ID: 1139494121

View in Genome Browser
Species Human (GRCh38)
Location 16:67303506-67303528
Sequence ACTCCCTACCACACTCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139494121_1139494127 21 Left 1139494121 16:67303506-67303528 CCCTAAGGAGTGTGGTAGGGAGT 0: 1
1: 1
2: 0
3: 3
4: 112
Right 1139494127 16:67303550-67303572 TTTTCTTTTCTTTTTTGAGATGG 0: 251
1: 2795
2: 91877
3: 72665
4: 86595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139494121 Original CRISPR ACTCCCTACCACACTCCTTA GGG (reversed) Intronic
903686105 1:25133179-25133201 GCTCCCTTCCTCACTCATTATGG + Intergenic
904374745 1:30073383-30073405 AATCCTCACAACACTCCTTAAGG - Intergenic
905169496 1:36100830-36100852 ACTCCCTGCCACTCGCCTTTGGG + Intronic
906501222 1:46342822-46342844 ACTCCCCAGCACACCCCTTCTGG + Intronic
909840557 1:80316640-80316662 ACTCCCCACCATACCCCTTCAGG + Intergenic
911179335 1:94847351-94847373 CCTCCCTGCCACCCTCCTCAAGG - Intronic
911385831 1:97174372-97174394 ACTACCTACTCCACTCCTCAAGG + Intronic
911542193 1:99171035-99171057 AATACCTACCAGACTTCTTAAGG + Intergenic
913976832 1:143465905-143465927 AATCCCTAACAAACTCCTGAAGG + Intergenic
914071234 1:144291532-144291554 AATCCCTAACAAACTCCTGAAGG + Intergenic
914107921 1:144674823-144674845 AATCCCTAACAAACTCCTGAAGG - Intergenic
917139719 1:171823694-171823716 CCTCCCTACCTCTCTCCTTTTGG - Intergenic
919235023 1:194829712-194829734 CCTCCCTAACACATTCCATAAGG - Intergenic
923928105 1:238659044-238659066 ACTGACAAACACACTCCTTATGG - Intergenic
1065256661 10:23876325-23876347 CATCCCTTCCACCCTCCTTATGG - Intronic
1071246645 10:83772480-83772502 ACTCCACACCACAGTCCTTGAGG - Intergenic
1072452481 10:95549556-95549578 ACTCCCTACCAGACTGCATTAGG - Intronic
1075957287 10:126534937-126534959 ACTTCCCACCTCACTCCTTCAGG + Intronic
1083292038 11:61695840-61695862 ACACCCTACCTCATTCCTGAAGG - Intronic
1083626276 11:64073715-64073737 CCTCCCAAACACACTCCTTGGGG + Intronic
1091918202 12:4284111-4284133 ACTCCCCACCACAGTCCTGCAGG + Intronic
1092747636 12:11688702-11688724 ACACGCTACCACACTCCTCCTGG - Intronic
1096832561 12:54325617-54325639 ATTCCCTGCCACATTCCTTCAGG + Intronic
1100694782 12:97080719-97080741 ACTCCCCAGCACACACCCTAAGG - Intergenic
1101718736 12:107333114-107333136 ACCCCCTCCCTCATTCCTTATGG + Intronic
1102016661 12:109652516-109652538 ACTCCATTCCAAACTCTTTATGG - Intergenic
1110360604 13:74620702-74620724 ACTGCCTACAACTCTCCATATGG + Intergenic
1113877599 13:113604426-113604448 ACTCACACCCACACTCCTAAGGG + Intronic
1118526059 14:66645040-66645062 ACAACCTAACACACTCCTTTAGG - Intronic
1118888859 14:69890071-69890093 TCTGCCTACCACATTCATTAAGG + Intronic
1119345526 14:73920573-73920595 ATTCCCTGCCACCCTCTTTAGGG - Intronic
1119634828 14:76265248-76265270 ACTCCCTTCCTCATCCCTTAAGG - Intergenic
1120150834 14:81031871-81031893 ACTCCCTAGGACACACCTTCAGG + Intronic
1126533767 15:49738287-49738309 CCTCCCTAACACACTCCATGAGG + Intergenic
