ID: 1139492765

View in Genome Browser
Species Human (GRCh38)
Location 16:67295423-67295445
Sequence CTAGCCTCTGAGACTGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139492765_1139492770 -4 Left 1139492765 16:67295423-67295445 CCGGACTCAGTCTCAGAGGCTAG 0: 1
1: 0
2: 2
3: 17
4: 328
Right 1139492770 16:67295442-67295464 CTAGGTCTTTGCGAAGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
1139492765_1139492768 -9 Left 1139492765 16:67295423-67295445 CCGGACTCAGTCTCAGAGGCTAG 0: 1
1: 0
2: 2
3: 17
4: 328
Right 1139492768 16:67295437-67295459 AGAGGCTAGGTCTTTGCGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1139492765_1139492767 -10 Left 1139492765 16:67295423-67295445 CCGGACTCAGTCTCAGAGGCTAG 0: 1
1: 0
2: 2
3: 17
4: 328
Right 1139492767 16:67295436-67295458 CAGAGGCTAGGTCTTTGCGAAGG 0: 1
1: 0
2: 1
3: 6
4: 84
1139492765_1139492769 -8 Left 1139492765 16:67295423-67295445 CCGGACTCAGTCTCAGAGGCTAG 0: 1
1: 0
2: 2
3: 17
4: 328
Right 1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139492765 Original CRISPR CTAGCCTCTGAGACTGAGTC CGG (reversed) Intronic
903335923 1:22624493-22624515 CCAGCTACTGAGACTGAGGCAGG + Intergenic
905964180 1:42076868-42076890 CTGGCCTCATAGAATGAGTCAGG + Intergenic
906230994 1:44164267-44164289 CTTGCCTCTGTGACTGATGCTGG + Intergenic
906556364 1:46717957-46717979 CTGGACTCAGAGTCTGAGTCGGG + Exonic
906793741 1:48680524-48680546 CTATCCTCTGGGACAGGGTCGGG - Intronic
907027434 1:51134984-51135006 CTGGCCTCATAGAATGAGTCAGG - Intronic
907605214 1:55809796-55809818 CTAGCCTCATAGAATGAGTTTGG - Intergenic
909058154 1:70846609-70846631 CAACCCTCAGAGACTGAGTTGGG - Intergenic
909460279 1:75904367-75904389 CTAGCCTCATAGAATGAGTTTGG + Intronic
910396085 1:86795117-86795139 CCAGCCTCAGAGACTGAGGCAGG + Intergenic
910995466 1:93100172-93100194 CTTGCCTCTGAGAGTAAGACTGG + Intronic
914994436 1:152529729-152529751 CTAGCCTCATAGAATGAGTTGGG + Intronic
915320961 1:155056259-155056281 CTGGCCTCTCTGGCTGAGTCTGG - Intronic
916386999 1:164285162-164285184 CTAGCCTCGTAGAATGAGTTAGG - Intergenic
916603524 1:166317535-166317557 CTAGCCTCATAGAATGAGTTAGG + Intergenic
916891736 1:169118420-169118442 CTAATCTCAGAGCCTGAGTCTGG + Intronic
916984263 1:170173961-170173983 CTAGCCTCATAGAATGAGTTGGG - Intergenic
918315740 1:183321333-183321355 CTAGCCTCTGAGGCTTCCTCTGG - Intronic
918539487 1:185614097-185614119 CTAGCCTCATAGAATGAGTTTGG + Intergenic
918765485 1:188477251-188477273 CTGGCCTCTGAGAATGAGTTAGG + Intergenic
919093721 1:193004308-193004330 CTGGCCTCATAGAATGAGTCAGG - Intergenic
919142494 1:193589912-193589934 ACAGCCTCTCAGACTCAGTCTGG - Intergenic
919987459 1:202685884-202685906 AGAGCCTCTGAGACTGTGTCCGG - Intronic
920777781 1:208957044-208957066 CTAGTCTCAGAGAATGAGTTAGG - Intergenic
921229255 1:213051588-213051610 CTCGGCTCTGAGCCAGAGTCAGG - Intronic
921241809 1:213192388-213192410 CTAGCCTCATAGACTGAGTTTGG + Intronic
922287119 1:224180372-224180394 CTAGCCTGTGTGACAGAGTGAGG - Intronic
924126520 1:240858993-240859015 CTAGCCTCATAGAATGAGTTAGG + Intronic
924515790 1:244764679-244764701 CTAGCCTCATAGAATGAGTTTGG + Intergenic
1062894567 10:1092966-1092988 CCAGCCTCAGAGAATGAATCAGG - Intronic
