ID: 1139496444

View in Genome Browser
Species Human (GRCh38)
Location 16:67322995-67323017
Sequence GTGAAGTAGTATTCTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139496444_1139496449 10 Left 1139496444 16:67322995-67323017 CCCACAACAGAATACTACTTCAC 0: 1
1: 0
2: 1
3: 19
4: 171
Right 1139496449 16:67323028-67323050 ATGGCTACAATGAAAACAATAGG 0: 1
1: 0
2: 5
3: 29
4: 327
1139496444_1139496446 -9 Left 1139496444 16:67322995-67323017 CCCACAACAGAATACTACTTCAC 0: 1
1: 0
2: 1
3: 19
4: 171
Right 1139496446 16:67323009-67323031 CTACTTCACACCCATTAGTATGG 0: 1
1: 17
2: 159
3: 729
4: 1874

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139496444 Original CRISPR GTGAAGTAGTATTCTGTTGT GGG (reversed) Intronic
905842642 1:41196986-41197008 GTGAAGTAGTATATCATTGTAGG - Intronic
907203737 1:52750954-52750976 GCTAAGTAGTATTCCATTGTGGG + Intronic
909447692 1:75766043-75766065 GTGAAGTCTGATTCTATTGTGGG - Intronic
913236366 1:116787029-116787051 GTGAAGTACTATTCTCTTCATGG - Intergenic
914326897 1:146626951-146626973 GTGAAGTAGTATCTCATTGTGGG - Intergenic
917923911 1:179773051-179773073 GAGAAGTAGTTTTTTGTTCTGGG + Intronic
918721262 1:187855001-187855023 CTGAACTAGTGCTCTGTTGTGGG - Intergenic
919955053 1:202405679-202405701 GTTAAGTAGTTTTGTGTTCTTGG - Intronic
1064813943 10:19234976-19234998 GGGAAGTAGCATGCTGATGTGGG + Intronic
1065399579 10:25282324-25282346 GCTAAGTAGTATTCCATTGTAGG + Intronic
1068441904 10:57067276-57067298 ATGAAGTAGTATAGTGTTATTGG - Intergenic
1069134983 10:64752605-64752627 GAGAAGAAGAATTCTGTTGAGGG + Intergenic
1071407259 10:85349592-85349614 GTGAAGTAGTAGTTGGTAGTTGG + Intergenic
1073874466 10:107906272-107906294 CAGAATTAGTATTCTGTTGGAGG - Intergenic
1074248632 10:111720391-111720413 GAGAATGTGTATTCTGTTGTGGG - Intergenic
1075004803 10:118822253-118822275 GTTGAGTAGTATTCCATTGTGGG - Intergenic
1078828733 11:14957210-14957232 GTTAAGTAGTATTTCATTGTTGG - Intronic
1079313588 11:19388718-19388740 GTGAAATCTTATTCTGTTGTAGG + Intronic
1081085729 11:38798014-38798036 GAGAGGTATTGTTCTGTTGTGGG - Intergenic
1081489614 11:43557255-43557277 GTGGAGAAGTATTCTGTAGTGGG + Intronic
1081943032 11:46961269-46961291 GTGAAGTAGTATCTCATTGTGGG + Intronic
1083403079 11:62437866-62437888 GTGTAGTAGTATCTTTTTGTGGG + Intronic
1084877431 11:72143405-72143427 GTGAAGGAGTCTCCTGTTCTTGG - Intergenic
1084882588 11:72182185-72182207 GTGAAGGAGTCTCCTGTTCTTGG - Intergenic
1085820417 11:79787315-79787337 TGTCAGTAGTATTCTGTTGTAGG - Intergenic
1087189621 11:95239214-95239236 ATAATGTAGTATTCTATTGTAGG + Intergenic
1089004288 11:115078030-115078052 GTGAAGTGGTTTTCTGTTAGAGG - Intergenic
1089055861 11:115584329-115584351 GAGAAGAAGAATTCTGTTGAGGG + Intergenic
1091770845 12:3150332-3150354 GTGAGTTAGTATTTTGTTGATGG + Intronic
1092445510 12:8552953-8552975 ATGGAGTTGTATTCTGTTTTTGG - Intergenic
