ID: 1139505498

View in Genome Browser
Species Human (GRCh38)
Location 16:67396322-67396344
Sequence TGGGGAAAGCAGGCCCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 1, 2: 7, 3: 46, 4: 471}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139505483_1139505498 21 Left 1139505483 16:67396278-67396300 CCCCAGCTTTGCCCAGAAGGACT 0: 1
1: 0
2: 3
3: 24
4: 274
Right 1139505498 16:67396322-67396344 TGGGGAAAGCAGGCCCGGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 471
1139505490_1139505498 -2 Left 1139505490 16:67396301-67396323 CCAGGTGAGGAAACAAAAGCCTG 0: 1
1: 1
2: 2
3: 36
4: 339
Right 1139505498 16:67396322-67396344 TGGGGAAAGCAGGCCCGGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 471
1139505485_1139505498 19 Left 1139505485 16:67396280-67396302 CCAGCTTTGCCCAGAAGGACTCC 0: 1
1: 0
2: 1
3: 19
4: 187
Right 1139505498 16:67396322-67396344 TGGGGAAAGCAGGCCCGGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 471
1139505489_1139505498 9 Left 1139505489 16:67396290-67396312 CCAGAAGGACTCCAGGTGAGGAA 0: 1
1: 0
2: 3
3: 25
4: 158
Right 1139505498 16:67396322-67396344 TGGGGAAAGCAGGCCCGGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 471
1139505484_1139505498 20 Left 1139505484 16:67396279-67396301 CCCAGCTTTGCCCAGAAGGACTC 0: 1
1: 0
2: 0
3: 25
4: 175
Right 1139505498 16:67396322-67396344 TGGGGAAAGCAGGCCCGGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 471
1139505488_1139505498 10 Left 1139505488 16:67396289-67396311 CCCAGAAGGACTCCAGGTGAGGA 0: 1
1: 0
2: 1
3: 21
4: 176
Right 1139505498 16:67396322-67396344 TGGGGAAAGCAGGCCCGGGAAGG 0: 1
1: 1
2: 7
3: 46
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139505498 Original CRISPR TGGGGAAAGCAGGCCCGGGA AGG Intronic
900227427 1:1539851-1539873 TGGGGAGCGCAGGCCGGGGTCGG + Intronic
900227459 1:1539951-1539973 TGGGGATCGCAGGCTGGGGAGGG + Intronic
900227475 1:1539991-1540013 GGGGGAGCGCAGGCCCGGGAGGG + Intronic
900227531 1:1540128-1540150 GGGGGAGCGCAGGCCGGGGAGGG + Intronic
900227539 1:1540147-1540169 AGGGGAGCGCAGGCCGGGGAGGG + Intronic
900227547 1:1540166-1540188 AGGGGAGCGCAGGCCGGGGAGGG + Intronic
900269810 1:1781248-1781270 TGGGGAAAGGATGACTGGGAAGG + Intergenic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
901159471 1:7163792-7163814 TGCGGGGAGCAGGCCAGGGAGGG + Intronic
901988083 1:13091791-13091813 TGGGGCAAGAAGGCCCAGAAAGG - Intergenic
901993729 1:13134976-13134998 TGGGGCAAGAAGGCCCAGAAAGG + Intergenic
902893688 1:19463887-19463909 TGAGGACAGCAGGCCAGGCACGG + Intronic
903657179 1:24956648-24956670 TGGGGTAAGCAGGGGCAGGAGGG - Intronic
903780281 1:25816225-25816247 TGGGGACATCAGGCACAGGAGGG - Exonic
904612257 1:31732225-31732247 TGGGCAAAGCTGGCTGGGGAGGG - Intronic
904806100 1:33133553-33133575 TGAGGAGAGCAGGGCCGGGATGG + Intergenic
905006817 1:34716565-34716587 TGGGGATAGGAGGCAGGGGATGG + Intronic
905011152 1:34747914-34747936 TGGGGGAAGCAGGTCTGGGAGGG - Intronic
905276194 1:36819688-36819710 TGGGGAAAGCAGACCCTGGAAGG + Intronic
905876131 1:41433086-41433108 TGGGGAAGCCAAGCCTGGGAGGG - Intergenic
906214232 1:44030071-44030093 TGCGGAGAGCAGGCCCGAAAGGG + Intronic
906411124 1:45580352-45580374 TGAGGAAAACAGGCCGGGCATGG + Intergenic
906509175 1:46401105-46401127 AGGGGGAAGCAGGCCAGGGGAGG + Intronic
909718007 1:78733577-78733599 TGGTGCAAGCAGGCACTGGATGG - Intergenic
910145878 1:84078698-84078720 GGGGGAAAGCAGGGGTGGGATGG - Intronic
912359393 1:109082377-109082399 TGAGGAAAGCAGGAGCTGGATGG + Intergenic
912794750 1:112686003-112686025 TAGGGAATGCAGGCCCCGGATGG - Intronic
913451951 1:118998640-118998662 TGGGGAAACCAGGCCAGTGGGGG - Intergenic
914942722 1:152037014-152037036 TGGGCAAGGCTGGGCCGGGAAGG - Exonic
915349490 1:155215465-155215487 TGGGGAAAGCTGGACAGGAAGGG + Intergenic
915352686 1:155236147-155236169 TGGGGAAAGCTGGACAGGAAGGG + Intronic
915461493 1:156073161-156073183 TGGGGGAAGCAGGCATGGGAGGG + Exonic
916859454 1:168787123-168787145 TAGGAAAAGCAGGGCGGGGATGG + Intergenic
917046539 1:170866799-170866821 TGGGGAGAGCACGTCTGGGAAGG + Intergenic
917190045 1:172406192-172406214 AGGGGAAGGCAGGTCAGGGAAGG + Intronic
917457099 1:175194301-175194323 TGAGGAAGACAGGCCTGGGATGG + Intergenic
917517211 1:175718274-175718296 TGGGGAATGCAGGTCAGAGAAGG - Intronic
918192739 1:182191851-182191873 TAAGGAAAGCAGGCCAGGGAAGG + Intergenic
920002803 1:202811156-202811178 TGGGGGACGGAGGCCCGGGCGGG - Intergenic
920702895 1:208231206-208231228 TGGGAATGGCAGGCCGGGGAGGG + Intronic
921266338 1:213423777-213423799 TGGGGAAGGCAGGCCCAGAGGGG + Intergenic
922503038 1:226110573-226110595 TGGGGAAGGCAGGGCCGGCGCGG + Intergenic
922724484 1:227916023-227916045 TGAGGAAAGCAGGGCCCAGAGGG - Intergenic
922781506 1:228256571-228256593 TGGGGAGAGAAGGCCTGGAAGGG - Intronic
922781896 1:228259420-228259442 TGGGGAGAGAAGGCCTGGAAGGG - Intronic