1062965094 10:1600995-1601017 TCAGCCTCTGAGACTGAGCAAGG - Intronic
1066138591 10:32478808-32478830 CTGGCCTCATAGAATGAGTCAGG + Intronic
1067070218 10:43125659-43125681 CCAGCCTCTGAGACATAGTATGG - Intronic
1068448125 10:57150000-57150022 CTGGCCTCATAGAGTGAGTCTGG - Intergenic
1068462663 10:57347922-57347944 CTGGCCTCACAGAATGAGTCAGG + Intergenic
1069234723 10:66056535-66056557 CTAGCCTCATAGAATGAGTTAGG + Intronic
1069667053 10:70170012-70170034 GTAGACTCGGAGACTGAGGCTGG - Intronic
1069667654 10:70174254-70174276 CCAGCATCTGAGACTGTGTCAGG - Intergenic
1071469341 10:85970304-85970326 GTAGCCTCTTAGAATGAGTTTGG - Intronic
1072843427 10:98800861-98800883 CTAGCCTCACAGAATGAGTTTGG - Intronic
1074374316 10:112926761-112926783 CCAGCCTCTGAGACTTTGTGTGG + Intergenic
1074535771 10:114327914-114327936 CTAGCCTCGGAGGCTGGGCCTGG - Intronic
1077756099 11:5029289-5029311 CTAGCCTCATAGAATGAGTTGGG - Intergenic
1078296273 11:10073693-10073715 CTAGCCTGGGAGACAGAGTGCGG + Intronic
1078714468 11:13826732-13826754 CTAACCTCAGAGATTGGGTCAGG + Intergenic
1079240160 11:18716780-18716802 CTCGCCGCTGTCACTGAGTCTGG + Exonic
1079552215 11:21714375-21714397 CTAGGCACTAAGACTCAGTCAGG + Intergenic
1079847790 11:25491695-25491717 CTGGCCTCATAGACTGAGTTAGG + Intergenic
1080789087 11:35504384-35504406 CTAGCCTCATAGAATGAGTTTGG + Intronic
1081012901 11:37838195-37838217 TTACCCTCTGTGACTGTGTCTGG - Intergenic
1081502833 11:43682985-43683007 CCAGCCTCTGAAACAGAGTGAGG - Intronic
1081591545 11:44426575-44426597 CTGCCCTCTGGGGCTGAGTCTGG - Intergenic
1081861499 11:46335703-46335725 TTCGGCTCTGAGACTGAGACTGG - Intronic
1084366159 11:68700941-68700963 CTGGCCTCATAGAATGAGTCAGG - Intergenic
1086568825 11:88259582-88259604 CTGACCTCTTAGAATGAGTCAGG + Intergenic
1087055118 11:93927276-93927298 CTAGCCTCACAGAATGAGTGAGG - Intergenic
1087213360 11:95466576-95466598 CTAGCCTCATAAACTGAGTTGGG + Intergenic
1088086062 11:105981870-105981892 CCTGCCTGTGAGACTGAGTTAGG + Exonic
1088985540 11:114903606-114903628 CTAGCCTCATAGAATGAGTTTGG - Intergenic
1090627884 11:128621826-128621848 CTAGTCTCTGAGTTTGATTCAGG - Intergenic
1090864347 11:130684398-130684420 CTAGCCTCATAGATTGAGTTAGG + Intronic
1091122548 11:133068157-133068179 CTAGGCTGTGATACTGAGCCTGG - Intronic
1093339548 12:17955249-17955271 ATAGTCTGTGAGGCTGAGTCTGG + Intergenic
1093646661 12:21593748-21593770 CTGGCCTCAGAGAATGAGTTAGG - Intronic
1094542647 12:31375212-31375234 CTAGCCTGGGAGACAGAGCCAGG + Intergenic
1094815809 12:34182375-34182397 CTAGCCTCAAAGAATGAGTTTGG + Intergenic
1095364454 12:41385801-41385823 CTAGCCTCATAGAATGAGTTAGG - Intronic
1095636386 12:44438976-44438998 GAAGTCTCTGAGACTGATTCTGG + Intergenic
1095695200 12:45136095-45136117 CTAGCCTCATAAAATGAGTCAGG - Intergenic
1096257528 12:50072471-50072493 GGAGCCTCAGAGACTGAGGCCGG + Intronic
1097554523 12:61120715-61120737 CTAGCCTCATAGAATGAGTTAGG + Intergenic
1097785328 12:63752646-63752668 CTAGTTTCTGAGACTAGGTCTGG + Intergenic
1098059942 12:66551186-66551208 CTAGCCTCTACCACAGAGTCTGG - Intronic
1098510228 12:71303504-71303526 ATAGCCACTCAGACTGACTCTGG - Intronic
1099696855 12:86034257-86034279 CTAGCCTCCTAGAATGAGTTAGG + Intronic
