ID: 1139506906

View in Genome Browser
Species Human (GRCh38)
Location 16:67403054-67403076
Sequence TTGTCTCAGCTGAGACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 309}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139506904_1139506906 1 Left 1139506904 16:67403030-67403052 CCAGAAGGCTTACCTGAGGAAGT 0: 1
1: 0
2: 0
3: 20
4: 162
Right 1139506906 16:67403054-67403076 TTGTCTCAGCTGAGACAGAGAGG 0: 1
1: 0
2: 3
3: 34
4: 309
1139506897_1139506906 30 Left 1139506897 16:67403001-67403023 CCAAATGACCTCATCTAGTCTGA 0: 1
1: 0
2: 4
3: 36
4: 352
Right 1139506906 16:67403054-67403076 TTGTCTCAGCTGAGACAGAGAGG 0: 1
1: 0
2: 3
3: 34
4: 309
1139506901_1139506906 22 Left 1139506901 16:67403009-67403031 CCTCATCTAGTCTGAAGGGGTCC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1139506906 16:67403054-67403076 TTGTCTCAGCTGAGACAGAGAGG 0: 1
1: 0
2: 3
3: 34
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139506906 Original CRISPR TTGTCTCAGCTGAGACAGAG AGG Intronic
900658085 1:3770034-3770056 TTCTCTCAGCTCAGGCAGAGGGG + Intronic
901132074 1:6968284-6968306 TTGTCCCAGCACAGAAAGAGCGG - Intronic
902176211 1:14652878-14652900 TTGTCACAGCTGGGAGAGAGGGG + Intronic
902181809 1:14695075-14695097 TTCTCTCAGCTTAGACAGGGAGG + Intronic
904248048 1:29202109-29202131 TTCTCCCAGCTGTGGCAGAGAGG - Intronic
904353748 1:29925275-29925297 GGGTCTCAGCTGGGACAGCGGGG - Intergenic
904354748 1:29931666-29931688 TTGTCTCTCCTGGGAGAGAGTGG + Intergenic
904420016 1:30385302-30385324 CTGGCTCAGCACAGACAGAGAGG - Intergenic
905049389 1:35036752-35036774 ATGTTTCAGCTCAGACAGTGAGG - Intergenic
905074985 1:35262493-35262515 TTGTCTCAGCTTGGAGGGAGAGG + Intergenic
905980262 1:42219223-42219245 ATGTCCCAGGTGGGACAGAGTGG - Intronic
906249639 1:44301228-44301250 TAGTCTGAGCTCAGAGAGAGTGG - Intronic
906928301 1:50142565-50142587 TTTTCTCATCTGAAGCAGAGTGG - Intronic
907462690 1:54614666-54614688 TGGACACAGCTGGGACAGAGAGG + Intronic
908840770 1:68278040-68278062 CTGTGTCAGCTGAGAGAGGGAGG - Intergenic
909673568 1:78214458-78214480 TTGTCTCTGCTGAGTCAGGCAGG - Intergenic
912056095 1:105599674-105599696 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
912074174 1:105851169-105851191 TTGTCTCAGGTGAAACTTAGAGG - Intergenic
912950777 1:114118801-114118823 TTGCCTCAGCTGACACCGACAGG - Intronic
914786417 1:150836425-150836447 TTGTCTCATGTGAGACAGGCAGG - Exonic
916156072 1:161850008-161850030 TTGTGGCAGCAGAGACGGAGAGG - Intronic
916523315 1:165585509-165585531 TTGACTCAGCTGAGACTCAGTGG + Intergenic
916832680 1:168509165-168509187 ATGTCTCAGCTGTGAAACAGTGG + Intergenic
917087684 1:171320000-171320022 TTGTCTCTGCTCAGACATGGTGG + Intronic
917622896 1:176815922-176815944 TTGTCTCAGGTGAGTCTCAGAGG + Intronic
917739043 1:177945610-177945632 TTGTCTCAGATGGTACAGTGAGG - Intronic