1093559909 12:20525709-20525731 ATGAAGTAATATTTTGTAGTCGG - Intronic
1093582837 12:20804044-20804066 GTGAGGGAGTATGCAGTTGTTGG + Intergenic
1094094941 12:26692900-26692922 GTGAAACAGTATTCTGTTTTGGG + Intronic
1095324014 12:40865038-40865060 GTGAAGTAATAGTTTATTGTGGG + Intronic
1095603603 12:44042272-44042294 CTGAAGTTGTATTATGTTTTTGG + Intronic
1095634649 12:44418944-44418966 AAGAATAAGTATTCTGTTGTTGG + Intergenic
1096348193 12:50869744-50869766 GTTAACTAGTATTTTGTTATGGG - Intronic
1098953681 12:76667274-76667296 TTGAAGTAGTATTCAATTTTTGG + Intergenic
1099533849 12:83821717-83821739 ATCAAGTAGTCTTTTGTTGTGGG + Intergenic
1099791385 12:87339164-87339186 GTGAACTAGTGTGCTGTTTTTGG - Intergenic
1099794323 12:87378739-87378761 GTGAAGTGGTATTTCATTGTGGG - Intergenic
1103823556 12:123717775-123717797 TTGAACTAGTTTTCTATTGTTGG + Intronic
1105866558 13:24465934-24465956 ATGAAGTAGTATAATATTGTAGG + Intronic
1107835720 13:44411069-44411091 TTGGAGTATTGTTCTGTTGTGGG - Intergenic
1109934520 13:69264384-69264406 TGGCAGTAGTACTCTGTTGTGGG + Intergenic
1110104597 13:71655764-71655786 GTGAAATAGTATTCTGATTTAGG - Intronic
1110748479 13:79084284-79084306 TTGAATTACTATTCTTTTGTAGG - Intergenic
1111764135 13:92505751-92505773 GTTTAGTAGTATTCTATAGTCGG - Intronic
1112447847 13:99481953-99481975 GTGCAATAGTATCCTGTTCTGGG + Intergenic
1113286994 13:108860621-108860643 GTGCAGCAGTACACTGTTGTTGG - Intronic
1115021099 14:28682778-28682800 GTGAAATAGTATTTCATTGTGGG + Intergenic
1116684662 14:48022694-48022716 GTGGAGTGGTATTCTGTTCTTGG + Intergenic
1117130393 14:52680927-52680949 GTGAAGTGGTATTGTGGTTTTGG - Intronic
1118223281 14:63875611-63875633 GTGATGTAGAAATATGTTGTTGG + Intronic
1119227244 14:72953894-72953916 GGGAGGTAGTATACTGTTGGAGG - Intronic
1122908107 14:104811965-104811987 GTGTAGTGGTATCTTGTTGTGGG - Intergenic
1124442201 15:29694922-29694944 GAGAATGTGTATTCTGTTGTTGG - Intergenic
1125066544 15:35493281-35493303 GTGAAGTATAATTCTTTTGTGGG - Intronic
1127027339 15:54821538-54821560 GTGGAGTTGTATTTTGCTGTTGG + Intergenic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1129575713 15:76742659-76742681 GTTAGCTAGTATTCTGTTGATGG - Intronic
1130005014 15:80087359-80087381 GTGGAGTGGTATTCTATTGTGGG + Intronic
1131273814 15:90963756-90963778 GTGAAGTGGTATTTCATTGTGGG + Intergenic
1135677371 16:24428221-24428243 GCTAAGTAATATTCTGTTGTAGG + Intergenic
1135693208 16:24562205-24562227 ATGATGTAGTGTTTTGTTGTTGG + Intronic
1135921745 16:26656234-26656256 TTCTAGTTGTATTCTGTTGTGGG + Intergenic
1139496444 16:67322995-67323017 GTGAAGTAGTATTCTGTTGTGGG - Intronic
1140006666 16:71083994-71084016 GTGAAGTAGTATCTCATTGTGGG + Intronic
1144871551 17:18375182-18375204 TTGAGGTAGTATTCTGTTGCTGG - Intergenic
1147180101 17:38678992-38679014 GCTGAGTAGTAGTCTGTTGTAGG + Intergenic