1100036960 12:90263458-90263480 CTAGCATCTGAGATTGAGTGTGG - Intergenic
1100942178 12:99735747-99735769 CTAGCCTCATAGAATGAGTTAGG - Intronic
1101982765 12:109421935-109421957 CTAGCTACTCAGACTGAGGCAGG - Intronic
1102291208 12:111701633-111701655 CTAGCCTGGGTGACTGAGTGAGG + Intronic
1104786287 12:131451172-131451194 CTGGCCTCAGAGAATGAGTTAGG + Intergenic
1107404959 13:40103428-40103450 CCAGCCTCAGAGACTGTTTCAGG + Intergenic
1108155015 13:47575925-47575947 CTAGCCCCTGAGGCTGAGCGGGG + Intergenic
1110377658 13:74812553-74812575 CTAGCCTCAAAGAATGAGTTTGG - Intergenic
1112394322 13:99014560-99014582 CTACCATCTGAGACTGAGAAGGG - Intronic
1113179745 13:107611909-107611931 CTTTCTTCTGAGACAGAGTCTGG - Intronic
1116156941 14:41217721-41217743 CTAGCCTCATAGAATGAGTTAGG - Intergenic
1116294668 14:43091603-43091625 CTGGCCTCTTAGAATGAGTTAGG + Intergenic
1117506380 14:56407312-56407334 CTAGCTTCAGAGAATGAGTTAGG - Intergenic
1117945637 14:61016950-61016972 CTAACTTCTGAAAGTGAGTCTGG + Intronic
1118114886 14:62764011-62764033 CTAGCCTCATAGAATGAGTTAGG - Intronic
1119433308 14:74582311-74582333 CTGACCACTGAGGCTGAGTCTGG + Intronic
1120868569 14:89317187-89317209 CTGGCCTCTGACAGTGAGTGAGG + Intronic
1121035486 14:90699936-90699958 CAAGCCTCTGAAACGGAGCCTGG + Intronic
1121104247 14:91270496-91270518 CTAGCCTGGGAGACAGAGTGAGG - Intergenic
1121130761 14:91444586-91444608 CTGGCCTCTTAGAATGAGTTTGG - Intergenic
1122395997 14:101431907-101431929 CTAGCCTCACAGAGTGAGTTGGG + Intergenic
1125007508 15:34834708-34834730 CTAGCCTCTGAGAATGAGTTTGG - Intergenic
1126159881 15:45600808-45600830 CTAGCCTCATAGAATGAGTTGGG + Intronic
1126508989 15:49444706-49444728 CTAGCCTTTGAGACAGACCCCGG - Intronic
1126991542 15:54383177-54383199 CTAGCCTCATAGAATGAGTAGGG - Intronic
1127497247 15:59524697-59524719 CTGGACTCTGAGTCTCAGTCAGG + Intergenic
1128766607 15:70254901-70254923 CAAGCCTGTTAGACTGACTCAGG - Intergenic
1130419282 15:83726900-83726922 CTGGCCTCAGAGAATGAGTCTGG + Intronic
1130861025 15:87889717-87889739 CTACCCTTTGAGTCTAAGTCAGG - Intronic
1131639804 15:94280095-94280117 CTAGCCTCACAGAATGAGTTAGG + Intronic
1131658612 15:94488923-94488945 CTAGCCTCATAGAATGAGTTAGG - Intergenic
1131702780 15:94957380-94957402 CCAGCCACTGAGATTGTGTCTGG + Intergenic
1131768993 15:95714404-95714426 TTAGCCTCTGAGCCCGAGTGAGG - Intergenic
1132313015 15:100870851-100870873 CAAGCCACTCAGCCTGAGTCAGG + Intergenic
1132616931 16:845964-845986 CTAGCCTCGGTGACAGAGTGAGG - Intergenic
1133163076 16:3925163-3925185 CTAGCCTCGTAGAATGAGTTAGG - Intergenic
1136246560 16:28979459-28979481 CTGGGCTCTGAGGGTGAGTCTGG + Exonic
1136669068 16:31839631-31839653 CTAGCCTCACAGACTGTCTCTGG + Intergenic
1137249671 16:46732501-46732523 CAAGCCCCTGGGACTGAGCCCGG - Exonic
1137405375 16:48184877-48184899 CTAACCTCTGTGACTCACTCAGG + Intronic
1138711659 16:58976988-58977010 CTGGGCTTTGAGACTGAGTGAGG - Intergenic
1139492765 16:67295423-67295445 CTAGCCTCTGAGACTGAGTCCGG - Intronic
1140809992 16:78567726-78567748 CCTGCCTCTGTGGCTGAGTCGGG + Intronic
1142676332 17:1515878-1515900 CCATCCTCTTAGAGTGAGTCTGG - Intronic
1143049436 17:4111919-4111941 CCAGCTACTGAGACTGAGGCAGG + Intronic
1143049641 17:4113855-4113877 CCAGCGACTGAGACTGAGGCAGG + Intronic