919243010 1:194939037-194939059 TTGTCTTAGGTGAGACAGGAAGG - Intergenic
920796964 1:209148123-209148145 TTTTCTCAGTTGAACCAGAGTGG - Intergenic
1063434953 10:6022076-6022098 CAGTCTCAGCTGAGACACAAGGG + Intronic
1063981693 10:11457687-11457709 TTGTCTCAGCTGAGCCTGACAGG - Intronic
1064638187 10:17389653-17389675 GTGTCACAGCTGAGACTGGGGGG + Intronic
1065432816 10:25676597-25676619 ATGTCTCAGCTCAGATAGTGAGG + Intergenic
1068494962 10:57776063-57776085 TTGTCTCAGATGAGACCTTGTGG - Intergenic
1068654380 10:59559688-59559710 TTGTGTCATCTGGGACTGAGTGG - Intergenic
1069644404 10:69982042-69982064 TTCTCTCTACTGAAACAGAGGGG - Intergenic
1071840930 10:89470451-89470473 TTCTCTCTGCTTAGACAGAGGGG - Intronic
1072173993 10:92897641-92897663 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
1074078625 10:110151049-110151071 TTTTCTCAGGAGAGACACAGTGG - Intergenic
1074540353 10:114360207-114360229 ATGTCTCAGCTCAGACCGACAGG - Intronic
1074607638 10:114989483-114989505 ATGTCTCAGCTCAAGCAGAGAGG - Intergenic
1074619710 10:115106375-115106397 TTGTCTCAGATGAGACCTTGGGG + Intronic
1075975520 10:126690775-126690797 TTGTCTCAGATGAGCCTCAGAGG + Intergenic
1078008390 11:7549745-7549767 TGGTCTCTGCTGAGACAGTGTGG + Intronic
1078153553 11:8779016-8779038 TTCTCTCAGCTAAAACAAAGTGG - Intronic
1079536728 11:21523950-21523972 TTGTCTCATCTGAAACAAACAGG - Intronic
1079727685 11:23896597-23896619 ATGTCTCAGCTCATCCAGAGTGG + Intergenic
1080288206 11:30640748-30640770 GAGTCTCTCCTGAGACAGAGAGG + Intergenic
1080310205 11:30881300-30881322 TTGCAGCAGCTGAGACACAGAGG + Intronic
1082192942 11:49269192-49269214 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1083383459 11:62288393-62288415 TTGTCTCAGGTGAGACTCAGAGG + Intergenic
1084641003 11:70425741-70425763 CTGTCACAGCTGCGACCGAGCGG - Intronic
1085381212 11:76120599-76120621 TTGGCACAGCTGGCACAGAGGGG - Intronic
1086673188 11:89571882-89571904 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1087037544 11:93770249-93770271 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
1088884829 11:113998580-113998602 TGGTCTCAGCTGAGGAAGAAGGG - Intergenic
1089126093 11:116177675-116177697 TTACCTCAGCTGGGCCAGAGGGG - Intergenic
1089174249 11:116536831-116536853 TTGTCTCAGATGAGGCAGTGGGG - Intergenic
1089733344 11:120533220-120533242 ATGTCACAGCTGGGTCAGAGGGG + Intronic
1091134977 11:133180303-133180325 TTGTCCCACCAGAGACTGAGGGG - Intronic
1091231462 11:133990674-133990696 CTGTCACAGCTGAGACCGGGCGG - Intergenic
1091414322 12:268024-268046 ATGTCTCAGCCCAGAGAGAGAGG + Intergenic
1091430438 12:429089-429111 CTGTTTTAGCTGAGACAGAGAGG + Intronic
1091533252 12:1380523-1380545 TTGCCTTAGCTAAGACAGAGAGG - Intronic
1092613571 12:10196316-10196338 TTATTTGAGCTGAGAAAGAGGGG - Intergenic
