ID: 1139496318

View in Genome Browser
Species Human (GRCh38)
Location 16:67321723-67321745
Sequence TACCCTACGTTCTCCTACAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139496316_1139496318 14 Left 1139496316 16:67321686-67321708 CCTCATTAGGATGTGTCTGAAGT 0: 1
1: 0
2: 10
3: 14
4: 120
Right 1139496318 16:67321723-67321745 TACCCTACGTTCTCCTACAACGG 0: 1
1: 0
2: 0
3: 5
4: 57
1139496315_1139496318 26 Left 1139496315 16:67321674-67321696 CCACATGCAGCGCCTCATTAGGA 0: 1
1: 2
2: 5
3: 8
4: 66
Right 1139496318 16:67321723-67321745 TACCCTACGTTCTCCTACAACGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139496318 Original CRISPR TACCCTACGTTCTCCTACAA CGG Intronic