1143193339 17:5056607-5056629 CCAGCCTCGGAGACAGAGTGAGG - Intergenic
1143256986 17:5565683-5565705 CTGGCCTCAGAGAATGAGTGTGG + Intronic
1144751313 17:17650290-17650312 CTAGCTTCTGAGGCTGAGGCAGG + Intergenic
1146379467 17:32318102-32318124 CTAGCTACTTAGACTGAGGCAGG + Intronic
1147477782 17:40729840-40729862 CTAGCCTGGGAGACAGAGGCAGG + Intergenic
1148043282 17:44725714-44725736 CTAGCCTCTGTGACTGAGTGTGG - Intronic
1149068783 17:52514458-52514480 CTAGCCTCATAGAATGAGTTGGG + Intergenic
1150024428 17:61657478-61657500 CTGTCCTCTTAGAATGAGTCAGG + Intergenic
1152958384 18:60068-60090 CTAGCCTCAAAGAATGAGTTTGG + Intronic
1155237585 18:23836526-23836548 TTTGCCTCTGAAACTCAGTCTGG - Intronic
1155597657 18:27506803-27506825 CTAGCCTCATAGAGTGAGTTTGG - Intergenic
1155764731 18:29614094-29614116 CTGGCCTCTTAGAATGAGTTAGG + Intergenic
1156396700 18:36705630-36705652 CTAGCCTCTGTGACAGAGCTAGG + Intronic
1156396985 18:36707525-36707547 CCATCCTCTGAGGATGAGTCAGG - Intronic
1157055735 18:44226372-44226394 CTAGCCTCATAGAATGAGTTAGG + Intergenic
1158263558 18:55635477-55635499 CCAGCCTGTGAGACAGAGTGAGG + Intronic
1159239178 18:65719136-65719158 CTGGCCTCTTAGAATGATTCAGG - Intergenic
1163758652 19:19121237-19121259 CTAGCCTCTGAGATTCAGGGAGG - Intronic
1164412916 19:28020685-28020707 CAAGCCTCTGACACTGTGACAGG + Intergenic
1165589794 19:36958280-36958302 CTGGCCTCATAGACTGAGTTAGG + Intronic
1166692125 19:44828719-44828741 CTAGCCTCGGCGACAGAGCCAGG - Intergenic
1166772736 19:45294152-45294174 CCAGCCACCGAGGCTGAGTCAGG - Intronic
1166800591 19:45454641-45454663 CTAGCCTGTGAAACTCAGGCTGG - Intronic
925278581 2:2667810-2667832 CTGAGCTCTGAGACTGAGGCTGG - Intergenic
927549896 2:23989166-23989188 CTGGCCTCATAGAATGAGTCTGG - Intronic
927844102 2:26462412-26462434 CTAGCATCTGAGACAGAGGGTGG - Intronic
928851696 2:35755502-35755524 CTGGCCTCATAGAATGAGTCTGG + Intergenic
929335976 2:40746212-40746234 GTAGCCTCTGATATCGAGTCAGG - Intergenic
930236852 2:48896854-48896876 CTAGCACCTGACACAGAGTCTGG - Intergenic
931122504 2:59235588-59235610 CTAGCCTCTAGGACTGTGACAGG - Intergenic
933020581 2:77185727-77185749 CTATCCCCTGAGAATTAGTCAGG + Intronic
934996303 2:98964172-98964194 CTAGCCTCATAGAATGAGTTGGG + Intergenic
935703272 2:105832809-105832831 CTGGCCTCTTAGAGTGAGTTAGG + Intronic
935803179 2:106719314-106719336 CTAGCCTCATAGAATGAGTTAGG + Intergenic
937978330 2:127594978-127595000 CTGGCCTCATAGAATGAGTCAGG + Intronic
938918649 2:135971081-135971103 CTGGCCTCTTAGAATGAGTTTGG - Intronic
939165404 2:138636292-138636314 CTGGCCTCAGAGACTCATTCAGG + Intergenic
939336102 2:140830247-140830269 CTGGCCTCTTAGAATGAGTTTGG - Intronic
939444984 2:142297962-142297984 CTAGCCTCATAGAATGAGTTAGG - Intergenic
939678174 2:145097836-145097858 CTGGCCTCTTAGAATGAGTTGGG + Intergenic
940685209 2:156840243-156840265 TTAGCCTATGATACTGAGTTAGG - Intergenic
940716358 2:157229451-157229473 CTGGCCTCAGAGAATGAGTTTGG + Intergenic
941674854 2:168332950-168332972 CAAGCCACTAAGACTGAATCAGG + Intergenic
941774751 2:169380753-169380775 CTAGCCTCACAGAATGAGTTAGG - Intergenic
942001193 2:171648721-171648743 CTGGCCTCATAGAATGAGTCTGG + Intergenic
