444-232951466 GGTCAGATGAGAGGTGTAGGAGG + Intronic
923436538 1:233972679-233972701 ATTCAGAGGAGAGGTCAAGATGG + Intronic
923622183 1:235588154-235588176 CCGCAGAGGAGAGTTCTGGCTGG + Intronic
924797518 1:247302699-247302721 GCTCAGAGAAGCTGTCTGGCTGG - Intronic
1063588339 10:7373073-7373095 GCTGGGAGCTGAGGTCTAGCAGG + Intronic
1065003415 10:21357774-21357796 TCTCAGGGGTGAGGTCTAGCAGG - Intergenic
1065244085 10:23740116-23740138 GCTCAGGGGAGAGGTCAGGCTGG + Intronic
1070493983 10:77004533-77004555 GCCCAGAGGAGAGCTCTTCCTGG - Intronic
1070517124 10:77218536-77218558 GCTCAGAGGAGACTTCTACTGGG - Intronic
1071296651 10:84225410-84225432 GCTCAGAGGAGAGTTTTGGCAGG - Exonic
1071531166 10:86391281-86391303 GCTCAGAGGAGGGGTCAGGCTGG + Intergenic
1072791559 10:98321651-98321673 GCCCACAGGAGAGGTCTCCCGGG - Intergenic
1074930583 10:118121387-118121409 TGTCAGAGGAGAGCTCTATCAGG + Intergenic
1076117219 10:127908644-127908666 GGTCAGAGGCGAGGTGGAGCAGG + Intronic
1076473527 10:130736554-130736576 GCTCAGGAGAAAGGTCTAGAAGG - Intergenic
1077889820 11:6410990-6411012 GCTCAGAGTACAGGTGTATCAGG + Exonic
1078437637 11:11338638-11338660 GCCAAGAGGAGATGTCCAGCTGG + Intronic
1078546353 11:12249757-12249779 ACTCAGCGGAGAAGTGTAGCCGG + Intronic
1085474934 11:76783593-76783615 ACCCAGGGGAGAGGTCTTGCGGG + Intronic
1085737745 11:79054033-79054055 GCTCAGTGGAGAGATCCAGGTGG + Intronic
1088651183 11:111959020-111959042 GCTCAGAGGAGACGTGCAGTGGG - Intronic
1088686247 11:112286732-112286754 GCACAGAGGAGAGGTCTCAGGGG + Intergenic
1089274991 11:117328603-117328625 GCTCAGGAAAGAGGTCTGGCTGG - Intronic
1089587928 11:119521761-119521783 GCTGAGAGGAGAGGTCTGGAGGG + Intergenic
1090905802 11:131073655-131073677 GCTCAGAGGAGGGTTCTCTCAGG + Intergenic
1091528616 12:1332539-1332561 ACCCAGAGCAGAGGCCTAGCAGG - Intronic
1097905839 12:64918963-64918985 GCACAGAGGAGAGCACCAGCTGG + Intergenic
1099412201 12:82344845-82344867 GCTCTGAGGAGAGGACTACATGG + Intronic
1105986386 13:25571285-25571307 GCTCAGAGGAGATGTTTGGTGGG + Intronic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1107922227 13:45221026-45221048 GCTCAGGAGAGAGGTCTAGAGGG - Intronic
1108096253 13:46904450-46904472 GCTCAGAGGACAGATCTAACAGG - Intergenic
1111742816 13:92225981-92226003 TGTCAGAGGAGAGGCCTAGTGGG + Intronic
1112207326 13:97337583-97337605 GCTCAGAGGAGAGGTTGGGCTGG - Intronic
1112470745 13:99686347-99686369 GCTCAGAGGGGAGGTGGTGCTGG - Intronic
1113456137 13:110450304-110450326 GATCAGAGGAGAGGCCTGCCGGG + Exonic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115945343 14:38653629-38653651 GTTCAGGTGAGAGGTCTGGCTGG - Intergenic
1117191588 14:53297756-53297778 GTTCAGAGGACAAGTCTAGCTGG + Intergenic
1117619040 14:57565325-57565347 GATCTAAGGAGAGGTTTAGCTGG - Intronic
1117665574 14:58052777-58052799 GCTCAAAGGAGAGGCAGAGCTGG - Intronic
1118410042 14:65469608-65469630 GCTCAGAGGAGAGCTGCAGAGGG + Intronic
1119142007 14:72275873-72275895 CCTCACAGGAGAGGGTTAGCTGG + Intronic
1120676036 14:87422660-87422682 TCTCAGAGGAAAGTTCTAGAAGG - Intergenic