922782468 1:228264035-228264057 TGGGGAGAGAAGGCCTGGGCAGG - Intronic
922933487 1:229407662-229407684 TGGGGAAAGCAGTCTGTGGAGGG + Intergenic
922996037 1:229962445-229962467 TGGGAACAGCCAGCCCGGGACGG + Intergenic
923025152 1:230197915-230197937 TGGGGCAGGCAGGCTCGGGAGGG + Intronic
924234716 1:241991033-241991055 TGGGGAAAGCAGCCCAGAGGAGG + Intergenic
1062998678 10:1892876-1892898 TGGGGACAGGAGGCCAGTGATGG - Intergenic
1063556140 10:7081437-7081459 TGGGGAATGCAGGCAGAGGAGGG - Intergenic
1063952523 10:11237313-11237335 TGGGGACATCAACCCCGGGATGG - Intronic
1064209354 10:13349596-13349618 AGGGGAATGCAGCCCAGGGAAGG + Intergenic
1064301417 10:14126457-14126479 TGGGCAAGGCAGGCCGGGCACGG - Intronic
1069580049 10:69559655-69559677 TGGGGGGAGAAGGCCAGGGATGG + Intergenic
1069878901 10:71579658-71579680 TGAGGAAGCCAGGCCCAGGAAGG + Intronic
1070032722 10:72692545-72692567 TGGGGACACCAGGGCGGGGAAGG + Intronic
1070365900 10:75736932-75736954 TGGGGAAGGCAGGGCTGGGATGG + Intronic
1070650422 10:78231466-78231488 TGGGGAAAACAAGACAGGGAAGG - Intergenic
1071360034 10:84837423-84837445 TGGGGAAAGCAGGCAAATGATGG + Intergenic
1071457440 10:85861710-85861732 TGGGGAAGGCAGGCAGGGTATGG + Intronic
1071480661 10:86062453-86062475 TGGGGAAAACAGGACAGGGAAGG - Intronic
1072286456 10:93920586-93920608 TGAGGAAAACAGACCAGGGAGGG + Intronic
1072608435 10:97001778-97001800 TTGGTCAAGCAGGCCAGGGAGGG + Intronic
1073104729 10:101026084-101026106 TGGGGAAAGTAGGCGGGGAAGGG + Intronic
1073106916 10:101037356-101037378 TGGGGAGAGCAGGGCCAAGAAGG - Intronic
1073288440 10:102401940-102401962 TCGGGAAAGGAGGCTGGGGAGGG - Intronic
1073428506 10:103471120-103471142 TGGGGAAAGGAGGCTCAGGGAGG - Intergenic
1073582199 10:104678888-104678910 GAGGGAAAGCAGGACAGGGAAGG + Intronic
1074458128 10:113613140-113613162 TGGGGATAGGAGGTCAGGGAGGG - Intronic
1074584304 10:114752211-114752233 TGGGGAATGGAGGTCCCGGAGGG + Intergenic
1074900276 10:117810543-117810565 TGAGGAAAGGAGGCCATGGAAGG - Intergenic
1075031801 10:119029309-119029331 AGGGGAGAGAAGGGCCGGGAAGG - Intergenic
1075614527 10:123881738-123881760 TGGGGAAAGAAGACCTGGGTGGG + Intronic
1076324750 10:129612570-129612592 TGGGGAAAGAAGACACTGGACGG - Intronic
1076343785 10:129766900-129766922 TGGGGAAGCCAGGCTTGGGAGGG + Exonic
1076534611 10:131168678-131168700 TGGGGAGAGCCTGCCCGGCAGGG - Intronic
1076668939 10:132108588-132108610 TGGGGCAAGGAGGCAGGGGAGGG - Intronic
1076756090 10:132572488-132572510 CAGGGAAAGCAGCCCCGGGCGGG - Intronic
1076768759 10:132651556-132651578 TGGGGACAGAAGGCCAGAGATGG - Intronic
1077083657 11:736496-736518 AGGGGAAAGCAGGGCCGGGGTGG + Intergenic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1077501518 11:2911634-2911656 TGAGGAAGGCTGGCCAGGGAAGG - Intronic
1077556946 11:3230474-3230496 TGGGGAGAGGTGGCCCGGGGCGG + Intronic
1078423674 11:11232486-11232508 TGGAGGAAGCAGACCCAGGAAGG - Intergenic
1078762240 11:14260591-14260613 TGGGGACAGCAAGCATGGGATGG - Exonic
1079253465 11:18805657-18805679 TGGGGAAAGGAGGACAGGGAAGG + Intergenic
1079274396 11:19020801-19020823 TGGGGAAAAGAGGACAGGGAAGG + Intergenic
1080244658 11:30166056-30166078 TGGGGAAAGCAGCCTAAGGAAGG + Intergenic
1080785018 11:35467234-35467256 TGTGGGAAGCTGGCCTGGGAAGG - Intronic
1081619563 11:44611342-44611364 TGGGGACAGCCTGCCCGAGAAGG - Intronic
1083030475 11:59587208-59587230 TGGGGAAAGGAGGCTGGGTACGG + Intronic
1083172516 11:60931387-60931409 TGGGGGAAGCGGGCCCGGGCAGG + Intronic
1083658911 11:64243125-64243147 TGGGGAAAGCAGCTGAGGGAGGG + Intronic
1083758756 11:64804734-64804756 TGGGGCGAGGAAGCCCGGGAAGG - Exonic
1083860818 11:65419072-65419094 TGGGGGAAGCAAGGCTGGGAGGG + Intergenic
1083878996 11:65539093-65539115 TGGGGAACGCAGGCCCCGTGCGG + Exonic
1083897997 11:65629871-65629893 TGGGAAACGCAGGCCCAGGGAGG - Intronic
1084319498 11:68365607-68365629 TGGGGACAGCAGGCACAGGTGGG - Exonic
1085454251 11:76656806-76656828 TGGGGAGAGCATGCCCAGCAGGG + Intergenic
1089554710 11:119310047-119310069 TGGGCATGGCAGGCCAGGGAAGG + Intronic
1089857224 11:121556764-121556786 TGGGGCAGGTAGGCCCAGGATGG + Intronic
1091247337 11:134109250-134109272 TGGTGAGAGCAGGCCGGGCACGG - Intronic
1091356473 11:134941597-134941619 TTGGGAAAGGAGGACCGGGATGG - Intergenic
1092119363 12:6033395-6033417 TTGGGAAAGCTGGCCTGGGCAGG + Intronic
1093065170 12:14650658-14650680 AAGGGAAAGCAAGCCCGTGAGGG - Intronic
1094600654 12:31906320-31906342 TGGGGAAATGAGGCCAGGCACGG - Intergenic
1095097252 12:38155288-38155310 AGGGGAAAGAAGGCCCCAGAGGG + Intergenic
1095344279 12:41131062-41131084 TGGTGAAAGCAGGCGCAAGAGGG - Intergenic
1095968534 12:47885246-47885268 TGTGGGATGCAGGCCCTGGAGGG - Intronic
1096103172 12:48981441-48981463 TGGGCACAGCAGGCACGGCAGGG + Exonic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096473187 12:51891347-51891369 AGGGGAAAGAAGCCCTGGGAGGG - Exonic
