ID: 1139496318 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:67321723-67321745 |
Sequence | TACCCTACGTTCTCCTACAA CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 63 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 57} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1139496316_1139496318 | 14 | Left | 1139496316 | 16:67321686-67321708 | CCTCATTAGGATGTGTCTGAAGT | 0: 1 1: 0 2: 10 3: 14 4: 120 |
||
Right | 1139496318 | 16:67321723-67321745 | TACCCTACGTTCTCCTACAACGG | 0: 1 1: 0 2: 0 3: 5 4: 57 |
||||
1139496315_1139496318 | 26 | Left | 1139496315 | 16:67321674-67321696 | CCACATGCAGCGCCTCATTAGGA | 0: 1 1: 2 2: 5 3: 8 4: 66 |
||
Right | 1139496318 | 16:67321723-67321745 | TACCCTACGTTCTCCTACAACGG | 0: 1 1: 0 2: 0 3: 5 4: 57 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1139496318 | Original CRISPR | TACCCTACGTTCTCCTACAA CGG | Intronic | ||