1121310303 14:92932180-92932202 GCTCAGAGGGGTGGGTTAGCTGG - Intronic
1125826640 15:42682117-42682139 GCTCAGAGAAGAGACCTGGCTGG + Exonic
1126386177 15:48095678-48095700 GCTCAGAGCAGACATCAAGCTGG - Intergenic
1128637006 15:69309072-69309094 GCTCAGAAGAGAGGCCTGGTTGG + Intronic
1133213381 16:4275378-4275400 GATCAGAGGTGAGGTGTGGCAGG - Intergenic
1136275603 16:29177699-29177721 GCTCAGAGGACACATCCAGCCGG - Intergenic
1137605095 16:49781882-49781904 GCTCAGATGGGAGGTAGAGCTGG - Intronic
1137745515 16:50817403-50817425 GCTCAGAGGAAAGGCATGGCGGG + Intergenic
1138205038 16:55118587-55118609 GCAGAGAGGAGAGGCCTGGCTGG + Intergenic
1139490547 16:67283749-67283771 GCTCAGAGGAGAGGTCTAGCTGG + Intronic
1140961637 16:79918329-79918351 GCTCAGTGGAGAGGCCTGGTAGG - Intergenic
1142623071 17:1177292-1177314 GCTTAGTGGAGAGCTGTAGCAGG - Intronic
1143982494 17:10882055-10882077 ATTCAGGAGAGAGGTCTAGCAGG + Intergenic
1144295383 17:13870305-13870327 ACTCAGAGGGGAGGTCTGGGTGG - Intergenic
1144824406 17:18097791-18097813 GCTGACAGGAGAGGTGTCGCAGG - Intronic
1149490608 17:57082474-57082496 GCTCAGAGGAGTGGTCTGAATGG - Intergenic
1149633876 17:58150478-58150500 GTTCAAGGGAGAAGTCTAGCTGG + Intergenic
1151801387 17:76381922-76381944 GCCCAGAGGGGAGCTCTGGCTGG + Intronic
1151919451 17:77142202-77142224 TCTCAGAGGAGAGGTCATGGTGG - Intronic
1153061709 18:1001782-1001804 GCTCAGAGGAGAGGTCCGGCTGG + Intergenic
1156661239 18:39349125-39349147 ACTCAGTGAACAGGTCTAGCTGG + Intergenic
1157439173 18:47697034-47697056 GCGCAGAGGAGAGGGCGGGCAGG - Intergenic
1160040627 18:75342140-75342162 GCTCAGAGCAGAGGGCAAGCTGG - Intergenic
1160062739 18:75547748-75547770 GCACAGAGAAGAGGTCCAGCTGG - Intergenic
1160877757 19:1305088-1305110 GCTCAGTGGTGAGGTCTGGGGGG - Intergenic
1161666724 19:5581638-5581660 GGTCAGAGGAGACCTCTTGCAGG + Intergenic
1162464602 19:10832323-10832345 GCTCAGAAGAAAGGTCGTGCGGG - Intronic
1165747387 19:38238040-38238062 GGTCAGAGAAGAGGTCAGGCTGG + Intergenic
1166679606 19:44758771-44758793 GGTCAGGGGAGGGGTCTGGCTGG - Exonic
1167066105 19:47187242-47187264 GCTCAGAGGAGTGACATAGCTGG - Intronic
1202632820 1_KI270706v1_random:15962-15984 GCTCAGAGGAGACGTGCAGTGGG + Intergenic
926438478 2:12861758-12861780 GCTCTAAGGAGAGGTCCACCGGG + Intergenic
927078895 2:19608533-19608555 GCTCACAGGAGAGGCATGGCAGG - Intergenic
927481744 2:23459327-23459349 GCTCAGAGGAGAGGTGGGACTGG + Intronic
927495963 2:23552064-23552086 GCTCAGAGGGGAGGTCTTCTGGG - Intronic
929446953 2:42009342-42009364 ACTCAGAGGGGTGGTCTATCTGG - Intergenic
930122272 2:47769828-47769850 TCTCAGAGGAAAGGGCCAGCAGG - Intronic
930800607 2:55438810-55438832 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
930946207 2:57079134-57079156 TGTCAGAGGAGGGGTCTAGTGGG + Intergenic
931080835 2:58768574-58768596 GCTCCTTGGAGAGGTCAAGCAGG + Intergenic
931189821 2:59989523-59989545 GCTCTGATGAGATGTCCAGCTGG - Intergenic
932488163 2:72099168-72099190 GTTCAGAAGAGAGGTCCAGGCGG + Intergenic
932492989 2:72133315-72133337 GCACAGAGGAGAGGTGTTGTTGG + Intronic