1093057629 12:14570416-14570438 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1093396698 12:18691952-18691974 TTATCTCAGCTGAGAATGGGAGG - Intronic
1094302996 12:28986852-28986874 TTGTCACCGCTGAGCCACAGGGG - Intergenic
1094363964 12:29660726-29660748 ATGTCTGAGCTGAGATAGAGTGG + Intronic
1097315969 12:58171969-58171991 TTGTCTGAGCTGTGAGAGAAAGG + Intergenic
1097781027 12:63704389-63704411 TTCTAGCTGCTGAGACAGAGAGG + Intergenic
1098676162 12:73292698-73292720 ATGTATCAGAAGAGACAGAGTGG + Intergenic
1098859532 12:75692110-75692132 TTGTCAGAGGTGAGACAGACAGG + Intergenic
1099465108 12:82975035-82975057 TTGTTTCAGGGAAGACAGAGAGG + Intronic
1100883358 12:99042367-99042389 TGGTCTCAGCTGAAACAGCTGGG - Intronic
1101559129 12:105839027-105839049 GAGTGTCACCTGAGACAGAGGGG + Intergenic
1102683136 12:114704052-114704074 TTGTCTGAGAAGAAACAGAGAGG - Intergenic
1102706369 12:114884284-114884306 TTGTGTCATCTGAGAGATAGGGG - Intergenic
1103983577 12:124752430-124752452 TAGTCAAAGCTGAGTCAGAGAGG - Intergenic
1104095363 12:125552357-125552379 TTTTCTAGGCAGAGACAGAGGGG + Intronic
1105586325 13:21747730-21747752 TTTCTTCAGCTGAGAGAGAGTGG + Intergenic
1106477141 13:30108521-30108543 TTTTTGCAGCTGGGACAGAGAGG + Intergenic
1107174574 13:37385403-37385425 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1107664920 13:42678951-42678973 CTGTCTCGGCTGAGACTGAATGG - Intergenic
1107753484 13:43594494-43594516 TTGTTTAAGCTGAGGAAGAGGGG + Intronic
1108190570 13:47934281-47934303 TTGTCTCAGGTGAGTCTCAGAGG + Intergenic
1108805473 13:54150226-54150248 TTGTCTGAGCAGAGATAGAGTGG + Intergenic
1109205221 13:59475805-59475827 TTGTCTCATCTGAAAAAGTGAGG + Intergenic
1109410340 13:61957306-61957328 TTGTCTCAGCTGATAATCAGTGG - Intergenic
1109423160 13:62139458-62139480 TTGTCTCAGGAGAGACTCAGAGG - Intergenic
1109794443 13:67291449-67291471 TAGTTTCACCTGAGACAGAGGGG - Intergenic
1109895720 13:68686455-68686477 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1113239777 13:108324512-108324534 TGGTCTCAGCTGAGTATGAGCGG - Intergenic
1114584161 14:23794701-23794723 GAGTCTCACCTAAGACAGAGTGG - Intergenic
1114661322 14:24347027-24347049 TTCTCTCAGCTGAGGGAGAAAGG - Intergenic
1115861703 14:37693896-37693918 TTGTCTATGGTGAGACATAGGGG - Intronic
1116278234 14:42865455-42865477 TGGTCTCTGCTGGGAAAGAGAGG - Intergenic
1116407859 14:44587178-44587200 TTGTAACACCTGACACAGAGTGG - Intergenic
1117926871 14:60790329-60790351 TTGTCTCAGATGAGCCTCAGAGG - Intronic
1118089963 14:62463210-62463232 ATGTCCCAGGTGGGACAGAGAGG + Intergenic
1118757447 14:68855212-68855234 TTATCTCAGAAGACACAGAGAGG - Intergenic
1119033150 14:71208126-71208148 TTGCCTCACCTGCCACAGAGAGG + Intergenic
1120960155 14:90117225-90117247 ATGTCTGAAGTGAGACAGAGTGG + Intronic
1121087009 14:91154397-91154419 TTGTCTCAGGTGAGCCTCAGAGG + Intronic