942403512 2:175628667-175628689 TCAGGCTCTGAGACTGAGACTGG + Intergenic
944291420 2:198010655-198010677 CTAGCCTCATAGAATGAGTTTGG + Intronic
946968017 2:225059455-225059477 CTAGCCTCATAGAATGAGTTAGG + Intergenic
1169625233 20:7560024-7560046 CTAGCCTCATAGAGTGAGTTAGG + Intergenic
1170657389 20:18301901-18301923 CTGGCCTCACAGAATGAGTCAGG - Intronic
1171777666 20:29384385-29384407 CTAGCCTCAAAGAATGAGTTTGG + Intergenic
1171898862 20:30838124-30838146 CTAGCCTCAAAGAATGAGTTCGG - Intergenic
1172167162 20:32906488-32906510 AGAGCGTCTGAGACTGAGCCTGG - Intronic
1172473009 20:35214803-35214825 CTGGACATTGAGACTGAGTCGGG + Intergenic
1173337603 20:42125434-42125456 CTAACCACTGAGATTGAGCCTGG + Intronic
1173362219 20:42355042-42355064 CTTGCCTCTGAGAAGGAGTGGGG - Intronic
1175317215 20:58057094-58057116 GTGACCTCTGAGACTGAGGCAGG - Intergenic
1175434831 20:58937611-58937633 CTAGCCTGTGTGACAGAGTGAGG - Intergenic
1177097975 21:16862193-16862215 CTACTCTCTGAGAGTGAGTGGGG - Intergenic
1177644274 21:23882176-23882198 CTAGCCTGGGTGACTGAGTGAGG + Intergenic
1179306106 21:40155349-40155371 CTAGTCTGTGAGCCTGAGGCTGG + Intronic
1179781554 21:43704107-43704129 CCAGCTTCTGAGGCTGAGGCAGG + Intergenic
1179930205 21:44565348-44565370 CTAGCCTCATAGAATGAGTTAGG - Intronic
1180756457 22:18165285-18165307 CTGGCCTCAGAGAATGAGTTAGG + Intronic
1181075312 22:20372149-20372171 CTGGCCTCAGAGAATGAGTTAGG - Intronic
1182106910 22:27696111-27696133 CTAGTTTTTGAGACTGAGCCAGG - Intergenic
1182553942 22:31118758-31118780 CTAACCTTTTAGACTGACTCTGG - Intronic
1182950272 22:34368159-34368181 CTAGCCTCAAAGAATGAGTTAGG + Intergenic
1183261681 22:36799352-36799374 CTGGCCTCTGTGTCTGACTCAGG + Intergenic
1183514085 22:38253128-38253150 CTAGTTTTTGAGACTGCGTCTGG - Intronic
1184315086 22:43681459-43681481 CTGGCCTCAGAGAATGAGTCTGG + Intronic
950598290 3:14005843-14005865 CTGGCCTCTTAGAATGAGTTTGG + Intronic
953998873 3:47540849-47540871 CCAGGCTCTGGGACTGAGACTGG + Intergenic
954879810 3:53826254-53826276 TTAGCCTCACAGAATGAGTCAGG - Intronic
955924770 3:63994262-63994284 CCAGCCTCGGTGACTGAGTGAGG - Intronic
957087542 3:75696364-75696386 CTAGCCTCAAAGAATGAGTTTGG - Intergenic
957689642 3:83551311-83551333 CTAGCCTCATAGAATGAGTTAGG + Intergenic
958505140 3:94967246-94967268 GTAGATTCTGAGACTGAGTTTGG + Intergenic
958649845 3:96925151-96925173 CTGGCCTCATAGAATGAGTCAGG + Intronic
959190073 3:103099808-103099830 TTGGCCTCAGAGACTGAGTTTGG + Intergenic
959209711 3:103362174-103362196 CTAGCCTCATAGAATGAGTTAGG - Intergenic
960792181 3:121445113-121445135 CTGGCCTCACAGAATGAGTCTGG + Intronic
962038019 3:131674319-131674341 CTAGCCTCATAGAATGAGTTTGG + Intronic
962994181 3:140608868-140608890 CTAGCCTCCTAGAATGAGTTAGG - Intergenic
963459789 3:145596442-145596464 CTAGCCTCAGAGACTGAGATAGG - Intergenic
963676900 3:148323487-148323509 CTAGCCTCATAGAATGAGTTGGG + Intergenic
964269833 3:154943981-154944003 CTAGCCTCATAGAATGAGTTAGG - Intergenic
964349287 3:155787064-155787086 CTGGCCTCATAGACTGAGTTAGG - Intronic
965026471 3:163307975-163307997 CTAGCCTCAGAGAATGAGTTTGG - Intergenic
965649779 3:170921608-170921630 CTAGCCTCATAGAATGAGTTGGG - Intergenic
965705180 3:171499554-171499576 CTATCTTCAGAGAATGAGTCTGG - Intergenic
