ID: 1139498472

View in Genome Browser
Species Human (GRCh38)
Location 16:67339787-67339809
Sequence CATACCACGGAGAAATTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139498472_1139498484 30 Left 1139498472 16:67339787-67339809 CCCACTAATTTCTCCGTGGTATG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1139498484 16:67339840-67339862 TGACTATTTAAAGCTTATGGGGG 0: 1
1: 0
2: 2
3: 12
4: 128
1139498472_1139498481 27 Left 1139498472 16:67339787-67339809 CCCACTAATTTCTCCGTGGTATG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1139498481 16:67339837-67339859 TTATGACTATTTAAAGCTTATGG 0: 1
1: 0
2: 1
3: 18
4: 271
1139498472_1139498483 29 Left 1139498472 16:67339787-67339809 CCCACTAATTTCTCCGTGGTATG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1139498483 16:67339839-67339861 ATGACTATTTAAAGCTTATGGGG 0: 1
1: 0
2: 1
3: 15
4: 196
1139498472_1139498479 3 Left 1139498472 16:67339787-67339809 CCCACTAATTTCTCCGTGGTATG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1139498479 16:67339813-67339835 CTTGTCCTGAAAGGGATCTTTGG 0: 1
1: 0
2: 0
3: 21
4: 158
1139498472_1139498477 -6 Left 1139498472 16:67339787-67339809 CCCACTAATTTCTCCGTGGTATG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1139498477 16:67339804-67339826 GGTATGGGTCTTGTCCTGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 96
1139498472_1139498478 -5 Left 1139498472 16:67339787-67339809 CCCACTAATTTCTCCGTGGTATG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1139498478 16:67339805-67339827 GTATGGGTCTTGTCCTGAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 112
1139498472_1139498482 28 Left 1139498472 16:67339787-67339809 CCCACTAATTTCTCCGTGGTATG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1139498482 16:67339838-67339860 TATGACTATTTAAAGCTTATGGG 0: 1
1: 0
2: 1
3: 10
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139498472 Original CRISPR CATACCACGGAGAAATTAGT GGG (reversed) Intronic
903987122 1:27236253-27236275 CAGACCAGGGAGTAACTAGTTGG + Intronic
909498549 1:76307207-76307229 CATACCCCTAACAAATTAGTGGG + Intronic
910442335 1:87265675-87265697 CATGCAACGAAGACATTAGTGGG - Intergenic
912219927 1:107661901-107661923 CCTACCACGGAAAATTAAGTTGG + Intronic
914386528 1:147174388-147174410 CATACCAAGGACATATTATTTGG - Intergenic
914951192 1:152115882-152115904 CATCCCATGGAGAAATTAATTGG - Intergenic
918396330 1:184116878-184116900 CATATTATTGAGAAATTAGTAGG + Intergenic
919363428 1:196624834-196624856 CATTCCAGAGAGCAATTAGTTGG + Intergenic
919481764 1:198098783-198098805 AACACCACGGAAAAATCAGTAGG + Intergenic
923575104 1:235151264-235151286 AATACCACAGAAAAATCAGTAGG + Intronic
923738441 1:236633955-236633977 CATTCCAAGGAAATATTAGTAGG - Intergenic
1063353325 10:5375360-5375382 CTTACCACGCAGAAGTGAGTGGG - Intergenic
1063975100 10:11408650-11408672 CAAAACATGTAGAAATTAGTTGG - Intergenic
1065314560 10:24450217-24450239 CATTCCAGGGAAAAATTATTTGG + Intronic
1065468859 10:26055465-26055487 CATCCAAGGGAGCAATTAGTGGG + Intronic
1068985023 10:63099767-63099789 CATTCCACAGAAAAATTAGGAGG - Intergenic
1069307019 10:66983328-66983350 GATACCAGGGAGAGATTTGTTGG - Intronic
1077723498 11:4650549-4650571 CAGACCAGATAGAAATTAGTGGG - Intronic
1082822980 11:57557162-57557184 CATTCCACGGAGCCATTCGTGGG - Intronic
1086965712 11:93025968-93025990 CCTTCCCTGGAGAAATTAGTTGG + Intergenic
1094252568 12:28381332-28381354 TATACCAAGGATAAATTAATAGG + Intronic
1095171788 12:39044647-39044669 CATAACACAGAGAAAATATTTGG - Intergenic
1110042576 13:70782619-70782641 CATACCACAGAGAAACTTTTTGG - Intergenic
1111847651 13:93531657-93531679 GATGCCACAGAAAAATTAGTAGG - Intronic
1116126229 14:40789580-40789602 AATACCACTGAAAAAGTAGTAGG - Intergenic