1128831295 15:70771831-70771853 AAGCCATACCACACTGCTTAGGG - Intergenic
1131621413 15:94071963-94071985 ACTCCCCACCACACCCCATGAGG + Intergenic
1137273679 16:46919432-46919454 GTTCCCCACCACACTCCTTCGGG - Intronic
1137870197 16:51942895-51942917 CCTCCCTTCCCCACTGCTTAAGG - Intergenic
1138411672 16:56845415-56845437 ACCCCCTTCCCCACTCATTAAGG + Intronic
1139494121 16:67303506-67303528 ACTCCCTACCACACTCCTTAGGG - Intronic
1141470539 16:84235323-84235345 CCTCCCTACCCCATTTCTTAAGG - Intronic
1143189622 17:5032027-5032049 ACCCCCTAGCACAGTCCCTAAGG - Intergenic
1147219321 17:38919316-38919338 TCTCCCTACCTCCCTCCTCAGGG + Exonic
1147459804 17:40560953-40560975 ACGCCCAACCACACTCTTCACGG + Intronic
1148102053 17:45098217-45098239 ACTCCCCACCACACTCCACCAGG - Intronic
1149199578 17:54167290-54167312 ACTCCCTTCCACACTGCATGGGG - Intergenic
1149412752 17:56425750-56425772 ACTCCCTGCCAGACTGTTTAGGG + Intronic
1149702873 17:58669921-58669943 ACTCCATCCCACGCTCCTTGAGG + Intronic
1150868560 17:68879836-68879858 ACTCCCTCCCACACTTGTCAGGG - Intronic
1152366396 17:79859130-79859152 CCTCCCTGCAACCCTCCTTATGG + Intergenic
1157116492 18:44867246-44867268 ATTCCCTACCTTTCTCCTTAAGG + Intronic
1158830942 18:61277838-61277860 ACTCCCTCCCTCACACCTTTTGG - Intergenic
1161379315 19:3956215-3956237 ACTCCCTACCAGACCCCCTAGGG - Intergenic
932498473 2:72159625-72159647 ACTCCCTCCAAGCCTCCTTAGGG - Intergenic
932594017 2:73083155-73083177 ACCCCAAGCCACACTCCTTATGG - Intronic
933846759 2:86332969-86332991 ACTCACTATCACAGTCCTAAGGG - Intronic
934030493 2:88041348-88041370 ACTCCCTACTTCTCTCCTTCTGG - Intronic
934181533 2:89626889-89626911 AATCCCTAACAAACTCCTGAAGG + Intergenic
934291836 2:91701109-91701131 AATCCCTAACAAACTCCTGAAGG + Intergenic
936267952 2:111024581-111024603 ACTCCTTACCACAATCCTAGTGG - Intronic
938661512 2:133491651-133491673 ACTCCCTCCCTCACTTCATAGGG - Intronic
939145062 2:138403695-138403717 ACTGCCTTCCACATTCCTTCTGG - Intergenic
944525827 2:200618679-200618701 ACTCACTACCCAACTACTTAAGG - Intronic
946386261 2:219386223-219386245 ACTGACTGCCACACTCCTCAGGG - Intronic
946916524 2:224528547-224528569 GTAGCCTACCACACTCCTTAAGG + Intronic
1173430435 20:42982924-42982946 ACTACCTCCCACATACCTTACGG + Intronic
1174264942 20:49324570-49324592 ACTCCTTACAACAGTCCTCAAGG + Intergenic
1174379293 20:50146452-50146474 ATTCCCAACCACAATCCTAACGG + Intronic
1180927073 22:19562875-19562897 AATTCCCACCACTCTCCTTAGGG + Intergenic
1182886327 22:33777278-33777300 ACTTCCTTCCACAGTCCCTAGGG + Intronic
1184379836 22:44138364-44138386 ACTCCCTTCCTCACTGCTCAGGG - Intronic
1184637369 22:45844242-45844264 ACTCCCTGCCACATTCCAAAGGG - Exonic
1185002477 22:48254293-48254315 ACTTCCTCCCTCACTCCTTCTGG - Intergenic
950425777 3:12924097-12924119 ACTCCCCACCACTCTCCCCAGGG + Intronic
954163442 3:48738373-48738395 TCTCCCTCCCTCCCTCCTTAGGG - Intronic
