ID: 1139492769

View in Genome Browser
Species Human (GRCh38)
Location 16:67295438-67295460
Sequence GAGGCTAGGTCTTTGCGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139492765_1139492769 -8 Left 1139492765 16:67295423-67295445 CCGGACTCAGTCTCAGAGGCTAG 0: 1
1: 0
2: 2
3: 17
4: 328
Right 1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139492769 Original CRISPR GAGGCTAGGTCTTTGCGAAG GGG Intronic
902318306 1:15640856-15640878 GAGGCGAGGTCATTGCAAAAGGG + Intronic
905003800 1:34694468-34694490 GGGGCTTGGTCTTTGCAAGGTGG - Intergenic
909800176 1:79796851-79796873 GAGGCTAGGTCTTTAGGAAATGG + Intergenic
915324750 1:155075640-155075662 GAGGCTAGGGCCTGGGGAAGGGG - Intergenic
915449684 1:155995967-155995989 AAGGGTAGATCTTTGAGAAGAGG - Intronic
916660583 1:166919884-166919906 GAGGCAGGGTAATTGCGAAGGGG + Intronic
924910097 1:248500725-248500747 GAGGCTCGGTCTTTGTGTACTGG + Intergenic
924914005 1:248547322-248547344 GAGGCTCGGTCTTTGTGTACTGG - Intergenic
1064843863 10:19629120-19629142 GAGGCTTGCTTTTTGGGAAGGGG - Intronic
1066950828 10:42113870-42113892 GAGGGTTGGTGTTTGCAAAGGGG + Intergenic
1069870303 10:71528864-71528886 GATGATAGGTCTTTGAGCAGGGG + Intronic
1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG + Intronic
1097826360 12:64178545-64178567 GAGACTATGCCTTTGTGAAGTGG - Intergenic
1098152226 12:67558390-67558412 GACACTAGGTATTTGAGAAGTGG + Intergenic
1102242108 12:111331059-111331081 GAGCCTAGATGTTTGTGAAGGGG + Intronic
1102476606 12:113192698-113192720 ATGGCTAGGACTTTGCCAAGTGG + Intergenic
1104401827 12:128482752-128482774 GAAGCTGGGGCTTTGGGAAGAGG - Intronic
1105446937 13:20465692-20465714 AGGGCCAGGTCTTTGCCAAGAGG - Intronic
1107032674 13:35869369-35869391 GAGGCCAGGTCATTGCAAGGAGG + Intronic
1111866417 13:93774246-93774268 GAGGTTAGGTCTTCAAGAAGAGG + Intronic
1113374832 13:109755513-109755535 GAGGGAAGGGCTTTGGGAAGGGG - Exonic
1115500175 14:34042653-34042675 AAGGGTAGGACTTTGCCAAGGGG + Intronic
1126108961 15:45164735-45164757 GAGGCTAACTCTTTGCTCAGAGG - Intronic
1129319630 15:74767377-74767399 GAGGCTATGCCTTTCCTAAGAGG - Intergenic
1134266277 16:12695445-12695467 GAGACTCTGTCTTTGCGAAAAGG - Intronic
1134441296 16:14301289-14301311 GAGGCCAGATCTTTGCCAGGTGG + Intergenic
1135113955 16:19710478-19710500 GGGGCTAGGGCTCTGCGAGGAGG - Intronic
1136553526 16:30994649-30994671 GAGGCTGGGTGTTTGTGGAGAGG - Intronic
1136669147 16:31839949-31839971 GAGGCTAGGTCTTCGAGGGGTGG - Intergenic
1138725891 16:59138982-59139004 GAGGAAAGGCCTTTGCTAAGGGG - Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1141425041 16:83939410-83939432 AAGGCCAGGTGTTTGCAAAGAGG + Intronic
1143016228 17:3892596-3892618 GAGGCCACGTCTGTGCGGAGTGG - Intronic
1163131063 19:15273303-15273325 GAGGGTAAGTCTTTGGGGAGAGG - Intronic
1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG + Exonic
925776835 2:7344066-7344088 GAGGCATGGTCTTTGGGATGAGG + Intergenic
926206756 2:10839464-10839486 GAGGTGGGGTCTTTGAGAAGTGG - Intergenic
937237889 2:120441809-120441831 GAGGCCAGGTCTTTGGTATGGGG - Intergenic
943203451 2:184860242-184860264 GAGGCTTGGTCTGTGAGAACTGG + Intronic
943557329 2:189421641-189421663 GAGGCTAGGTCTGTGGGCACTGG - Intergenic
943878265 2:193102267-193102289 GAGGCTAGGTCTGGGAGGAGTGG + Intergenic
945278617 2:208013968-208013990 GAGCCTAGGTCTTTGTTAACTGG + Intronic