1147876568 17:43625608-43625630 GTGAAGTGGTATTTCATTGTGGG - Intergenic
1149017107 17:51920726-51920748 GTGCAGAAGCATTCTGTTGTGGG - Intronic
1153887875 18:9483218-9483240 GTGAAGTGGTATCATGTTGAGGG + Intronic
1154958601 18:21284880-21284902 ATGAAGTAGTATCCCATTGTGGG + Intronic
1156740192 18:40316831-40316853 GATGAGTAGTATTCTATTGTAGG + Intergenic
1158338875 18:56444177-56444199 TTGAAGTTGTGTTCTTTTGTGGG - Intergenic
1158496508 18:57959934-57959956 GAAAAGTGGTAGTCTGTTGTAGG + Intergenic
1159505657 18:69332015-69332037 CTGAAGTAGTATTTTATTGTAGG + Intergenic
1164965871 19:32482487-32482509 GTGACCTAGAATTATGTTGTTGG + Exonic
1166204312 19:41259300-41259322 ATGGAGTAGTATTCTGATGAGGG - Intronic
930118752 2:47742523-47742545 GAGAAGAAGAATTCTGTTGAGGG - Intronic
930406531 2:50964252-50964274 GTCAAGTAGTATTTTATTCTTGG + Intronic
932786548 2:74609762-74609784 GTGAGGTAATATTTTATTGTGGG + Intronic
934878784 2:97953689-97953711 GGGAATGAATATTCTGTTGTAGG - Intronic
935395240 2:102601178-102601200 GTTAAATAATATTCTATTGTAGG + Intergenic
935845448 2:107161547-107161569 GTGAAGTTTTATGCAGTTGTAGG + Intergenic
937618989 2:123963986-123964008 GTGAAGTGGTATTCCTTGGTGGG - Intergenic
940622504 2:156130007-156130029 GGGAGGTAGTGCTCTGTTGTGGG - Intergenic
941372842 2:164688280-164688302 GTAAACTAGTATTCTATTGATGG - Intronic
941752396 2:169146959-169146981 GTGAAGAAATCTTCTGTTATAGG - Exonic
942740350 2:179169611-179169633 CAGAATAAGTATTCTGTTGTTGG - Intronic
943622210 2:190161692-190161714 GAGTAGAAGTATTCTCTTGTTGG + Intronic
943686963 2:190828889-190828911 TTGAATGAGGATTCTGTTGTTGG - Intergenic
944367448 2:198939881-198939903 GTGAATAAATATTGTGTTGTTGG - Intergenic
945418512 2:209604849-209604871 CTGCAGAAGTATTCTGTTTTGGG - Intronic
1169726556 20:8740041-8740063 GTCAAGTATAATTCTGTTATGGG + Intronic
1170072253 20:12381461-12381483 TTAAAGTAGTCTTCTGTGGTTGG - Intergenic
1170132617 20:13037649-13037671 CTGAAGGAATGTTCTGTTGTAGG - Intronic
1170133636 20:13050038-13050060 GTGAACTAGTATTATATTTTGGG - Intronic
1170185916 20:13590293-13590315 TTGAAGTAGTATTTTGTTGTGGG - Intronic
1170628800 20:18050539-18050561 GTGAAGTAGGTTTTTATTGTTGG - Intronic
1171773169 20:29342454-29342476 GTGAAGTGGTATAATGTTGATGG + Intergenic
1171815189 20:29780017-29780039 GTGAAGTGGTATAATGTTGATGG + Intergenic
1171903181 20:30876018-30876040 GTGAAGTGGTATAATGTTGATGG - Intergenic
1172867680 20:38112638-38112660 GGGCAGGAGCATTCTGTTGTGGG + Intronic
1174484788 20:50854343-50854365 ATGTAGCAGTATTCTGATGTGGG + Intronic
1177194226 21:17885690-17885712 GTGCAGGAGTCTTCTGGTGTGGG + Intergenic
1178489182 21:33037173-33037195 GTGGAATCATATTCTGTTGTGGG + Intergenic
1178936240 21:36864459-36864481 GTGAAGTAGAATTTTCTTGAAGG - Intronic
1180318624 22:11300574-11300596 GTGAAGTGGTATAATGTTGATGG + Intergenic
1180336577 22:11581992-11582014 GTGAAGTGGTATAATGTTGATGG - Intergenic