965726131 3:171718456-171718478 CTGGCCTCATAGAATGAGTCGGG - Intronic
967848839 3:194066381-194066403 CTGGCCTCATAGACTGAGTCTGG - Intergenic
969367186 4:6703318-6703340 CTTGCCTTTCAGGCTGAGTCAGG + Intergenic
969716000 4:8868392-8868414 CTGGCCTCAGTGATTGAGTCTGG - Intronic
971084875 4:23261881-23261903 CTAGCCTCATAGAATGAGTTAGG - Intergenic
971109525 4:23568519-23568541 CTAGCTTCATAGACTGAGTTTGG + Intergenic
972003162 4:34064872-34064894 TTGGCCTCTTAGACTGAGACAGG + Intergenic
974209483 4:58750980-58751002 CTATCCTCTGAGACTACTTCTGG + Intergenic
975894930 4:79077920-79077942 CTGGCCTCAAAGAATGAGTCAGG + Intergenic
975949478 4:79751296-79751318 CTGGCCTCAGAGAATGAGTTTGG - Intergenic
976371772 4:84298043-84298065 CTAGCCTCTTATAATGAGTTAGG - Intergenic
980686643 4:136238456-136238478 TTAGCCTCTTAAAATGAGTCTGG - Intergenic
982176396 4:152709271-152709293 CTTGCCTCTGTCACTGAGGCTGG - Intronic
982670105 4:158310560-158310582 CTAGCCTCACAGAATGAGTTGGG + Intergenic
985443437 4:190002437-190002459 CTAGCCTCAAAGAATGAGTTTGG + Intergenic
986884920 5:12222143-12222165 CTGGCCTCGTAGACTGAGTTTGG + Intergenic
987260752 5:16200051-16200073 CTAGCCTCATAGAATGAGTTAGG - Intergenic
988647860 5:33114788-33114810 CTAGCCTCACAGAATGAGTTAGG + Intergenic
989299463 5:39872326-39872348 CTAGCATCTTAGAATGAGTTAGG + Intergenic
989754110 5:44931692-44931714 CTGGCCTCATAGACTGAGTTTGG + Intergenic
990628944 5:57646276-57646298 CTAGCTTCAGAGAATGAGTTAGG + Intergenic
991106410 5:62848171-62848193 CTAGCCTTAGAGAATGAGTTAGG + Intergenic
992284376 5:75218581-75218603 CTAGCCTCCTAGAATGAGTTGGG - Intronic
992309884 5:75485989-75486011 CTAGCCTCATAGAATGAGTTTGG - Intronic
992794772 5:80245488-80245510 CTAGCCTATGAGACTGTGCCTGG - Intronic
994144829 5:96383345-96383367 CTATACCCTGAGACTGAGTGGGG + Intergenic
994178218 5:96735072-96735094 CTAGGGTGTGAGCCTGAGTCTGG - Intronic
995204811 5:109467534-109467556 CTAGACTTTGAGAGTGTGTCAGG + Intergenic
995219982 5:109637273-109637295 CTGGCCTCATAGAATGAGTCAGG - Intergenic
995695134 5:114870382-114870404 CTAGCCTCATAGAATGAGTTAGG - Intergenic
998275574 5:140749926-140749948 CTGGCCTCTTAGAATGAGTTAGG + Intergenic
998637640 5:143973588-143973610 CTTTTCTATGAGACTGAGTCTGG + Intergenic
998916632 5:147019824-147019846 CTAGCCTCGGAGGCTGAGAAAGG - Intronic
999541679 5:152581602-152581624 CTAGCCTCATAGAATGAGTTAGG + Intergenic
999567137 5:152876859-152876881 CTAGCCTCATAGAATGAGTTAGG - Intergenic
999938747 5:156516966-156516988 CTAGCCTGTGTGACAGAGTGAGG + Intronic
1000241724 5:159414914-159414936 CCAGCCTCTGAATCAGAGTCAGG - Intergenic
1003643952 6:7899140-7899162 CCAGCATCAGAGACTGACTCTGG - Intronic
1004548316 6:16621262-16621284 CTGGGCTCTGAGACTGAAGCAGG - Intronic
1004815080 6:19303971-19303993 CCAGCTTCTGAGATAGAGTCTGG - Intergenic
1004929817 6:20452056-20452078 CTAGCCTCATAGAATGAGTTGGG + Intronic
1004982809 6:21045437-21045459 CTAGCCCCTGACTCAGAGTCAGG - Intronic
1006280448 6:33048830-33048852 CTAGCCTCACAGAATGAGTTTGG + Intergenic
1007334610 6:41145024-41145046 CTAGCCTCATAGAATGAGTTAGG + Intergenic
1007431979 6:41781664-41781686 CTGGCCTCTAAGACTGGGCCAGG - Intronic
1007668608 6:43532704-43532726 CTTCCCTCTGAGACTGGGTTAGG + Intronic