932823089 2:74917884-74917906 GTTCAGAGGAGAGTTCAGGCTGG + Intergenic
932879235 2:75485010-75485032 TCTCAGAAGAGAGGTTTATCTGG - Intronic
933157995 2:78995003-78995025 GCTCACAGCAGTGGTCTAGGAGG - Intergenic
935725656 2:106021742-106021764 GTTCAGAGCAGAGTTTTAGCAGG + Intergenic
935921615 2:108021901-108021923 ACTCAGAGTAGAGGGCTTGCTGG - Intergenic
937469632 2:122164158-122164180 GTTCAATGGAGAGGTCAAGCTGG + Intergenic
937666642 2:124495520-124495542 GGCCAGAGGAGAGGTCATGCAGG + Intronic
938057947 2:128231192-128231214 ACTCAGAGGAGTGGGCTTGCAGG + Intergenic
943029836 2:182672003-182672025 ATTTAGAGGAGAGGTTTAGCGGG - Intergenic
943703912 2:191014884-191014906 GCCCAGAGGAGAGGTGTGGACGG - Intronic
944534660 2:200697018-200697040 GCTCAGAGGAGAGGTCAAGGTGG + Intergenic
944961445 2:204879243-204879265 TCTCAGATGACAGGTCAAGCAGG + Intronic
948016591 2:234696175-234696197 TCTCAGAGGAAAGGGATAGCAGG - Intergenic
948641740 2:239379518-239379540 GCTCCCAGGAGGGGTCTGGCAGG + Intronic
949058623 2:241943614-241943636 GCTCAGAGGAGAGCACTCCCCGG + Intergenic
1169884722 20:10386201-10386223 GTTCAAAGAAGAGTTCTAGCAGG - Intergenic
1170004232 20:11647480-11647502 GCTCAGAGGAAACCTTTAGCAGG - Intergenic
1171349787 20:24493799-24493821 GCTCAGAGGGGAGGCATGGCCGG + Intronic
1172129377 20:32645550-32645572 GTGCAGGGGAGAGGTCTCGCAGG - Intergenic
1173642429 20:44613420-44613442 GCTCAGAAGAGAGGTGGAGTGGG - Intronic
1173718604 20:45233270-45233292 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
1174114092 20:48214930-48214952 TCTCAGTGGAGATGTCAAGCTGG + Intergenic
1176645034 21:9341842-9341864 GCTCAGAGGAGACGTGCAGTGGG + Intergenic
1177963967 21:27704012-27704034 GCTCGGAGGAGAGGTCTGAGAGG - Intergenic
1178095659 21:29212393-29212415 GCTTAGAAGGGAGCTCTAGCTGG + Intronic
1178313916 21:31553718-31553740 GCTCAGAGGAGAGGTTTTGCAGG + Intronic
1178511104 21:33205834-33205856 GCTCAGACGAGAGGTCTGGCTGG - Intergenic
1180131608 21:45830331-45830353 GCTCAGAGGAGCGGCCTAAGAGG - Intronic
1180367917 22:11957392-11957414 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
1181279310 22:21707463-21707485 GCTCAGGTGAGAAGTCTACCAGG - Intronic
1183581372 22:38728496-38728518 TCTCAGAGCAGAGGTCTGGTTGG + Intronic
949272225 3:2231329-2231351 GCTCAGAGAAGAGGACTGGGAGG + Intronic
949688114 3:6601080-6601102 GCTCAGAGCAGAGGGCTAGATGG + Intergenic
952269313 3:31816759-31816781 GCTCAGAGGAGACCCGTAGCGGG + Intronic
953578716 3:44134363-44134385 TCTCAGAGCAGAGCTCCAGCAGG + Intergenic
953900074 3:46834940-46834962 GCTCAGAGGAGTGGGCGAGCAGG + Intergenic
954423337 3:50430335-50430357 GCTCAGAGGAGAGGCCATGGGGG - Intronic
956967077 3:74474412-74474434 GTTCAGGGCAGAGGTCAAGCTGG + Intronic
959875769 3:111380290-111380312 TCCCACAGGAGAGGTCTGGCTGG + Intronic
961429828 3:126873641-126873663 GCTCAGTGGTGATGCCTAGCAGG - Intronic
963120098 3:141769075-141769097 GTTCAGAGGAGAGGTCTGGAGGG - Intergenic
966265125 3:178031094-178031116 GGTCAGAGGAAAGGTATAGAAGG - Intergenic
967510351 3:190304084-190304106 TCTGAGAGGAGAGTCCTAGCAGG - Intergenic