1121637487 14:95463570-95463592 CTGTCCCAGCTGGGCCAGAGGGG + Intronic
1121973480 14:98380962-98380984 TGGTCTCAGCTAGGACAGCGTGG + Intergenic
1123200952 14:106663632-106663654 TTGTCTCAGGGGAGACTTAGAGG + Intergenic
1123452767 15:20382282-20382304 TTGTCTCAACTGTGACAGATTGG + Intergenic
1126363863 15:47873371-47873393 TTGTCAGTGCAGAGACAGAGGGG - Intergenic
1126702792 15:51382993-51383015 TTGTCTCATCTGAGCCACTGGGG - Intronic
1127229070 15:56969047-56969069 TTGTCTCAGGTGAGCCTCAGAGG + Intronic
1129769196 15:78192879-78192901 TGGGTTCAGCTGGGACAGAGAGG + Intronic
1134374493 16:13659164-13659186 TTGTCACAGCTGAGCCTGACAGG + Intergenic
1137398062 16:48131134-48131156 TTGTCTCTGTTGATACAGAAGGG + Intronic
1139506906 16:67403054-67403076 TTGTCTCAGCTGAGACAGAGAGG + Intronic
1141616270 16:85211471-85211493 TTGTCTAAGGTGACACAGCGCGG - Intergenic
1141669398 16:85483921-85483943 TCCTCTCAGCTGGGACAGTGGGG + Intergenic
1142372235 16:89689238-89689260 TCGTCCCAGCTGAAACAGAAGGG - Exonic
1142629702 17:1216885-1216907 TTGTCTCAGAGGGCACAGAGTGG - Intronic
1143111352 17:4554767-4554789 GTGTCTCAGCTGTGGCGGAGGGG - Intronic
1144058468 17:11561019-11561041 ATGTCATAGCTGGGACAGAGAGG + Exonic
1144666076 17:17103087-17103109 TTGTCTCCCTTGAGGCAGAGTGG + Intronic
1145769867 17:27485270-27485292 TGGTCTGAGCTGAGGCAGAGAGG + Intronic
1146508997 17:33429733-33429755 TTGCCTGAGCAAAGACAGAGAGG + Intronic
1149104133 17:52942259-52942281 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1149432669 17:56606869-56606891 CTGTTTCCTCTGAGACAGAGAGG + Intergenic
1150336417 17:64333838-64333860 TAGTCCCAGCTGAGTCAGAGGGG + Intronic
1151000321 17:70368710-70368732 ATGTCTCAGCTCAAACAGAGAGG + Intergenic
1151039827 17:70845946-70845968 TAGTCTCAGCAAAGACATAGAGG + Intergenic
1151108898 17:71652296-71652318 TGGCCTCAGCTGAGACAGCTCGG - Intergenic
1151984261 17:77531920-77531942 TTGTCAGAGCAGAGACAGTGTGG + Intergenic
1152398733 17:80051004-80051026 TTGAATCAGATGAGACAGTGGGG + Intronic
1154346396 18:13546751-13546773 TTCTCTAAGCTGAGAAAGTGGGG - Intronic
1156762419 18:40609298-40609320 TTGGTCCATCTGAGACAGAGTGG + Intergenic
1157057151 18:44243830-44243852 TTATCTCATCTCAGAGAGAGAGG + Intergenic
1157689288 18:49668016-49668038 TTGTCTCAACAGAGAAAGAGGGG - Intergenic
1158632821 18:59131279-59131301 TTATCTGAGCTGTGACAGACTGG + Intergenic
1159022227 18:63152961-63152983 TTTTCTCAGATGAGAGAGAGTGG - Intronic
1159939711 18:74397578-74397600 CTGTCTGAGCTGAGACACTGAGG - Intergenic
1159963484 18:74574190-74574212 TGATCACAGCAGAGACAGAGAGG - Intronic
1161735921 19:5992003-5992025 TAGTGTCACCTGAGACAGAGAGG + Intergenic
1164254960 19:23519640-23519662 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1164470080 19:28522816-28522838 TAGTCTCTCCTAAGACAGAGTGG + Intergenic