1183840311 22:40494708-40494730 CTGAAGTAGTATTCTGTTAAAGG - Intronic
1184898490 22:47426746-47426768 TTGAAGTTGTATTCTGTTGAAGG - Intergenic
953572795 3:44085102-44085124 GTGAAGTAGTATTCCATAGTAGG + Intergenic
954770170 3:52960067-52960089 GTGTAGTAGTATTCCATTGAAGG - Intronic
959982580 3:112532718-112532740 GTGTAGTCATATTCTATTGTTGG + Exonic
960226485 3:115175473-115175495 AAGAATTAATATTCTGTTGTTGG - Intergenic
962356322 3:134697474-134697496 CTAAAGTGGGATTCTGTTGTAGG - Intronic
963154615 3:142082616-142082638 GTTTAGTAGTATTTTGTTGAGGG - Intronic
964110568 3:153083173-153083195 GAGAAGAAGAATTCTGTTGGGGG - Intergenic
964450589 3:156809325-156809347 TTAAAGTAGTCTTCTGTGGTTGG + Intergenic
965938901 3:174151161-174151183 GTGAAGGAGTATTTTTTTTTTGG - Intronic
967751304 3:193119269-193119291 GTGGAGAAGAATTCTATTGTGGG - Intergenic
971048067 4:22828569-22828591 ATGAAGTATAATTCTGTAGTGGG + Intergenic
972871870 4:43310376-43310398 GTGAAGGAGCAGTCTGTTGTCGG - Intergenic
984376299 4:178935067-178935089 GTAAAGTAGAATTCTACTGTTGG - Intergenic
985192201 4:187387128-187387150 GCCAAATAGTATTTTGTTGTAGG - Intergenic
987945398 5:24601577-24601599 TTGAACTAGTATTCTTTTCTTGG - Intronic
990562872 5:57001009-57001031 GAGAAGAAGAATTCTGTTGAAGG + Intergenic
992862380 5:80924606-80924628 GTGAAGTAGTATCTCATTGTAGG + Intergenic
994473981 5:100244030-100244052 GGGAACTCGTATACTGTTGTTGG + Intergenic
994608350 5:102000818-102000840 GCTAAGTAGTATTCCCTTGTAGG + Intergenic
994827465 5:104733331-104733353 GCAATATAGTATTCTGTTGTTGG - Intergenic
996363416 5:122675500-122675522 GTGAAGTGGTATCTGGTTGTGGG + Intergenic
996917341 5:128728181-128728203 GTTAAGTAGTAGTCTTTTCTAGG + Intronic
998883302 5:146667511-146667533 GTGAAGTAATATTCTAGTCTGGG + Intronic
999940911 5:156541895-156541917 GGGAAATAGTATAATGTTGTGGG - Intronic
1000476908 5:161721007-161721029 AAGAATGAGTATTCTGTTGTTGG + Intergenic
1000540398 5:162531717-162531739 AAGAATTAGTATTCTGTTGCTGG - Intergenic
1004612929 6:17263296-17263318 TCTAAGTAGTATTCTCTTGTAGG - Intergenic
1008880005 6:56372087-56372109 TTGAATTAGTGTTCTGGTGTAGG - Intronic
1011752759 6:90469722-90469744 GTGAAGTAGGATTGCTTTGTAGG + Intergenic
1017902713 6:158731970-158731992 CTGAAGTAGTAAGCTGTTTTTGG - Intronic
1024032395 7:45473291-45473313 AAAAAATAGTATTCTGTTGTTGG - Intergenic
1024940831 7:54761325-54761347 ATGGAGTACTATTCTGTTGTGGG - Intergenic
1026385447 7:69842972-69842994 GTGTAGTATTGCTCTGTTGTAGG + Intronic
1026475428 7:70730945-70730967 GTGAAGTAATATTTGATTGTGGG + Intronic
1028185296 7:87777853-87777875 TTGAAGTAGTATTTTATTCTGGG - Exonic
1030976493 7:116130427-116130449 GTGTAGTATTATTTTCTTGTAGG - Intronic
1031764282 7:125757495-125757517 AAGAATTTGTATTCTGTTGTTGG + Intergenic
1031813408 7:126401523-126401545 GTAAAGTAATATTTTGCTGTGGG + Intergenic
1034714992 7:153234063-153234085 GAGAAGAAGTATTCTGGTTTGGG + Intergenic