1202741857 3_GL000221v1_random:63226-63248 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
968593341 4:1470619-1470641 GCTCAGGGGAGAGAACAAGCAGG + Intergenic
968659378 4:1792947-1792969 GCTCAGAGGGGAGGTCTCGGCGG - Intergenic
968899871 4:3426055-3426077 GCACAGGGGAGAGGGCGAGCGGG + Intronic
968978296 4:3833362-3833384 GCCTAGAGGAGAGGTCTTGTGGG - Intergenic
972323285 4:37992219-37992241 CGGCAGAGGAGAGGTCTTGCTGG + Intronic
975307802 4:72868606-72868628 TCACAGAGGAGAGCTCCAGCTGG + Intergenic
975588607 4:75977678-75977700 GTTCAAAGAAGAGTTCTAGCAGG + Exonic
978550445 4:109919713-109919735 GATCAGAGGAGAGCTCTTGATGG + Intronic
984325254 4:178242448-178242470 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
989412328 5:41134492-41134514 GCTCAGGGGAGAGAAATAGCTGG - Intergenic
992401279 5:76414026-76414048 GCTCAGCTGAGAGGACTAACTGG + Intronic
994245344 5:97470825-97470847 GCTCAGAGGAGATGTGCAGTGGG + Intergenic
995622218 5:114039085-114039107 GCTCAGAGGGGATGTCCAGTGGG + Intergenic
996116828 5:119629253-119629275 GCTCAGAGGAGGGGTATGGCAGG - Intronic
996282054 5:121741915-121741937 GCTCCAAGGAGAGGTCTACATGG - Intergenic
998052240 5:139045576-139045598 GCTCAGGGGAGAGGTTGGGCTGG - Intronic
1000163673 5:158626374-158626396 GTTAAGAGGAGAGGGCTGGCGGG + Intergenic
1001244833 5:170098277-170098299 ACTGATAGGAGAGGTCCAGCTGG + Intergenic
1002617234 5:180463564-180463586 GCCTGGTGGAGAGGTCTAGCAGG + Intergenic
1004017565 6:11746206-11746228 ACTCAGAGGAGAAATCCAGCTGG + Intronic
1004518454 6:16340477-16340499 GCATATAGGAGAGGTCTAGAGGG - Intronic
1006168775 6:32081317-32081339 GCTCACAGGATGGGGCTAGCAGG + Intronic
1006294458 6:33163886-33163908 GCTCAGAGGAGAGGTGAGCCTGG - Intronic
1009045862 6:58237204-58237226 TCCCTGAGGAGAGATCTAGCAGG + Intergenic
1009221678 6:60991517-60991539 TCCCTGAGGAGAGATCTAGCAGG + Intergenic
1010404014 6:75482063-75482085 GCTCAGAGAAGAGGACAAGGGGG - Intronic
1010795761 6:80114800-80114822 GTTCAGAGGAGAGGCCTGGCTGG + Intronic
1011553703 6:88552669-88552691 GGTCAGAGAAGACGTCAAGCAGG - Intergenic
1011738484 6:90335841-90335863 GATCAGATGAGAGGTTTGGCTGG + Intergenic
1013797597 6:113904549-113904571 AATCAGAGGAGAGGTCTGGCAGG - Intergenic
1013847465 6:114471407-114471429 GCTCAGTGGAGATGTCTGGCTGG - Intergenic
1014138845 6:117918093-117918115 GGTCAGAGGAGTGGTGCAGCTGG + Intronic
1015061905 6:128976373-128976395 GCTCAGGGGAGAACTCTAGCTGG + Intronic
1015238215 6:130994750-130994772 GCTCAAAGGAAAAGTCAAGCTGG + Intronic
1016063153 6:139651100-139651122 GCTCCCAGGAGAGGTTCAGCAGG - Intergenic
1020977331 7:15022965-15022987 CCTCAGGGGATGGGTCTAGCTGG - Intergenic
1021939503 7:25665711-25665733 GCTCAGAGGAGAGCCTAAGCTGG + Intergenic
1022163981 7:27740141-27740163 GCTGGGAGGGGAGGTGTAGCCGG + Intronic
1023296252 7:38717798-38717820 GCTCAGAGCAGAGCTCCAGGGGG + Intergenic
1024737272 7:52319317-52319339 GTTCAGAGGAGAGGTCTTTTAGG - Intergenic
1025611720 7:63080586-63080608 GATCACAGGTGAGGTCTGGCCGG - Intergenic