1164575241 19:29401968-29401990 TTGTCTCAGCTGGGACAGGAGGG - Intergenic
1164754593 19:30680134-30680156 TTGTCCCCGGTGTGACAGAGAGG - Intronic
1167059988 19:47138367-47138389 TTTTCTCAGCTGCAAAAGAGGGG + Intronic
1167070364 19:47218459-47218481 GCATCTCATCTGAGACAGAGGGG + Intergenic
926482433 2:13415958-13415980 TTGTCTCAACTGTGACAGATTGG - Intergenic
927087987 2:19689928-19689950 CTGCCTCAGCTGGGACAGACTGG - Intergenic
928024280 2:27727405-27727427 TGCTCTCAGCAGAGGCAGAGGGG + Intergenic
929423753 2:41821934-41821956 TTCTATCAGTTGTGACAGAGGGG - Intergenic
929431973 2:41894810-41894832 TTGTCCCAGCTGATACCAAGTGG - Intergenic
930297557 2:49574097-49574119 TTGACGCAGCTGACACAGTGAGG + Intergenic
930749842 2:54923803-54923825 TTGTTTCAGCTGAGGGAGGGAGG - Intronic
930840818 2:55842872-55842894 TGGTTTGAGCAGAGACAGAGAGG + Intergenic
931157866 2:59655770-59655792 ATGAGTCAGTTGAGACAGAGCGG + Intergenic
931563587 2:63589765-63589787 TTGTCTCTGCTGAAAGAGAGGGG + Intronic
932102799 2:68916119-68916141 TTCCTTCAGCTGAGACAGATTGG - Intergenic
932721932 2:74144935-74144957 TTGTCTGAGCTGAGCCAGGCTGG + Intronic
934108234 2:88716071-88716093 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
935578599 2:104736215-104736237 TTGCCTCAGCAGAGACTGTGTGG + Intergenic
937515187 2:122645488-122645510 TTGCCTCAGCAGAGACTGAATGG - Intergenic
939128327 2:138204499-138204521 TTGTCTCAGATGAGACACTGCGG - Intergenic
940142888 2:150513794-150513816 ATGCCTCAGCTGAGAAAGTGTGG + Intronic
942135148 2:172918060-172918082 TGGTCTTAGCTGATAGAGAGAGG + Intronic
942139973 2:172967984-172968006 TGGGTTCAGCTGAGACAGAAGGG - Intronic
942308638 2:174633418-174633440 TTGTGTTAACTGAGACAGGGAGG - Intronic
942742017 2:179192076-179192098 TTGTCACAGCTGGGAAAGGGAGG - Intronic
943271872 2:185815748-185815770 TTTTCTAACCTGAGAGAGAGAGG + Intronic
943727472 2:191267089-191267111 TTGTCTCTGCATAGGCAGAGAGG - Intronic
944520156 2:200557306-200557328 TAGTCTCTCCTAAGACAGAGTGG - Intronic
945292891 2:208143357-208143379 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
945414103 2:209549286-209549308 TTTTCTCATCTGTGAAAGAGAGG - Intronic
945549166 2:211197737-211197759 TTGTGTCTGGTGAGAAAGAGAGG + Intergenic
946956170 2:224932186-224932208 TTGTCTCTGTAGAGACAAAGAGG - Intronic
948605663 2:239133161-239133183 GTGTCTCTGTTTAGACAGAGAGG - Intronic
1168833934 20:864299-864321 TTGTATTAGCTGGGACTGAGGGG + Intergenic
1168881068 20:1206779-1206801 TGGTCTCCGATGAGACAGCGAGG + Intronic
1170231714 20:14054684-14054706 TTGTGTCAGATGTCACAGAGAGG + Intronic
1171373663 20:24677304-24677326 TTGTCTCCTCTGCGAAAGAGAGG + Intergenic
1174661035 20:52213422-52213444 TTGTCTCTGGTGAGCCTGAGAGG + Intergenic
1174766407 20:53257972-53257994 TTGCCTCACATCAGACAGAGGGG + Intronic
1175550078 20:59811802-59811824 TTGTCTCAGCTGCGTGAGATAGG + Intronic