955378491 3:58417801-58417823 ATTCCCTCCCACCCTCCTTTGGG + Intronic
957086568 3:75684860-75684882 GTTCCCTACCACACTCCATCAGG + Intergenic
961209533 3:125115040-125115062 ACTCCCTTCCACACTCCTTATGG - Intronic
963764006 3:149314926-149314948 ACTCCCTTCCTCCCTCCTTCTGG - Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
971386058 4:26141355-26141377 ACTTCCTACCCCACTCCTGCGGG + Intergenic
972643157 4:40943560-40943582 TCTCCATACCAAACTCCTTGAGG + Intronic
977177926 4:93838526-93838548 ACTCCCTGCTTCACTCCTTGGGG - Intergenic
984749839 4:183261489-183261511 GCTCCCTAGCACATTCATTAAGG - Exonic
987240195 5:15988758-15988780 AGTCCCTACCAAAATCCTGATGG - Intergenic
988649190 5:33129820-33129842 ACTCTCTACCTCCCTCATTATGG + Intergenic
995133064 5:108650500-108650522 ACCCCCAGCCACACTCCTTTTGG - Intergenic
996327934 5:122297251-122297273 ACTCCCTACCACACTAACTTAGG - Intergenic
1003378873 6:5604273-5604295 ACTCCCATCTACACTCCTTGAGG + Intronic
1004334717 6:14754219-14754241 ACTCTCTAGCACAGTCATTATGG - Intergenic
1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG + Intronic
1007075766 6:39065235-39065257 CCTCCCTCCCACACTCCTTGGGG - Intronic
1010949090 6:82013757-82013779 ACCCCCTACCACACCCCTGTGGG - Intergenic
1013824729 6:114197627-114197649 ACTCCCTCCCTCCCTCCTTTTGG + Intronic
1016873599 6:148842576-148842598 ACTCCCCACCACCTTCCTTCGGG - Intronic
1017031257 6:150224871-150224893 CCTTACTACCACACTACTTAAGG - Intronic
1020128274 7:5545342-5545364 ATTCCCTGCCACACTGCTCACGG + Intronic
1024904921 7:54366521-54366543 ACTCTCAACCACACTCATTTTGG + Intergenic
1033412248 7:141128677-141128699 CCTCCCTACCACACTCATCGTGG - Intronic
1034842773 7:154414952-154414974 ACTCCCTTCCAAACTCCATCAGG - Intronic
1035887695 8:3309350-3309372 ACTGCCGACCACACTCCTGATGG + Intronic
1036917775 8:12821301-12821323 ACTCCCTCCCGCACTCTGTAGGG + Intergenic
1037514758 8:19619344-19619366 GCTCCCTTCCACACTCCTGTAGG - Intronic
1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG + Intronic
1046957845 8:120080108-120080130 CGTCCCTACCTCACTCCTTCTGG + Intronic
1048045445 8:130768342-130768364 AACCCTCACCACACTCCTTAAGG - Intergenic
1048420279 8:134271182-134271204 ACAACCTACCACAATCCTGAGGG + Intergenic
1052024684 9:23561463-23561485 TCTCCCTAGCACATTCCTGATGG + Intergenic
1053047497 9:34932001-34932023 ACTCCTTACCCCACACCATAAGG - Intergenic
1055167339 9:73212842-73212864 GTTCCCTACCACATTCCCTAGGG + Intergenic
1057664577 9:97034901-97034923 CCACCCTACCACCCTCCATAAGG + Intronic
1058268017 9:102931777-102931799 AATCCCTACTTCACTCCTTTGGG + Intergenic
1060963783 9:127700300-127700322 CCTCCCACCCACACCCCTTATGG + Intronic
1061378949 9:130242861-130242883 TCTCCCTACCTCACTCCCCAGGG + Intergenic
1061806186 9:133138971-133138993 ACTCCCTCCCACACTCACTGTGG + Intronic
1186155139 X:6717501-6717523 ACTTCCTACCAGACTCCTCCTGG + Intergenic
1196970983 X:121108411-121108433 ACTCCCTTCCTCCCTCCTTTTGG + Intergenic