1096517267 12:52163900-52163922 TGGGGAAGGGAGGCCAGGGCAGG + Intergenic
1097173318 12:57129104-57129126 TGGGGAAGGGAGACGCGGGAGGG + Intronic
1097173442 12:57129512-57129534 GAGGGCAGGCAGGCCCGGGAAGG + Intronic
1098059316 12:66543157-66543179 TGGGGGAAGAAGGCTGGGGACGG + Intronic
1098327574 12:69318216-69318238 TGGGCAAAGAAGGCCGGGCATGG - Intergenic
1098719300 12:73875317-73875339 TGGTGAAAGCAGGAGCAGGAGGG - Intergenic
1100424250 12:94468561-94468583 TGGGCAAAGGAGGCCGGGCATGG + Intergenic
1100564433 12:95781765-95781787 TGGGGAATGCTGGCAGGGGAAGG - Intronic
1101529085 12:105558027-105558049 TGAGGAAAGCAGGACAGGAAAGG - Intergenic
1102022406 12:109693005-109693027 TGGGGAAAACAGGACAGGGAAGG - Intergenic
1103011668 12:117462813-117462835 TGGGGAAAGAAAGCCGGGGATGG + Exonic
1104093815 12:125537992-125538014 TGGGGGAAGCAGGCCTGGCTGGG - Intronic
1104280735 12:127374227-127374249 TGGGGGAAGCAGGCCTGGCTGGG + Intergenic
1104442202 12:128802901-128802923 TGCGGAAACCAGGATCGGGACGG + Intronic
1104932869 12:132348958-132348980 TGGGGGATGGAGGCCTGGGAGGG + Intergenic
1105437709 13:20391553-20391575 TGGGGAAAGGAGGCGAGGGGTGG + Intergenic
1107048726 13:36024182-36024204 TGAGGAGAGCAGGCCAGGCACGG - Intronic
1107938577 13:45365153-45365175 TGGGGAGAGGTGGCCAGGGAAGG - Intergenic
1108243700 13:48493609-48493631 TGGGAAAAGCAAGCCCGGTGTGG - Intronic
1112343116 13:98568574-98568596 TGGGGAATGAAGGCCGGGGATGG + Intronic
1113249101 13:108431583-108431605 TGGGGGAAGCTCACCCGGGAGGG - Intergenic
1113366675 13:109682996-109683018 TGGGGAAAGGAGGCACGTGTTGG - Intergenic
1113655618 13:112066708-112066730 AGGGGGGAGGAGGCCCGGGAGGG - Intergenic
1114526973 14:23372501-23372523 TGGTGAAACCAGACCCTGGATGG + Intergenic
1114567008 14:23640000-23640022 TGGGAGAAGCAGGCCCTGGGTGG + Intronic
1116479948 14:45385494-45385516 TGGGGAAAGCGGGACAAGGAAGG + Intergenic
1120792537 14:88598401-88598423 TGGGGAAAGAAGGCTGGGGGAGG + Intronic
1120961190 14:90126492-90126514 TTGGGAAAGAAGGCCAGAGAGGG - Intronic
1121337983 14:93088925-93088947 TGGGGAGAGCGGGCCTGGGTGGG - Intronic
1121355122 14:93207491-93207513 TAGGGACAGCCGGGCCGGGAAGG - Intronic
1121539288 14:94712963-94712985 TCTGGAAAGAAGGCCCAGGAGGG + Intergenic
1121557119 14:94846871-94846893 TGGGGACAGCAGGCAGGGAAGGG - Intergenic
1121694320 14:95900490-95900512 TGGGGCCAGCAGCCCTGGGATGG - Intergenic
1121783515 14:96637937-96637959 TGGGACAAGGAGGTCCGGGAGGG - Intergenic
1122007764 14:98719275-98719297 AGGGGAGAGGAGGCCAGGGAAGG + Intergenic
1122209615 14:100166101-100166123 TGGGGGTAGCCTGCCCGGGAGGG + Intergenic
1122318231 14:100838027-100838049 TGTGGAGAAGAGGCCCGGGAGGG + Intergenic
1123044587 14:105505154-105505176 TGGGAAAAGCCAGCCCAGGAGGG + Intergenic
1123137041 14:106037771-106037793 TGGGAAATGCAGGCCCTGGCAGG + Intergenic
1123206981 14:106723443-106723465 TGGGAAACGCAGGCCCTGGCAGG + Intergenic
1123212000 14:106770446-106770468 TGGGAAACGCAGGCCCTGGCAGG + Intergenic
1123947868 15:25247636-25247658 GGGAGAAAGCAGGCTCAGGAAGG - Intergenic
1124421943 15:29530325-29530347 TGGGGAAAAGTGGCCAGGGATGG + Intronic
1125589074 15:40843738-40843760 CTGGGAAAGCAGGCCCCGGCCGG + Intergenic
1126675688 15:51157808-51157830 TGGGGAAAGCAGCTCGGTGAGGG + Intergenic
1126813076 15:52428301-52428323 TGGGGAAAGCAGGCTGTGGTTGG - Intronic
1127051818 15:55091562-55091584 TGGGGAAAGAAGGACAGGGAAGG - Intergenic
1128231636 15:66039638-66039660 TGGAGAAAGCAGGGGTGGGAGGG - Intronic
1128738017 15:70064474-70064496 TGGGGAAAGAAGGCCAGGACAGG + Intronic
1129252844 15:74318366-74318388 TGGAGACAGCAGGGCCGGGGAGG - Intronic
1129503826 15:76064361-76064383 TGGTGTAAGCAGTCCCAGGAAGG + Intronic
1129540350 15:76342871-76342893 TGGGGAAGGAAGCGCCGGGAGGG - Intergenic
1129700469 15:77765122-77765144 CTGGGAAAGCAGGCCTGGCATGG + Intronic
1130883848 15:88077408-88077430 TGGGGGAGGCAGGGCTGGGAAGG - Intronic
1130915247 15:88299748-88299770 TTGGGAATGCAGGTCTGGGAGGG + Intergenic
1131051904 15:89353963-89353985 TGGGGGAAGCAGGCCAGGGAAGG + Intergenic
1132694936 16:1197854-1197876 TTGGGGGAGCAGGCCCAGGATGG + Intronic
1132752553 16:1465481-1465503 TGGGGGCAGCAGGGCTGGGACGG + Intronic
1132929145 16:2449801-2449823 GGAGGAAAGCAGGCCAGGGGTGG - Intronic
1133119230 16:3596095-3596117 CGGGGAGGGGAGGCCCGGGAGGG + Intronic
1133318990 16:4901396-4901418 TTGGGAAAGCTGGCCAGGCATGG + Intronic
1133735375 16:8611041-8611063 TGAGGAAAGCAGACTAGGGAAGG - Intergenic
1134092788 16:11400343-11400365 TGGGGGAGGCGGCCCCGGGATGG - Intronic
1135137380 16:19895121-19895143 TGGGGAGAGGAGGGCAGGGATGG + Intergenic
1135547537 16:23376006-23376028 TGCAGAAAGGAGGCCTGGGAGGG - Intronic
1135567760 16:23524933-23524955 TGGGAAAATCAGGCCAGGCACGG - Intronic
1135940812 16:26820104-26820126 TGGGGAAAGGAGGTCAGAGAGGG - Intergenic
