ID: 1139496316

View in Genome Browser
Species Human (GRCh38)
Location 16:67321686-67321708
Sequence ACTTCAGACACATCCTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 10, 3: 14, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139496316_1139496318 14 Left 1139496316 16:67321686-67321708 CCTCATTAGGATGTGTCTGAAGT 0: 1
1: 0
2: 10
3: 14
4: 120
Right 1139496318 16:67321723-67321745 TACCCTACGTTCTCCTACAACGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139496316 Original CRISPR ACTTCAGACACATCCTAATG AGG (reversed) Intronic