ID: 1139496444

View in Genome Browser
Species Human (GRCh38)
Location 16:67322995-67323017
Sequence GTGAAGTAGTATTCTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139496444_1139496446 -9 Left 1139496444 16:67322995-67323017 CCCACAACAGAATACTACTTCAC 0: 1
1: 0
2: 1
3: 19
4: 171
Right 1139496446 16:67323009-67323031 CTACTTCACACCCATTAGTATGG 0: 1
1: 17
2: 159
3: 729
4: 1874
1139496444_1139496449 10 Left 1139496444 16:67322995-67323017 CCCACAACAGAATACTACTTCAC 0: 1
1: 0
2: 1
3: 19
4: 171
Right 1139496449 16:67323028-67323050 ATGGCTACAATGAAAACAATAGG 0: 1
1: 0
2: 5
3: 29
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139496444 Original CRISPR GTGAAGTAGTATTCTGTTGT GGG (reversed) Intronic