ID: 1139496315

View in Genome Browser
Species Human (GRCh38)
Location 16:67321674-67321696
Sequence TCCTAATGAGGCGCTGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 2, 2: 5, 3: 8, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139496315_1139496318 26 Left 1139496315 16:67321674-67321696 CCACATGCAGCGCCTCATTAGGA 0: 1
1: 2
2: 5
3: 8
4: 66
Right 1139496318 16:67321723-67321745 TACCCTACGTTCTCCTACAACGG 0: 1
1: 0
2: 0
3: 5
4: 57
1139496315_1139496317 -6 Left 1139496315 16:67321674-67321696 CCACATGCAGCGCCTCATTAGGA 0: 1
1: 2
2: 5
3: 8
4: 66
Right 1139496317 16:67321691-67321713 TTAGGATGTGTCTGAAGTCTTGG 0: 1
1: 0
2: 9
3: 19
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139496315 Original CRISPR TCCTAATGAGGCGCTGCATG TGG (reversed) Intronic