1007964249 6:45988929-45988951 CAAGCCTCATAGACTGAGACTGG - Intronic
1008446229 6:51595250-51595272 CTAGCTTCTGACCATGAGTCAGG - Intergenic
1009597097 6:65749545-65749567 CTAGCCTCATAGAATGAGTTAGG - Intergenic
1009967804 6:70595193-70595215 CCAACCTCTGAGAGTGAGTGAGG - Intergenic
1010270131 6:73908518-73908540 ATAGCCTCTGACACTAAGACAGG - Intergenic
1014515574 6:122374448-122374470 CCACCCCCTGAGACTAAGTCAGG + Intergenic
1014968755 6:127789511-127789533 CTGGTCTCTGAAACTGAGTTAGG - Intronic
1015242914 6:131046056-131046078 TTAGCTTCGGAGACTGAGGCGGG - Intronic
1015247886 6:131095282-131095304 CTGGCCTCACAGAATGAGTCTGG - Intergenic
1016365380 6:143311081-143311103 CTGGCCTCAGAGAATGAGTTAGG - Intronic
1017811952 6:157989981-157990003 CCAGCCTCGGAGCGTGAGTCTGG + Intronic
1018536155 6:164822132-164822154 CTAGCCTCATAGAATGAGTTTGG - Intergenic
1018570545 6:165205170-165205192 CTGGCCTATGTGACTGAGTCTGG - Intergenic
1018671891 6:166185449-166185471 CTAGCCTCTTAAAATGAGTTAGG - Intergenic
1019768662 7:2869956-2869978 TTTTCCTTTGAGACTGAGTCTGG - Intergenic
1020214206 7:6177165-6177187 CTGGCCTCAGAGAATGAGTCGGG + Intronic
1020613517 7:10429938-10429960 CCAGCCTCTGAGACTGATCCAGG + Intergenic
1021492681 7:21236572-21236594 CTAGCCACTGCCACTGTGTCTGG + Intergenic
1021578765 7:22130050-22130072 GTTCCCTGTGAGACTGAGTCAGG - Intronic
1023878138 7:44302387-44302409 CTAGCCTCATAGAATGAGTTAGG - Intronic
1026665101 7:72335462-72335484 GTAGCCTCTGCGACAGAGTTGGG - Intronic
1027131938 7:75597428-75597450 CCAGCCTCTGAGGCTGGGTGCGG + Intronic
1028197346 7:87922100-87922122 TTTGCCTTTGAGACGGAGTCTGG - Intergenic
1029122931 7:98280875-98280897 CTGGCCTCGGGGACTGCGTCAGG - Intronic
1030115331 7:106058521-106058543 CTGGCCTCAGAGCCTGTGTCTGG - Intergenic
1031550276 7:123102488-123102510 CTGGCCTCAGAGAATGAGTTAGG - Intergenic
1032091169 7:128912390-128912412 TTAGCCTCTGCCACTGAGCCTGG + Intergenic
1033494025 7:141876094-141876116 CTAGCCTCATAGAATGAGTTAGG + Intergenic
1034230171 7:149518592-149518614 CTGGCCTCCTAGAATGAGTCTGG - Intergenic
1035308632 7:157951148-157951170 CTTGTCTCTGAGAGTGAGGCTGG - Intronic
1037155300 8:15692328-15692350 CTAGCCTCATAGAATGAGTTTGG + Intronic
1039056883 8:33544081-33544103 CTAGCCTGGGAGACAGAGTGAGG - Intergenic
1039663795 8:39497046-39497068 CTAGCCTCATAGAATGAGTTTGG - Intergenic
1040442918 8:47463510-47463532 CTAGCCTCAGGGAATGAGTTAGG - Intronic
1040483234 8:47845818-47845840 CTGGCTTCAGAGAATGAGTCAGG - Intronic
1040524981 8:48213955-48213977 CTGGCCTCATAGAATGAGTCAGG - Intergenic
1040961851 8:53042706-53042728 CTAGCCTCATAGAATGAGTTAGG + Intergenic
1042640011 8:70923453-70923475 TTTGCCTCTGAGAGTGAGACAGG - Intergenic
1044359663 8:91267262-91267284 CTAGCCTCATAGAATGAGTTTGG + Intronic
1044793825 8:95875749-95875771 CTAGCCTCATAGAATGAGTTAGG - Intergenic
1045154894 8:99456799-99456821 CTAGCCTCAAAGAATGAGTTGGG + Intronic
1045600087 8:103704472-103704494 CTAGCCTCATAGAATGAGTTTGG + Intronic
1045764436 8:105649886-105649908 CTGGCCTCATAGACTGAGTTAGG + Intronic
1045789805 8:105969878-105969900 CTTGCCTCATAGACTGAGTTGGG + Intergenic
1046453082 8:114419429-114419451 CTAGCCTCATAGAATGAGTTAGG - Intergenic