1175745141 20:61451308-61451330 GCGTCTCAGCTGCGTCAGAGTGG + Intronic
1176305551 21:5121293-5121315 TTGTCTGAGCAGGGACAAAGGGG + Intronic
1178448273 21:32665403-32665425 TTGTCTCAGGTGAGTCTCAGAGG - Intronic
1178849666 21:36202457-36202479 TGGTGTCAGCTGTGACTGAGGGG + Intronic
1179170831 21:38971454-38971476 CTGACTCAGATGTGACAGAGAGG - Intergenic
1179851505 21:44140738-44140760 TTGTCTGAGCAGGGACAAAGGGG - Intronic
1179924061 21:44522722-44522744 TTGTGCCAGCAGAGACAGTGAGG - Intronic
1180363818 22:11922261-11922283 AAGTCTCATCTGAGACAAAGAGG - Intergenic
1180717898 22:17884350-17884372 TTGTGTCAGCTGGGACACACAGG + Intronic
1184259475 22:43306421-43306443 TTCTCTGCTCTGAGACAGAGCGG + Intronic
1184588983 22:45468369-45468391 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
950157720 3:10736223-10736245 TTATCTCAGCTGAGCTTGAGGGG + Intergenic
950736320 3:15011432-15011454 TTCTCTCAGCTGCCACAGAAGGG - Intronic
952064588 3:29553434-29553456 TTGTCCCAGTTTAGACAGAGGGG + Intronic
956175993 3:66473592-66473614 TTGAGGCAGCTGAGAAAGAGAGG - Intronic
956736478 3:72242470-72242492 TTGTATCAGCTGAGACTGCAGGG - Intergenic
957787556 3:84901728-84901750 TTGTCTCAGATGAGACTTTGGGG + Intergenic
958999351 3:100944098-100944120 TTCTCTCAGCTGGGAGTGAGAGG - Intronic
960035780 3:113101907-113101929 TAGTCTCAGCTGACCCAGAGGGG + Intergenic
960586300 3:119323616-119323638 CTGTCTCACCTGAGAGAGGGAGG + Intronic
960904390 3:122585188-122585210 TTGAGTCAGCTGACACAGACAGG + Intronic
961182800 3:124889182-124889204 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
961333772 3:126158117-126158139 ATCCCCCAGCTGAGACAGAGAGG - Intronic
961799411 3:129433806-129433828 TTGTCTTAGTAGAGACAGTGTGG - Intronic
962811960 3:138966793-138966815 TTGTCCCAGATGAGACAGGGAGG + Intergenic
962833283 3:139162805-139162827 TTGTCTCAGGTGAGGCACAGAGG + Intronic
963299772 3:143585273-143585295 TTGTCTCAGGTGAGGCTCAGAGG - Intronic
963301045 3:143597494-143597516 TTCAAGCAGCTGAGACAGAGCGG + Intronic
963938632 3:151079517-151079539 TTTTGTCAGCTGACCCAGAGTGG - Intergenic
964773677 3:160252662-160252684 TTGTCTCAGGTGAGCCTCAGAGG + Intronic
967235858 3:187383079-187383101 TGGCCTCAGCTGAGGCAGCGGGG - Intergenic
969238641 4:5885640-5885662 TTGTCCTAGGGGAGACAGAGGGG - Intronic
969420378 4:7090879-7090901 TAGTCTCTCCTAAGACAGAGTGG - Intergenic
970179969 4:13381499-13381521 CTGTCTTGGCTGAGACAAAGTGG + Exonic
971389458 4:26172451-26172473 TTTTCAGGGCTGAGACAGAGGGG - Intronic
973267574 4:48226416-48226438 CTGTCTCAGGGGTGACAGAGGGG - Intronic
973911696 4:55588281-55588303 TTGTCTCAGGTGAGTCTGAGAGG - Intronic
974082804 4:57230407-57230429 TTGTCTCAGATGAGCCTCAGAGG + Intergenic
974609932 4:64204433-64204455 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
974969575 4:68807485-68807507 TAGCCACAGCTGAGACAAAGGGG - Intergenic