1136016864 16:27406046-27406068 TGGGGAAAGGAGGCCCAGAGAGG - Intronic
1136115511 16:28091872-28091894 TGGGGAAGGCAGGCATGGGTAGG + Intergenic
1136230497 16:28882901-28882923 GGGGGAAGCCAGGCCCGGGAGGG - Intronic
1136615114 16:31393744-31393766 TGGGGGAAACAGGCCCAGGGAGG - Intronic
1136716860 16:32288664-32288686 TGGGGAGGGCAGGGCCGGGCCGG - Intergenic
1136835236 16:33494909-33494931 TGGGGAGGGCAGGGCCGGGCCGG - Intergenic
1136933193 16:34436718-34436740 TGGGGAGAGGAGGCCATGGAAGG + Intergenic
1136971379 16:34975096-34975118 TGGGGAGAGGAGGCCATGGAAGG - Intergenic
1137374941 16:47944336-47944358 AGGGGAAAGCAGGGCCAGGGAGG + Intergenic
1138450691 16:57092274-57092296 CGGGCAAAGCAGGCCTGGGGAGG + Intergenic
1139405935 16:66717718-66717740 TGGGAAAAGGAGGCCTGAGAGGG + Intergenic
1139505498 16:67396322-67396344 TGGGGAAAGCAGGCCCGGGAAGG + Intronic
1139664278 16:68445864-68445886 TGGGGAGGGCAGGTCTGGGAGGG + Intronic
1139918959 16:70446899-70446921 TGGGGAAAGCAGGATAGGGCAGG - Intergenic
1140131586 16:72166593-72166615 AGGGGGAAGCAGGACAGGGAAGG + Intronic
1141205446 16:81929684-81929706 TGTGGAAAGCAGGCTGGGCATGG - Intronic
1141290759 16:82716287-82716309 ATGGAAAAGCAGGCTCGGGATGG - Intronic
1141344187 16:83230330-83230352 CCGGGAAAGCAGGCACAGGAAGG + Intronic
1141345409 16:83240259-83240281 TAGGGAACGTAGGCCTGGGAGGG + Intronic
1141428266 16:83957394-83957416 TGGGGCAACCAGGCCCGAGGAGG + Intronic
1141877910 16:86838666-86838688 TGGGGCATGCATGCCGGGGAGGG + Intergenic
1141883781 16:86878324-86878346 TGGGGAACGCAGGCGGGGAAAGG - Intergenic
1142146058 16:88493358-88493380 TGGGGAGAGCTGTCCCGGGGTGG + Intronic
1142146100 16:88493478-88493500 TGGGGAGAGCTGTCCCGGGGTGG + Intronic
1142146123 16:88493538-88493560 TGGGGAGAGCTGTCCCGGGGTGG + Intronic
1142155305 16:88530215-88530237 TGGGGACAGCAGGCTGGTGAGGG + Intronic
1142308343 16:89298243-89298265 TGTGGAAAGGAGGCCCAGGGTGG - Intronic
1203009567 16_KI270728v1_random:229123-229145 TGGGGAGGGCAGGGCCGGGCCGG + Intergenic
1203145408 16_KI270728v1_random:1795230-1795252 TGGGGAGGGCAGGGCCGGGCCGG - Intergenic
1143852234 17:9821718-9821740 TGGGGAAGACAGGTGCGGGATGG - Intronic
1144265345 17:13563130-13563152 TGGAGAAGGCAGGGCTGGGAAGG - Intronic
1144578266 17:16443521-16443543 TGGGCAAGGCAGGCAGGGGAGGG - Exonic
1145101367 17:20080574-20080596 TGGGGAAGGCAGTCTCGGGGAGG + Intronic
1145736799 17:27238799-27238821 TGGGCCAAGCAGGGCAGGGAGGG + Intergenic
1145913260 17:28554832-28554854 TGAGGTAAGCAGGCAGGGGATGG - Exonic
1146121203 17:30196899-30196921 TGGGGAAAGGAGGCCAAGGGAGG + Exonic
1146603067 17:34235285-34235307 TCTGGAAAGCAGGCCTGGAAGGG + Intergenic
1147185511 17:38711223-38711245 TGGGGGAGGCAGGCCCTGGCTGG + Intronic
1147561974 17:41514826-41514848 TGGGGATAGCAGGCCTGGATGGG - Intronic
1148203702 17:45766315-45766337 TGGGGAAGGCGGGCAGGGGAGGG - Intergenic
1148253855 17:46110809-46110831 TGGGGAAAGCAGGTCAAGCATGG + Intronic
1149449715 17:56740050-56740072 CTGGGAAAGCTGGCCAGGGATGG + Intergenic
1149575013 17:57705616-57705638 TGGGGAAGGCAGCCCAGAGAAGG - Intergenic
1150133141 17:62680025-62680047 TCAGGAAAGCAGGTCCGAGAGGG + Intronic
1151190865 17:72396820-72396842 AGGGGCAAGCAGGCCCTGGGAGG - Intergenic
1151261874 17:72922451-72922473 TGACGAAAGCAGGTCCTGGAAGG + Intronic
1151766507 17:76135940-76135962 TGGGGCAGGCGGGCCCGGGCAGG + Intergenic
1151817631 17:76479049-76479071 TGGGGAAAGGAGGCAGGGGTGGG - Intronic
1151898808 17:76998097-76998119 TGGGGAAAGCAGAACAGGGACGG + Intergenic
1151924421 17:77184074-77184096 TGGGGAAATAAGGCCGGGCATGG - Intronic
1152135592 17:78501450-78501472 GGGGGAAAGAGGGCCAGGGAGGG - Intronic
1152236626 17:79142478-79142500 TGGGGTCAGCAGGCTGGGGAGGG - Intronic
1152356939 17:79812076-79812098 TGGGGAGAGCGGGTCAGGGATGG - Intergenic
1152396425 17:80036065-80036087 TGGGGACGCCAGGCTCGGGACGG - Intergenic
1152467068 17:80472527-80472549 TGGGGAAAGGGGGCCCAGAATGG + Intronic
1152528212 17:80901821-80901843 TGGGGAAGGCAGAGCAGGGAGGG - Intronic
1152553075 17:81039513-81039535 TGGGGACAGCAGGCACGGGCAGG - Intronic
1152689231 17:81710422-81710444 TGGGGGAAGCAGGGCCTGGAGGG - Intergenic
1152789947 17:82273492-82273514 TGGTGAAAGCGGGGCCGTGAGGG - Exonic
1153055277 18:939688-939710 AGAGAAAAGCAGGCCCAGGAAGG + Intergenic
1157334702 18:46729364-46729386 TGGGGAAAGGGGGCCAGGGGTGG + Intronic
1158491173 18:57910929-57910951 TGGGGAAGGCAGGTCTGGAAGGG + Intergenic
1158649330 18:59272616-59272638 TGGGGCGACGAGGCCCGGGAGGG + Intronic
1160304508 18:77719099-77719121 TGGGGTAAGCAGGCCAGGGATGG + Intergenic
1160418162 18:78726427-78726449 GGGGGACAGCAGGCCTGGGCGGG - Intergenic
1160703146 19:517831-517853 TGGGGAGGGGAGGCCCGGGCTGG + Intronic
1162416762 19:10543380-10543402 AGGGGTAGGCAGGCGCGGGAGGG - Intergenic
1163339301 19:16694418-16694440 TGGGGAAAGAAGGACAGGGTAGG + Intergenic