945928482 2:215830375-215830397 GAAGCTGTGTCTTTGCGAGGTGG - Intergenic
948364682 2:237447041-237447063 GAGGTGGGGTCTTTGGGAAGGGG - Intergenic
1168947549 20:1774041-1774063 GAGGCTGGGTCATGGAGAAGAGG + Intergenic
1174846688 20:53949602-53949624 GAGGCTTGGTCTTTGGAAAGCGG + Intronic
1176175450 20:63721096-63721118 AATGCTAGGACTTTGGGAAGTGG + Intronic
1184891215 22:47380553-47380575 GAGGCTAGGAGTTTGGGACGAGG + Intergenic
950490273 3:13300473-13300495 GAGGTTGGGTCTTTGGGAGGTGG - Intergenic
951263509 3:20540086-20540108 GCGGGTAGGTGTTTGGGAAGAGG + Intergenic
952217786 3:31295027-31295049 GAGGCTATGTCTGTGTGAAGGGG - Intergenic
954676359 3:52317832-52317854 GACGCTAGGCCGTTGCTAAGGGG - Intronic
955685094 3:61541313-61541335 GAGGCTAGATCATTTCCAAGAGG + Intergenic
956745388 3:72307087-72307109 GGGGCTAGAGCTTTGCAAAGCGG - Intergenic
957856936 3:85891588-85891610 GAGACGAGGTCTTTAAGAAGGGG + Intronic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
964359347 3:155878136-155878158 GAGGTGAGGTCTTTGGGAGGTGG - Intronic
964389556 3:156183269-156183291 GAGGTGAGGGCTTTGAGAAGGGG + Intronic
970644668 4:18106664-18106686 GAGGCTAGGCTTTCGGGAAGAGG + Intergenic
972362097 4:38336175-38336197 GAGGTGAGGTCTTTAAGAAGTGG + Intergenic
972580549 4:40392026-40392048 GTGGCCAAGTCTTTGCAAAGAGG - Intergenic
972878287 4:43393137-43393159 AAGGCTAGGTATTTACAAAGAGG + Intergenic
973886689 4:55329271-55329293 GAAGCTTGGACTTTGGGAAGGGG - Intergenic
978724325 4:111952496-111952518 GAGGCTATGTCATTGAGTAGGGG - Intergenic
981628280 4:146786897-146786919 GAGGCTAGGTGTTTGAGACCAGG + Intronic
987829859 5:23082136-23082158 GAGGCTAAGTCTTTTTGAATTGG - Intergenic
990516317 5:56534190-56534212 TAGCCTAGGGCTTTGGGAAGGGG - Intronic
992501074 5:77344641-77344663 GAGGCAGGGCCTTTGGGAAGTGG - Intronic
997370056 5:133353837-133353859 GAGGCCAGTTCTTTGAGCAGCGG + Intronic
997839265 5:137224087-137224109 GAGGCTGGTTCTTTGGAAAGAGG + Intronic
998744183 5:145238044-145238066 GAGGGTAGGTCTTTGTGAGAAGG - Intergenic
999180267 5:149665229-149665251 CAGGCTTGGTCCTTGGGAAGGGG - Intergenic
1013037834 6:106403905-106403927 GATGCTAGGAATTTGAGAAGGGG + Intergenic
1018753504 6:166828286-166828308 GAGGGCAGGTCTTTCAGAAGAGG - Intronic
1026505586 7:70979933-70979955 GAGCCTAGGTCTTGGCACAGTGG - Intergenic
1032206464 7:129870155-129870177 GAGGCCTGGTGTTTGAGAAGAGG - Intronic
1036614447 8:10377851-10377873 GAGGCGAGATCTGTGCAAAGTGG - Intronic
1040600465 8:48878788-48878810 GAGGCTAGGTCTTTAGGACCAGG + Intergenic
1050487211 9:6146955-6146977 GAGGCAAGGTGTTGGGGAAGGGG + Intergenic
1057992415 9:99784078-99784100 GCGGCTAGGTGCTTGGGAAGTGG - Intergenic
1060753701 9:126193111-126193133 GAGGCTAGGTCTTGGGTAAGTGG - Intergenic
1061615450 9:131775992-131776014 GAGGTTAGGTCTTGGGAAAGTGG - Intergenic
1062490835 9:136804165-136804187 GAGGCCAGGTTTTGGGGAAGAGG + Intronic
1186573434 X:10739911-10739933 GAGGCTAGGCCTTGGAGAATGGG + Intronic
1188446361 X:30256839-30256861 GAGGCTAGGGCTATGTGAATAGG + Intergenic
1199778117 X:151033460-151033482 GAGGGCAGGTCTCTGTGAAGAGG + Intergenic
1200926352 Y:8658412-8658434 GTGGCTAGGTATTTGGGAAGAGG - Intergenic
1200962757 Y:9010186-9010208 GAGGTTAGTTCTTTGAGAACTGG - Intergenic
1201677439 Y:16603247-16603269 GAAGCTTGGTCTTTGCTAATGGG - Intergenic