1026907703 7:74072129-74072151 GCTCAGGGGAGCGGTCATGCTGG - Intergenic
1028160521 7:87479483-87479505 GCTCACAGGAGGGATCCAGCAGG - Intronic
1028371191 7:90094226-90094248 TCCCCAAGGAGAGGTCTAGCTGG - Intergenic
1032551341 7:132787128-132787150 CCTGAGGGGAGAGGCCTAGCTGG + Intronic
1035495514 7:159322131-159322153 GCTCAGAGGAGTGAGGTAGCAGG + Intergenic
1036222290 8:6930869-6930891 GCTCAGAGGAGAGGTTCTGCTGG - Intergenic
1036482809 8:9153058-9153080 GCTCAGAGGAGGGCTTTACCAGG + Intronic
1037101294 8:15050315-15050337 GTTCAGAGGAGAGGTTTATGTGG + Intronic
1038303778 8:26381071-26381093 GTTCAAAGAAGAGTTCTAGCAGG + Intergenic
1039776900 8:40746127-40746149 GCTCAGAGGAGAGATTTGGGTGG - Intronic
1041056034 8:53987182-53987204 GCCCAGAAAAGAAGTCTAGCGGG - Intronic
1041287376 8:56274259-56274281 TCACAGAGGAGAGCTCTGGCTGG + Intergenic
1042336996 8:67639863-67639885 GCTCAGAGGAGACCTATAGTGGG + Intronic
1043235179 8:77855872-77855894 GATCAGAGGATATGTCTAGATGG + Intergenic
1043876863 8:85494912-85494934 GCTCAGAGCAGAGGTTCAGCTGG + Intergenic
1044008637 8:86965802-86965824 GCTCAGAGGAGACCTGCAGCAGG + Intronic
1045290609 8:100829537-100829559 GCACAGAGGTGAGGACAAGCAGG - Intergenic
1045622953 8:104004124-104004146 GCTAAGAGGAAATATCTAGCAGG + Intronic
1046721057 8:117619606-117619628 GCTCAGAGGTGATGTCAAGTAGG - Intergenic
1048288546 8:133162156-133162178 GTTCAGAGGAGAGGCCTGGGTGG + Intergenic
1048926705 8:139278111-139278133 GCAGAGAGGAGAGGTCTCCCGGG - Intergenic
1049224354 8:141442532-141442554 GCACAGAGGTGGGGTCAAGCTGG + Intergenic
1049251048 8:141589113-141589135 GCTTTGAGGAGTGGTCTTGCCGG + Intergenic
1049289566 8:141794596-141794618 GTTGGGAGGAGAGGCCTAGCAGG + Intergenic
1050377552 9:4988169-4988191 GCTAAGAGGAGGGGTCTAAAAGG - Intronic
1055058269 9:72043416-72043438 GCCCAGGGGAGAGATCTGGCTGG - Intergenic
1057829396 9:98395397-98395419 GCTGAGGGGAGAGGTGTGGCTGG + Intronic
1058558967 9:106203633-106203655 TCACAGAGGAGAGCTCTGGCTGG - Intergenic
1059171139 9:112126280-112126302 GCTCAGTGGAGAAGTCTGGGAGG + Intronic
1060733680 9:126052975-126052997 GAGCAGAGGCGAGGTCCAGCTGG + Intergenic
1062386537 9:136313942-136313964 GCTCAGGGGAGAGCTCTGGCAGG + Intergenic
1062546334 9:137065210-137065232 GGTCAGAGAGGAGGTCCAGCCGG + Intronic
1203710487 Un_KI270742v1:93150-93172 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
1185702952 X:2245093-2245115 GCTCAAAGGAAAAGTCCAGCTGG + Intronic
1188317320 X:28690561-28690583 GTTTAGAGTAGAGGTCTGGCTGG - Intronic
1191243928 X:58211079-58211101 TCTAACAGGAGAGATCTAGCTGG + Intergenic
1192206950 X:69102683-69102705 GCTCAGGGGAGAGGGCTGGGTGG - Intergenic
1192384816 X:70656902-70656924 TCTCAGAGGGGAGCTCTAGTGGG - Intronic
1192779887 X:74283205-74283227 GCTGAGAGGAGAGGGGAAGCAGG + Intergenic
1194985120 X:100481798-100481820 TCTCAGAGGAGAGGTCAAATAGG - Intergenic
1195504297 X:105639338-105639360 GCCCAGTGGAGAGTTATAGCAGG - Intronic
1195837242 X:109130372-109130394 GCTCAGAGGAAATGTTTAGATGG + Intergenic
1198235261 X:134731023-134731045 ACTCAGAGGAGAGCTTTAGGAGG - Intronic