1163668517 19:18614047-18614069 TGGGGAGAGGTGGCCTGGGAAGG + Intronic
1163756852 19:19111406-19111428 TGGAGAAGGCAGGGCCGGCAGGG - Exonic
1163783300 19:19261627-19261649 TGGGGAAGGCAGGCCCGGGAGGG - Intronic
1164408151 19:27973059-27973081 TGGGGAAAGTAGGCCATGGTTGG + Intergenic
1165118095 19:33541265-33541287 TGGGGAGAGCTGGCCAGGGATGG + Intergenic
1165689041 19:37848640-37848662 TGGGAAAAGCAGGCCGGGCGTGG + Intergenic
1165747728 19:38240267-38240289 TGGGGAAAATAGGCCAGGCACGG + Intergenic
1165828491 19:38719022-38719044 AGGGGGAGCCAGGCCCGGGAAGG - Intronic
1165854378 19:38870906-38870928 TGGCGAGAGCCGGCCCAGGATGG + Exonic
1165914449 19:39248924-39248946 TTGGGAAAGCTTGCCCTGGACGG - Intergenic
1166012248 19:39951176-39951198 GGGGGAAAGCAGCCCTGGTATGG + Intergenic
1166542433 19:43614355-43614377 TGTGGAGAGCTGGCCGGGGAGGG - Exonic
1166781606 19:45346215-45346237 TAGGGGAACCAGGCCTGGGAAGG + Intronic
1166990964 19:46692507-46692529 TGGGGCAAGGAGACCAGGGAAGG - Intronic
1167211399 19:48136129-48136151 GGGAGAGAGCAGGCCAGGGAAGG + Intronic
1167233949 19:48302652-48302674 TGGAGAAGCCAGGCTCGGGAGGG + Intronic
1168011848 19:53539192-53539214 TGGGGAAAACAGAACCGGAAGGG - Intronic
1168311762 19:55464346-55464368 TGGGGAAGGTGGGCACGGGACGG - Intergenic
925306036 2:2848902-2848924 TGGGGGAAGGAAGCCAGGGAGGG + Intergenic
925414095 2:3657343-3657365 TGGGGAAAGAAAACCCAGGAAGG + Intergenic
925833960 2:7924644-7924666 TGAGGACAGCAGGCCAGGGCAGG - Intergenic
926111921 2:10189077-10189099 TGGGGAATGGAGGCACAGGAGGG + Intronic
927134792 2:20088899-20088921 TGGAGAAAGGAGGCTAGGGAAGG - Intergenic
927932953 2:27057387-27057409 AGGGGAAAGCCGGCGGGGGAGGG - Exonic
927988248 2:27428742-27428764 AGGGAAAAGAGGGCCCGGGAGGG + Intronic
929116321 2:38447402-38447424 TGGGCAAGGCAGGCCTGGTAGGG + Intergenic
930240683 2:48932861-48932883 TGGGGAAAGCAGGCCTGTGCAGG + Intergenic
930595106 2:53377941-53377963 TGGGGAAAGAAGGCACTGGTTGG + Intergenic
932090222 2:68799743-68799765 TGGGGGAAGAAGGGCCGGGAGGG + Intronic
932416062 2:71574529-71574551 TGGGGAAAGCAGCCCCAGTCTGG + Intronic
934714646 2:96536683-96536705 TGGGGCGAGCAGGGGCGGGACGG + Intergenic
934925925 2:98381731-98381753 TGGGGGAAGGAGGCTGGGGAAGG + Intronic
935435635 2:103029017-103029039 TGGGGAAGGCTGGCTCAGGAGGG + Intergenic
936020153 2:108988580-108988602 TGGGGAAGGCAGGCGCGGCAGGG - Intronic
937121474 2:119442409-119442431 TGGGGAGGGCAGGCCCGTAAGGG - Intronic
937206601 2:120240677-120240699 TGGGGATAGCAGGCCTGTGTAGG - Intronic
937237138 2:120437746-120437768 TGGGGAAATCATGCCAGGGAGGG + Intergenic
937292290 2:120788865-120788887 TGGGGACAGCAGGCACAGGCTGG + Intronic
938168903 2:129057650-129057672 AGGGGACAGCAGCCCTGGGATGG - Intergenic
939964024 2:148592947-148592969 TGGGGCAAGCAGGATGGGGAAGG + Intergenic
946095508 2:217270823-217270845 TGTGGAAAGGAGGCCAGGAAAGG + Intergenic
946199925 2:218065473-218065495 TGGGGCTGGCAGGCCCGGCAAGG - Intronic
946306735 2:218860521-218860543 TAGGCAAAGCAGGGCGGGGAAGG - Intronic
946371042 2:219281590-219281612 GGGGGAAAGCAGGCACAGCAGGG - Intronic
947718496 2:232353395-232353417 TGGAGAGAGAAGGCCCAGGAGGG + Intergenic
947944094 2:234084789-234084811 TGGGGAAACCATGCCAGGGTAGG + Intergenic
948461780 2:238133111-238133133 TGGGGCAGGCAGGGCCGGGAAGG + Exonic
948498150 2:238368214-238368236 TGGGTAAAGCAGGCTCAGGAGGG + Intronic
1169343454 20:4812973-4812995 TGGGAAAAGCAGACCCTGCAGGG + Intronic
1170572348 20:17639601-17639623 TGAGGTAAACAGGCCAGGGACGG + Intronic
1170821861 20:19760825-19760847 TGGGGAAAGGAGGACAGGGTCGG - Intergenic
1171201330 20:23244713-23244735 TGGGAGGAGCAGGCCCAGGACGG + Intergenic
1172096296 20:32462148-32462170 TGGGGAAAGCAGGGCTGATAGGG + Intronic
1173577789 20:44124195-44124217 TGGGGAAAGGAGGCCAGGGTGGG - Intronic
1174546781 20:51331574-51331596 AGGGGAAAGCAGGGCCAGCAAGG + Intergenic
1174707243 20:52669418-52669440 TGGGAGAAGCAGCCCAGGGAAGG + Intergenic
1174751788 20:53118447-53118469 TGAGGAAAGCAGGACAGGGCAGG + Intronic
1174970642 20:55271436-55271458 TGGGAGAAGCAGACCGGGGAAGG - Intergenic
1175545166 20:59773327-59773349 TGTGGAGAGCTGGCCCCGGAGGG - Exonic
1175892724 20:62322626-62322648 TGGGGTAAGCAGGGCTGGGTGGG - Intronic
1176214859 20:63943177-63943199 TGGGGCAAGCAGGACCCGGGTGG + Intronic
1178223971 21:30693401-30693423 TGGGGAAAGCAGTCCCTTCAAGG - Intergenic
1178602068 21:34003146-34003168 TGAGGAAAGGAGGCCCAGAATGG + Intergenic
1178664350 21:34533754-34533776 TGGTGAAAGCAAGCCCGGCCAGG + Intronic
1178899664 21:36588930-36588952 TGGGAAAAGCAGTGGCGGGAGGG - Intergenic
1179049705 21:37878749-37878771 TGGGGAAAGAGGGTCCGGGAGGG + Intronic
1179089697 21:38253163-38253185 TGGGGAAAGCAAGTCAGGAAGGG - Intronic
1179171121 21:38973619-38973641 TGGAGAAAGGAGGCCCTGGCAGG + Intergenic
1179172191 21:38981258-38981280 TGAGGACAGCAGCCCGGGGATGG + Intergenic