1034763957 7:153699989-153700011 GTGAAGCAGTATTCTACTGTGGG + Intergenic
1036165243 8:6426536-6426558 GCTGAGTAGTATTCTATTGTAGG + Intronic
1036941141 8:13053864-13053886 GTGAGGTAGTATCCCATTGTAGG - Intergenic
1039084529 8:33766775-33766797 GTGAAGTGATATTATATTGTAGG - Intergenic
1039301094 8:36209554-36209576 GTGAAGAGGAATTCTGTTGAAGG - Intergenic
1039649989 8:39330865-39330887 GTGAAGTGGTATCATCTTGTAGG + Intergenic
1040488603 8:47898416-47898438 GTGAATTAGTTTTATGTTGTGGG + Intronic
1041668578 8:60469612-60469634 AATAGGTAGTATTCTGTTGTGGG - Intergenic
1042590264 8:70391338-70391360 GGGAAGTAGATTTCTGTTTTAGG - Intronic
1042869242 8:73382417-73382439 GTAATGGAGGATTCTGTTGTTGG + Intergenic
1045047164 8:98290427-98290449 GAGAAGGAGGATTTTGTTGTTGG - Intronic
1046922607 8:119748660-119748682 TTGAGGTAGTATTATTTTGTAGG + Intronic
1052065472 9:24013472-24013494 GAGTAGTAGTATTCTATTATAGG + Intergenic
1053477319 9:38391885-38391907 GTGGCATAGAATTCTGTTGTAGG - Intergenic
1055685244 9:78766400-78766422 GTGAAGTAGTTTGGGGTTGTGGG - Intergenic
1056681402 9:88722132-88722154 GTGATGTAGGACTTTGTTGTAGG - Intergenic
1057001666 9:91515648-91515670 GAGAAGTAGTTTTCTTTTGGGGG - Intergenic
1057035470 9:91809017-91809039 GTGAAGTATTAAACTGTTTTGGG + Intronic
1057170296 9:92959374-92959396 TTGAACTAGTTCTCTGTTGTTGG + Intronic
1059116500 9:111604429-111604451 GTGAAGTAGATTCCTTTTGTAGG + Intergenic
1059953187 9:119489123-119489145 GAGAATTAGTGTTGTGTTGTTGG - Intergenic
1060387450 9:123244946-123244968 GTTAAGTAGTATTCCATGGTAGG - Intronic
1203366853 Un_KI270442v1:266339-266361 GTGAAGTGGTATAATGTTGATGG + Intergenic
1185808224 X:3080032-3080054 GGGAAGTAGTCTTCGCTTGTGGG + Intronic
1186287025 X:8056533-8056555 GTCAAATGGTATTCTGTTTTTGG - Intergenic
1186295093 X:8140710-8140732 GAGAAGAAGAATTCTATTGTGGG + Intergenic
1188299616 X:28491771-28491793 GCTAAATAGTATTCTGTTATAGG + Intergenic
1188864319 X:35295865-35295887 CTCAAGTAGTATTTTTTTGTGGG + Intergenic
1192455871 X:71275202-71275224 GTGAAGTAGTATCTCATTGTAGG + Intergenic
1193622546 X:83773653-83773675 GTGAAGTAGTATTGTATTCTTGG - Intergenic
1195134956 X:101896101-101896123 AGGAAGTAGTATTCTGTATTAGG + Intronic
1195177350 X:102323593-102323615 GTTAAGAAGGATCCTGTTGTTGG + Intronic
1195181514 X:102363500-102363522 GTTAAGAAGGATCCTGTTGTTGG - Intronic
1196902500 X:120399711-120399733 GAGAAGTAGAATTTTGTTGAGGG + Intergenic
1197043515 X:121969374-121969396 GTGTAGAAGTATTGTGTTCTTGG + Intergenic
1197953798 X:131924483-131924505 GTGAAGTAGTATAATTTTGAGGG - Intergenic
1198440116 X:136654946-136654968 GTGAAGGAGATTTTTGTTGTGGG - Intronic
1198789634 X:140330115-140330137 GTGAAGTAGTATTCTCCTTGTGG + Intergenic
1199002741 X:142659050-142659072 TTGAAGAAGTATTCTTTTTTAGG + Intergenic
1202579834 Y:26368394-26368416 GTTAAGTAGTTTTGTGTTCTTGG - Intergenic