1119189563 14:72671266-72671288 CGTACCACGGAGGACTTATTCGG - Exonic
1119957518 14:78815158-78815180 CTTGTCACAGAGAAATTAGTGGG - Intronic
1120172351 14:81258625-81258647 CATACCACGGAGTATTTCTTAGG + Intergenic
1126738352 15:51753316-51753338 CTTACAATGGAGAAATTAGGAGG + Intronic
1128124832 15:65184914-65184936 CATTCCACGGGGAAAGTGGTGGG + Intronic
1133599363 16:7324129-7324151 GACACCACGGACAAATGAGTTGG - Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1139498472 16:67339787-67339809 CATACCACGGAGAAATTAGTGGG - Intronic
1142940317 17:3375600-3375622 CAAACCAAGAAGAAATTACTGGG - Intergenic
1149097156 17:52856706-52856728 CAAACCATAGAGAAATTAGCTGG - Intergenic
1153468389 18:5415569-5415591 CATCCCACGTAGAACTCAGTGGG + Intronic
1164882413 19:31744494-31744516 TATACCTAGGAGAAATTAGATGG - Intergenic
926628510 2:15116102-15116124 GATACCAAGGAGAATTGAGTTGG - Intergenic
927161176 2:20263562-20263584 CATAACAAGTAGGAATTAGTGGG - Intronic
927884724 2:26711234-26711256 CATCCCACTGAGAAATGAGGAGG - Intronic
928369044 2:30726084-30726106 CCTACCCTGGAGAAACTAGTTGG - Intronic
931988319 2:67762771-67762793 TATACCACTGAGACATAAGTAGG + Intergenic
939772875 2:146345005-146345027 CATACAGCTGAGAAATTAGTAGG + Intergenic
945380916 2:209139008-209139030 CATAACACGGAGAGATCAGAGGG - Intergenic
1172359384 20:34301689-34301711 CATACTGTGGAGAGATTAGTGGG - Intronic
1175147113 20:56905189-56905211 CACACCCGGGAGAAATGAGTGGG - Intergenic
1176237380 20:64059909-64059931 CATCCCAGGGAGAAATCAGGTGG + Intronic
960134969 3:114095606-114095628 AATACCACGGAGTAATTATGGGG - Intergenic
961606826 3:128101846-128101868 CACACCAGGGAGAAAATAGGGGG + Intronic
963927143 3:150962681-150962703 CATACCATGAAGATTTTAGTTGG + Intronic
965553609 3:169996916-169996938 AATACCAAGGAGAAATTCCTAGG + Exonic
973267647 4:48227265-48227287 CAAATCACAGAGAAATCAGTGGG + Intronic
978662222 4:111140548-111140570 CATACCACTAAAAAATTAGGTGG - Intergenic
982383836 4:154779004-154779026 CATACAAGGGAGAAAATAGAAGG - Intergenic
983420852 4:167514864-167514886 CATACCAAGGAAAAATAAGGTGG + Intergenic
985285690 4:188334492-188334514 CATTCCAAGGAGAAAGTAGGAGG - Intergenic
992268552 5:75042351-75042373 CATACCATGTAGATATTAGGTGG - Intergenic
994245069 5:97469055-97469077 CAAACCACAGAGATATTACTGGG - Intergenic
1005498960 6:26413320-26413342 CATATCAGGGAGACATTACTGGG + Exonic
1009669790 6:66732141-66732163 CATTAAACGTAGAAATTAGTTGG + Intergenic
1018200752 6:161392663-161392685 CATACCAAGGAGAATGTATTAGG - Intronic
1022216632 7:28269550-28269572 CATTACATGGAGAAAATAGTAGG + Intergenic
1028696100 7:93715002-93715024 CATACCTCAGAGGTATTAGTGGG - Intronic
1050046632 9:1553290-1553312 CATGCCATGGAGAAGTTACTTGG + Intergenic
1056638046 9:88347641-88347663 CATACAAAGGAGAAATAAGGAGG + Intergenic
1195419605 X:104659151-104659173 CCTACCACTGAGAAATTGTTGGG + Intronic
1197452735 X:126640492-126640514 CATAGCACCCAGAATTTAGTGGG - Intergenic
1197465134 X:126795696-126795718 CATACCAAAGAGAAAACAGTAGG + Intergenic
1201780949 Y:17722194-17722216 CAGACCCCTGAGACATTAGTGGG - Intergenic
1201791984 Y:17851127-17851149 CAGATCACGTAGAAATTTGTGGG + Intergenic
1201809570 Y:18054862-18054884 CAGATCACGTAGAAATTTGTGGG - Intergenic
1201820604 Y:18183796-18183818 CAGACCCCTGAGACATTAGTGGG + Intergenic
1202172396 Y:22064742-22064764 CAGACCCCTGAGACATTAGTGGG - Intergenic
1202218967 Y:22521629-22521651 CAGACCCCTGAGACATTAGTGGG + Intergenic
1202324219 Y:23674423-23674445 CAGACCCCTGAGACATTAGTGGG - Intergenic
1202356103 Y:24050524-24050546 CAGACCTCTGAGAAAATAGTGGG + Intergenic
1202514675 Y:25619585-25619607 CAGACCTCTGAGAAAATAGTGGG - Intergenic
1202546552 Y:25995631-25995653 CAGACCCCTGAGACATTAGTGGG + Intergenic