1179504076 21:41828590-41828612 TGGGGCAGGGTGGCCCGGGAGGG - Intronic
1179629162 21:42666085-42666107 AGGGGAAAGCAGCCCTGGGGTGG + Intronic
1179708501 21:43195904-43195926 TGGGGAAGGAAGGGGCGGGAAGG + Intergenic
1180169442 21:46050301-46050323 TTTGGAAAGCCTGCCCGGGATGG - Intergenic
1181172453 22:21017309-21017331 TGGGGAATGTATGCCCAGGAAGG - Intronic
1181263283 22:21614093-21614115 TGGGAAAAGCAGGCCCAAGTGGG - Intronic
1181950202 22:26548345-26548367 GGGGGAAAGGAGGCGGGGGAGGG + Intronic
1183365318 22:37403697-37403719 TGGGGAGAGGAGGTCCCGGATGG - Intronic
1183439157 22:37813455-37813477 TGGGGTCAGCAGGGCCTGGAGGG - Exonic
1183771149 22:39927171-39927193 TGGGGATAGCATGGCCGGGGGGG - Intronic
1183828956 22:40408045-40408067 TGGGAAAAACAGGCCCTGTAAGG - Intronic
1183933638 22:41249696-41249718 AAGGAACAGCAGGCCCGGGAGGG - Intronic
1184653253 22:45928831-45928853 TGGGGAAACCAGGGCCAGGATGG - Intronic
1184676176 22:46044700-46044722 GAGGAAAAGCAGGCCGGGGAGGG - Intergenic
1185193664 22:49454712-49454734 TGGGGAGAAGAGGCCAGGGAGGG + Intronic
1185419069 22:50725344-50725366 AAGGAAAAGCAGGCCCGGGTAGG - Intergenic
949881246 3:8662711-8662733 TGGGGAAAGCAGGGCTGTGTAGG - Intronic
950012293 3:9732046-9732068 CGGGGAAAGTCGGGCCGGGAAGG - Exonic
950217618 3:11170504-11170526 TGGGGAAGGCAGACCCGGAACGG + Intronic
950415910 3:12869029-12869051 TGGGCACAGCAGCCCCTGGAGGG + Intronic
950542772 3:13622103-13622125 TGGGGAAAGCAGCCTCCGGGTGG - Intronic
950613389 3:14140140-14140162 TTGGGAAAACAGGCCCGGGAAGG + Intronic
950703797 3:14767790-14767812 TCTGGAGAGCAGGCCCGTGAGGG - Intronic
951454819 3:22878623-22878645 TTGGGGAAGCAGGGCAGGGAAGG - Intergenic
951544392 3:23810517-23810539 GGGGAAAAGCAGGTCCGGGGAGG + Intronic
951867551 3:27324824-27324846 TGGGGAGGCCAGGCCCTGGAGGG - Intronic
952523593 3:34186499-34186521 TGGGAAAAGGTGGCCAGGGAAGG + Intergenic
952861934 3:37820150-37820172 TGGGGGAAGCAGGACAAGGAAGG + Exonic
953308856 3:41857214-41857236 TGGGGAAAGCTGGCCCTCTAGGG - Intronic
953312208 3:41890900-41890922 GGGGGAAAGAAGGGACGGGAGGG + Intronic
953312223 3:41890941-41890963 CGGGGAAAGAAGGGACGGGAGGG + Intronic
953312231 3:41890961-41890983 GGGGGAAAGAAGGGACGGGAGGG + Intronic
953312239 3:41890981-41891003 GGGGGAAAGAAGGGACGGGAGGG + Intronic
953312247 3:41891001-41891023 GGGGGAAAGAAGGGACGGGAGGG + Intronic
953312255 3:41891021-41891043 GGGGGAAAGAAGGGACGGGAGGG + Intronic
953312263 3:41891041-41891063 GGGGGAAAGAAGGGACGGGAGGG + Intronic
953312281 3:41891082-41891104 GGGGGAAAGAAGGGACGGGAGGG + Intronic
953312330 3:41891206-41891228 CGGGGAAAGAAGGGACGGGAGGG + Intronic
953686152 3:45079835-45079857 TGGTGAAAGAAGGCCCAGCAAGG - Intergenic
953707950 3:45245397-45245419 TGGGGAAAGCAGGACCAGGAAGG + Intergenic
953725106 3:45390600-45390622 TGGGCAAAGAAGGCCCGGTCTGG - Intronic
953878418 3:46679290-46679312 TGGGGAGAGGAAGCCAGGGAGGG + Intronic
954033636 3:47838056-47838078 TGGGGAAGCCAGGCCAAGGAGGG + Intronic
954316776 3:49805770-49805792 TGGGGAAAGAATGCTTGGGAAGG + Intronic
954334649 3:49909233-49909255 TGGGTAAGGCAGCCCTGGGATGG - Exonic
954377868 3:50204524-50204546 TGTGGAAAGCAGGCAGGGGTGGG + Intergenic
954814523 3:53270208-53270230 CAAGGAAAGCAGGCCCGGCAGGG - Intergenic
956383146 3:68686761-68686783 TGGGTACAGCAGCCCAGGGAGGG - Intergenic
956791496 3:72683518-72683540 TGGGGGGAGCAGGACAGGGAAGG + Intergenic
959114715 3:102163069-102163091 TGTGGAAAGCAGGCAAGGGAGGG + Intronic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
960950123 3:122993775-122993797 TGGGGGAGGCAGGAGCGGGAGGG - Intronic
961376445 3:126469296-126469318 TGGGGAGAGCAGGCCAGGCAGGG - Intronic
961555144 3:127692146-127692168 TGGGGGATGCAGGCAGGGGAAGG - Exonic
961673236 3:128549636-128549658 TGGGGGCAGAAGGCCAGGGAAGG + Intergenic
961764678 3:129200214-129200236 AGGTGAAAGCAGGCACGGGGTGG - Intergenic
963257949 3:143164600-143164622 TAAGGAAAGCAGGCCCAGAAAGG - Intergenic
963919514 3:150892316-150892338 TGAGGGAAGCAGGACAGGGAAGG - Intronic
964826337 3:160832263-160832285 TGGGGAACTCAGGCCAGGCAAGG + Intronic
965597870 3:170425661-170425683 TGGGGGAAGCAGGACATGGAGGG + Intronic
965757840 3:172042445-172042467 TTGGAAAATGAGGCCCGGGAAGG + Intronic
965840927 3:172904849-172904871 TGGGGCAATCGGACCCGGGAAGG - Intronic
966807552 3:183818851-183818873 GGGGGAAGGCGGGCCCTGGAGGG + Intronic
967841056 3:194004710-194004732 AGTGGGAAGCAGGGCCGGGAAGG + Intergenic
967873557 3:194251489-194251511 TGGGGAGAGCAGGGCAGAGAAGG + Intergenic
968434354 4:576859-576881 GGGGGAAAGGAGCCCGGGGAGGG + Intergenic
968816844 4:2825970-2825992 TGGGGACAGGAGGCCCAGGGAGG + Intronic
968826339 4:2900451-2900473 TGGGGAAAGAAGGCCTCAGAGGG + Intronic
969444210 4:7234897-7234919 TGGGGCCAGGAGGCCGGGGAAGG + Intronic
969582391 4:8072841-8072863 TGGGGAACGCAGGCCCTGCAAGG + Intronic
