ID: 1139496315 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:67321674-67321696 |
| Sequence | TCCTAATGAGGCGCTGCATG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 82 | |||
| Summary | {0: 1, 1: 2, 2: 5, 3: 8, 4: 66} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1139496315_1139496318 | 26 | Left | 1139496315 | 16:67321674-67321696 | CCACATGCAGCGCCTCATTAGGA | 0: 1 1: 2 2: 5 3: 8 4: 66 |
||
| Right | 1139496318 | 16:67321723-67321745 | TACCCTACGTTCTCCTACAACGG | 0: 1 1: 0 2: 0 3: 5 4: 57 |
||||
| 1139496315_1139496317 | -6 | Left | 1139496315 | 16:67321674-67321696 | CCACATGCAGCGCCTCATTAGGA | 0: 1 1: 2 2: 5 3: 8 4: 66 |
||
| Right | 1139496317 | 16:67321691-67321713 | TTAGGATGTGTCTGAAGTCTTGG | 0: 1 1: 0 2: 9 3: 19 4: 163 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1139496315 | Original CRISPR | TCCTAATGAGGCGCTGCATG TGG (reversed) | Intronic | ||