1046650851 8:116835215-116835237 CCACCCTCTCATACTGAGTCTGG + Intronic
1046656075 8:116896422-116896444 CTGGCCTCATAGAATGAGTCTGG - Intergenic
1048079882 8:131114625-131114647 CCAGCCTCATAGAATGAGTCTGG + Intergenic
1048380025 8:133857305-133857327 CAGGCCTCTGAGACTGCGTGGGG - Intergenic
1048582617 8:135742765-135742787 CTATCCTCAAACACTGAGTCTGG - Intergenic
1050686401 9:8174693-8174715 CTAGCCTCTGTTGCAGAGTCTGG - Intergenic
1051096624 9:13473796-13473818 CTGGCCTCATAGAATGAGTCAGG + Intergenic
1051914219 9:22188565-22188587 CTGGCCTCATAGACTGAGTTAGG - Intergenic
1052770380 9:32683297-32683319 CTAGCCTCATAGAATGAGTTTGG - Intergenic
1053324700 9:37133020-37133042 CCAGCCTCAGAGGCTGAGGCAGG + Intronic
1056479370 9:86985445-86985467 CCTGCCTCTGAGATAGAGTCTGG - Intergenic
1058199736 9:102024741-102024763 CTGGCCTCAGAGAATGAGTTAGG + Intergenic
1058549988 9:106104347-106104369 CTAGCCTCTAAAACAGACTCTGG + Intergenic
1060033736 9:120237158-120237180 ATATCATCTGAGACTGAGGCTGG - Intergenic
1060052244 9:120385720-120385742 CTAGCCCCTGAGGCAGAGTCCGG + Intergenic
1060508826 9:124217597-124217619 CTATCCTCTGAGACTGGGATGGG + Intergenic
1061391511 9:130319616-130319638 CCAGCCTCTGGGACTCAGGCTGG + Intronic
1203370618 Un_KI270442v1:300327-300349 CTAGCCTCAAAGAATGAGTTTGG + Intergenic
1185624116 X:1470678-1470700 CTAGCTTCTGTCACTGAGCCAGG + Intronic
1187003785 X:15210519-15210541 CTAGCCTCAAAAAGTGAGTCTGG + Intergenic
1187046885 X:15655701-15655723 CTAGCCACTGAGAGTGTATCTGG - Intronic
1188828753 X:34870208-34870230 CTGGCCTCTTAGAATGAGTTGGG - Intergenic
1188896179 X:35671169-35671191 ATAGCTTCTGAGACAGAGTAGGG - Intergenic
1189898065 X:45676608-45676630 CTGGCCTCTTAGAATGAGTTAGG - Intergenic
1190899427 X:54655301-54655323 CTGGCCTCGTAGACTGAGTTTGG - Intergenic
1191743378 X:64460085-64460107 CTGGCCTCAGAGAATGAGTTAGG + Intergenic
1191924274 X:66292474-66292496 CCAGCCTCTTAGAATGAGTTTGG + Intergenic
1192540782 X:71970250-71970272 CTGGCCTCACAGAATGAGTCTGG + Intergenic
1193440224 X:81531562-81531584 CTGGCCTCATAGAATGAGTCAGG + Intergenic
1193725857 X:85038398-85038420 CTAGCCTCATAGAATGAGTTAGG + Intronic
1193827796 X:86247678-86247700 CTGGCCTCATAGAATGAGTCAGG - Intronic
1193970373 X:88043416-88043438 CTGGCCTCATAGAATGAGTCAGG - Intergenic
1194073629 X:89360504-89360526 CTAGCCTCAGAAAATGAGTTTGG + Intergenic
1194324823 X:92501363-92501385 CTAGCCTCAGAGAATTAGTTAGG - Intronic
1194521880 X:94930011-94930033 CTAGCCTCGTAGAATGAGTTTGG + Intergenic
1194965413 X:100283117-100283139 CTAGCCTCATAGAATGAGTTTGG + Intergenic
1195601623 X:106755395-106755417 CTGGCCTCATAGAATGAGTCTGG - Intronic
1196271021 X:113710923-113710945 CTAACCACTGAGACTGAGCTGGG - Intergenic
1196510994 X:116512201-116512223 GTAGCCTCAGAGAATGAGTGAGG + Intergenic
1197016113 X:121627618-121627640 CTAGCCTCAAAGAATGAGTATGG - Intergenic
1197552136 X:127904287-127904309 CTGGCCTCATAGACTGAGTTGGG - Intergenic
1198404988 X:136303437-136303459 CTTTCCTTTGAGACAGAGTCTGG - Intronic
1199118800 X:144026045-144026067 CTAGCCTCATAGAATGAGTTTGG - Intergenic
1200633555 Y:5620539-5620561 CTAGCCTCAGAGAATTAGTTAGG - Intronic
1201067695 Y:10114739-10114761 CTAGCCTCAAAGAATGAGTTTGG - Intergenic