969720573 4:8891234-8891256 TAGGGAAAGCAGGCCTGAGGAGG + Intergenic
969830278 4:9790422-9790444 TTGGGAAAGCATGCCCAGTATGG + Intronic
970483378 4:16500270-16500292 TGGGAAAAGCAGGATAGGGAAGG - Intergenic
972162479 4:36244140-36244162 TCGGGAAGGCTGGGCCGGGATGG - Intronic
978333471 4:107641130-107641152 TGGGCAATGCAGGCCTGGTAAGG - Intronic
982221117 4:153126011-153126033 TGGGGAAGGCATGCTGGGGAGGG + Intergenic
984831583 4:183980476-183980498 TCGGGAAAGCAGCCCTTGGAAGG + Intronic
985512708 5:321457-321479 GGGGGAACGCAGGGCCTGGAGGG + Intronic
985513556 5:325380-325402 TGGGGAGAACAGGCCAGAGACGG - Intronic
985713180 5:1441814-1441836 GGGGGGACGCAGGCCAGGGAAGG - Intronic
986063305 5:4212091-4212113 TGGGGAGAGCATGGCCGTGAGGG + Intergenic
986074283 5:4318569-4318591 TGGGGAAATCTCCCCCGGGAAGG - Intergenic
987150490 5:15034623-15034645 TGGGGAGAGCAGGCAAGTGAAGG - Intergenic
989547687 5:42693659-42693681 TAGGGAAGGCAGGGCCTGGAAGG - Intronic
992232016 5:74672778-74672800 TGGAGAAAGCTGAACCGGGAGGG - Intronic
992272830 5:75083431-75083453 AGGGGAAAGCAGGCCAGGCCAGG + Intronic
992828630 5:80572775-80572797 TGGGGAGAGGAGGGCAGGGAGGG - Intergenic
994098828 5:95872770-95872792 TGTGGACAGCAGGTCCTGGATGG - Intergenic
998137497 5:139681897-139681919 GGGGGAAAGATGGCCCTGGAGGG - Intronic
999107743 5:149088640-149088662 TGGGTAAAGCTGGCCCAGAAAGG + Intergenic
999249301 5:150172620-150172642 GGGGGAAAGGAGGCCAGGCAGGG + Intronic
999723962 5:154419514-154419536 TGGGAAAGGCAGGCCCGGGACGG - Exonic
999936744 5:156494865-156494887 TGAGGAAGCCAGGCCTGGGAAGG - Intronic
1000616948 5:163437747-163437769 TGAGGTGAGCAGGCCCGGGGAGG + Exonic
1001801620 5:174549191-174549213 AGGAGAAAACAGGCCTGGGATGG - Intergenic
1001861920 5:175063359-175063381 TTGGGAAAGGAGGCACAGGAAGG - Intergenic
1001922320 5:175610296-175610318 TGGGGAGAACAGCCCAGGGATGG - Intergenic
1002065174 5:176648124-176648146 AAGGGAAAGGAGGCCGGGGAAGG - Intronic
1002073806 5:176696416-176696438 TGGGGAAGGCAGGGTCGGGGTGG + Intergenic
1002607237 5:180390561-180390583 GGGGGCAGGCAGGCCAGGGATGG - Intergenic
1003080528 6:3017532-3017554 CTGGGGAAGCAGGCCTGGGAGGG - Intronic
1003325000 6:5084793-5084815 TGGGGAAAGCAGGAGCAGAAGGG + Exonic
1003909040 6:10726940-10726962 TGGGGAAGGGAGGTCCGTGATGG + Intronic
1003912066 6:10752042-10752064 TGGGGAAGGGAGGTCCGTGATGG + Intronic
1005953313 6:30647122-30647144 AGGGGAAAGGAGGCCGGGGCGGG - Exonic
1006319636 6:33312965-33312987 GGGGGAAAGCAGGGCCGGGCAGG - Intronic
1006429396 6:33985725-33985747 TGGGGAAAGGGGGCCTTGGAAGG + Intergenic
1006837306 6:37006798-37006820 TGAGGGAAGCAGGGCCGGGCAGG + Intronic
1006905821 6:37532797-37532819 TGGGGAAGGCAGGGGCAGGAGGG + Intergenic
1007298240 6:40845164-40845186 TTGGGAAAGCAGGTGGGGGAAGG + Intergenic
1007752100 6:44076923-44076945 TGGGTAAAGCAGGGCAGAGAGGG - Intergenic
1008141754 6:47840025-47840047 TGGGGAAACCAGGCAAGGGATGG + Intergenic
1009320913 6:62286865-62286887 TGGGGAAAGGAGGCACGGATAGG - Intergenic
1014725771 6:124970092-124970114 TGGGGAAAGCTGGTCGGGCAGGG + Intronic
1015588774 6:134802800-134802822 TGGGGAAGACAGGCTAGGGAGGG + Intergenic
1016304587 6:142670583-142670605 TGGGTAAAGCAGGCATGGGGAGG + Intergenic
1017888446 6:158620201-158620223 TGGTGAGAGGAGGCCCGGGGGGG + Intronic
1018369520 6:163155203-163155225 TTTGGAAAGCGGGCTCGGGAAGG - Intronic
1018762985 6:166906953-166906975 TGGGGAGAGCGGGGCCGGGCAGG - Intronic
1018763000 6:166907002-166907024 TGGGGAGAGCGGGGCCGGGCAGG - Intronic
1018890250 6:167977418-167977440 AGGGGACAGCAGGCCCCGGATGG - Intergenic
1018890270 6:167977466-167977488 AGGGGAGAGGAGGCCCCGGATGG - Intergenic
1018890291 6:167977514-167977536 AGGGGAGAGGAGGCCCCGGATGG - Intergenic
1018890312 6:167977562-167977584 AGGGGAGAGGAGGCCCCGGATGG - Intergenic
1018890333 6:167977610-167977632 AGGGGAGAGGAGGCCCCGGATGG - Intergenic
1018890354 6:167977658-167977680 AGGGGAGAGGAGGCCCCGGATGG - Intergenic
1018890375 6:167977706-167977728 AGGGGACAGCAGGCCCCGGATGG - Intergenic
1018890395 6:167977754-167977776 AGGGGAGAGGAGGCCCCGGATGG - Intergenic
1018890414 6:167977802-167977824 AGGGGAGAGGAGGCCCCGGATGG - Intergenic
1018890435 6:167977850-167977872 AGGGGAGAGGAGGCCCCGGATGG - Intergenic
1019100186 6:169623835-169623857 TGAGGAAAACAGGCCCAGGCTGG - Intronic
1020112408 7:5454982-5455004 TGGGGAAACCAGAGCCTGGAGGG + Intronic
1020170289 7:5839844-5839866 TGGGGAAAGCTGACCTCGGAAGG + Intergenic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1021506068 7:21386404-21386426 TGGAGAAAGCAGCCTAGGGATGG - Intergenic
1022252927 7:28626855-28626877 TGGGGAAAGGGGCCCCAGGACGG + Intronic
1023125947 7:36954371-36954393 TGGGGGAAGCAGGGACAGGAGGG + Intronic
1023420406 7:39973424-39973446 TGGGCAAAGAAGGCCAGGCATGG - Intronic
1023822271 7:43986775-43986797 TGGCGAGAGCAGCCCGGGGAGGG + Intergenic
1024226491 7:47329762-47329784 TGGGGCAGCCAGGCCCAGGAAGG + Intronic
1024303338 7:47904626-47904648 TGGGGAAAGGAGGGCAGGGAAGG + Intronic
1025008413 7:55374545-55374567 TGGGAAAAGCAGGCAGGGGTGGG - Intronic
1025260599 7:57415147-57415169 TGGGGAAGCCAGGCCCTGTAGGG + Intergenic
1026901235 7:74038538-74038560 TGGGGAATGCACCCCCAGGAAGG + Intronic
1026902804 7:74046372-74046394 TGGGGGGAGCAGGCCTGGGATGG - Intronic
1026924692 7:74182521-74182543 TGGGGAAAGTAGGGCCCAGAAGG - Intronic
1029052508 7:97703740-97703762 TGCGCAAAGCAGGCCGGGCATGG + Intergenic
1029269762 7:99370133-99370155 TGGGGGAGGCAGGCCAGGGCTGG - Intronic
1029298119 7:99558104-99558126 TGGGGAAAGCGGGGACGGGAGGG - Intronic
1029693920 7:102201059-102201081 CGGGGAAAGGAGCCCCAGGAGGG + Intronic
1029722889 7:102381671-102381693 TGAGGAAATGAGGCACGGGAAGG + Intronic
1029750536 7:102540189-102540211 TGGCGAGAGCAGCCCGGGGAGGG + Intronic
1029768489 7:102639297-102639319 TGGCGAGAGCAGCCCGGGGAGGG + Intronic
1030214038 7:107025115-107025137 GGGGGAAGGCAGGCTGGGGAGGG + Intergenic
1030927597 7:115477396-115477418 TGGGGAGTGCAAGCCTGGGACGG - Intergenic
1030944762 7:115704383-115704405 TGGGGAAAGCAGAGACAGGAGGG - Intergenic
1032524581 7:132570241-132570263 TCAGGAAAGCAGGCCTGAGATGG + Intronic
1033606763 7:142933254-142933276 TTCGGAAAGCAGGCCCAGGTGGG + Intronic
1034182195 7:149147612-149147634 CGGGGAAGGCAGGGCCGGGTCGG + Exonic
1034506461 7:151496105-151496127 TGGTGAAAGCAGCCCTGGAATGG - Intronic
1034530749 7:151694987-151695009 TTGGGTCAGCAGGCCCGGGCAGG + Intronic
1036093960 8:5702799-5702821 TGGGGACAGCAGTCTTGGGATGG - Intergenic
1036661227 8:10710422-10710444 TGGGGACAGGGGGCCTGGGAGGG + Intronic
1036663776 8:10725990-10726012 CGGGGAAAGCTGGCCCAGGTGGG + Exonic
1038229444 8:25686629-25686651 TGGGTAAAGGAGTCCTGGGAGGG - Intergenic
1039248623 8:35636624-35636646 TGGGGAAGACAGGGCCAGGAGGG - Intronic
1042827512 8:72993594-72993616 TGGAGGAAGCAGGACAGGGAAGG + Intergenic
1048044984 8:130764901-130764923 TGGGGAAAGTAGGGCAAGGAAGG + Intergenic
1049170643 8:141158707-141158729 TGGGGAAAGCTGGGCAAGGAGGG - Intronic
1049614848 8:143571635-143571657 TGGGGACCGCAGGGCCAGGACGG + Intronic
1049651614 8:143772293-143772315 TGGGGGAAGGAGGCCCCTGAGGG - Intergenic
1050520707 9:6496721-6496743 TGTGGAAAGTAGACCTGGGAAGG + Intronic
1051931170 9:22388212-22388234 TGGGGAAAACAGGCCAAAGAAGG - Intergenic
1053199404 9:36142510-36142532 AGGAGAAAGCAGGCCCGGGATGG + Intronic
1053287906 9:36861737-36861759 AGGGGAGAGAAGGCCAGGGAGGG + Intronic
1053402382 9:37837168-37837190 TGCGCAAAGCAGGCCGGGCACGG + Intronic
1054720462 9:68598429-68598451 TGTGGAAAGAAGGCCAGGCACGG - Intergenic
1057010511 9:91597336-91597358 TGAGGAAAGCAAGCCCAGGGAGG - Intronic
1059655919 9:116357502-116357524 TGCAGAAAGAAGGCCCGGGGAGG + Intronic
1059734230 9:117085686-117085708 TGGGGAAAGGTAGCCTGGGAGGG - Intronic
1060204330 9:121673839-121673861 TGGGGAAACCAGGCCCTGAGAGG - Intronic
1060416388 9:123433817-123433839 TGGGGAAAGCAGTCAGGGGAAGG - Intronic
1060942685 9:127552090-127552112 TGGGGAAGACAGGCCCAGCATGG - Intronic
1060992299 9:127856115-127856137 TGAGGAAAGCATGCCAGGCAGGG + Intergenic
1061087887 9:128409747-128409769 TGGGGAAAGCAGGCTGGGAGAGG - Intergenic
1061296546 9:129679851-129679873 TGGGAAACGGAGGCCCTGGAGGG - Intronic
1061724547 9:132574985-132575007 GGGGAAAAGCAGGCCTGGGAGGG - Intergenic
1061814811 9:133188326-133188348 TGGGGAACGCAGGCACCGGCTGG + Intergenic
1061821214 9:133228104-133228126 TGGGGGCTGCAGGCCAGGGAAGG - Intergenic
1061834230 9:133318260-133318282 TGGGGGCTGCAGGCCAGGGAAGG + Intergenic
1061940237 9:133880084-133880106 TGGGGAAGACAGGCCAAGGAAGG + Intronic
1062162706 9:135088663-135088685 TTGGGAATGCAGGCGCGGGCAGG - Intronic
1062385316 9:136307032-136307054 GGGAGAAAGGAGGCCAGGGAGGG + Intergenic
1062407740 9:136404911-136404933 TGGGGATAGCTGGCCCACGAGGG - Intronic
1062420014 9:136476121-136476143 TGGGCACAGCTGGCCCAGGAAGG + Exonic
1062665295 9:137667537-137667559 TGGGGAAAGCAGGACCCGGGAGG + Intronic
1062690156 9:137837511-137837533 CGGGGAGTGCAGGCCTGGGAAGG + Intronic
1062716027 9:138010531-138010553 TGGGGAGAGCATGACCAGGAGGG - Intronic
1185666792 X:1771947-1771969 TGGGGAAACCAGAGCTGGGAGGG + Intergenic
1189099329 X:38172659-38172681 TGAGGAAAGCAGAACAGGGAAGG + Intronic
1189239751 X:39516087-39516109 TGAGGAACGCAGGCCCCAGAAGG - Intergenic
1190708528 X:53049292-53049314 CAGGGAAAGCAGGCACCGGAGGG - Exonic
1190973580 X:55377400-55377422 TGGGGAAATCAGGCAAGAGAAGG - Intergenic
1191951366 X:66597376-66597398 TGGGGAACTCAGGCCCCAGAAGG + Exonic
1196438137 X:115693300-115693322 GGGGAAAAGCAGGCCTGGCATGG + Intergenic
1198253698 X:134906814-134906836 TGTGGGAAGCAGGCCCAGGATGG + Intronic
1200145473 X:153924165-153924187 TGGGGGAAGCAGGGCAGGGCAGG - Intronic
1202014911 Y:20393242-20393264 TGTGCAAAGCAGGACCTGGAAGG - Intergenic