976359407 4:84159962-84159984 TTCTCTCAGCAGACACAGGGAGG + Intergenic
976634967 4:87278368-87278390 TTTTCTTAGTTCAGACAGAGTGG - Intergenic
977142512 4:93391400-93391422 ATTTCTCAGCTGAGAAAAAGAGG - Intronic
977230323 4:94444660-94444682 TTTTCACAGCTGAGAGAAAGTGG + Intergenic
977312768 4:95407474-95407496 TTGTCTCAGCTGAGCATGATTGG - Intronic
977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG + Intronic
977894311 4:102346214-102346236 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
980048788 4:128018120-128018142 GTGTCACAGCTGAAACAGAAGGG - Intronic
980720652 4:136690551-136690573 TTGTCTCAGATGAGTCAGAGGGG + Intergenic
981039829 4:140212836-140212858 TTGTCTCAGGTGAGCCTCAGCGG - Intergenic
981465491 4:145066330-145066352 TTCTCTCTGCTGAGCCAGAAAGG + Intronic
981634465 4:146860606-146860628 ATGTCCCAGATGGGACAGAGTGG + Intronic
982070358 4:151688846-151688868 CTGTCTCAGAGGAGGCAGAGGGG - Intronic
983583717 4:169334355-169334377 TTGTCTCAGGTGAGACTCAGAGG - Intergenic
984702175 4:182825552-182825574 TTGGCTGAGGAGAGACAGAGGGG - Intergenic
986163664 5:5253482-5253504 TTGTCTCAGGTGAGCCTCAGAGG + Intronic
987362057 5:17116348-17116370 TTTTCTCTGCTGAGGTAGAGAGG - Intronic
987380628 5:17282505-17282527 ATGTCTGTGCTGAGGCAGAGTGG - Intergenic
988693352 5:33594765-33594787 TATTCTCAGCTCAGAGAGAGAGG - Intronic
990284763 5:54290145-54290167 CTGGCTCTGTTGAGACAGAGTGG - Intronic
990695253 5:58409159-58409181 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
991264916 5:64706364-64706386 TTGTCTCAGCTGAGCCTCAGAGG + Intronic
991697358 5:69285669-69285691 GTGTGTCAGCTGGCACAGAGGGG - Intronic
992894442 5:81234286-81234308 TTGACTCAGCTGACACTGTGAGG - Intronic
995932126 5:117458632-117458654 TTTTCTAAGATGAGATAGAGTGG - Intergenic
996024655 5:118631413-118631435 ATGTCTCAGGTGGGACAGAACGG + Intergenic
997743349 5:136277245-136277267 TGGTCCCAGCTAAAACAGAGGGG + Intronic
998638124 5:143979853-143979875 TTGTCTCAGTTGAGTATGAGTGG - Intergenic
999450423 5:151673525-151673547 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
1001179939 5:169510893-169510915 TTGTCACAGCTGAGGCAGAGGGG - Intergenic
1002193143 5:177489297-177489319 TTGCCTCAGCTGCGACTGGGGGG - Intronic
1003055035 6:2810350-2810372 CTGTCTCAGCAGAGACTGAAGGG - Intergenic
1003055037 6:2810355-2810377 CAGTCTCTGCTGAGACAGAAAGG + Intergenic
1003883541 6:10500068-10500090 TTGTTTCAGCTCATACACAGAGG + Intronic
1005504294 6:26456753-26456775 CTGTCACAGCAGAGACACAGTGG + Intergenic
1006798044 6:36743476-36743498 GTGTCCCAGATGTGACAGAGGGG + Intronic
1007156342 6:39748373-39748395 TTGTCTCAGGTGAGTCTCAGAGG + Intergenic
1007357445 6:41331925-41331947 TTATCTCAGCTGTCCCAGAGTGG + Intergenic
1008363977 6:50654237-50654259 TTTTCTCAGCTGGGACACAAGGG - Intergenic
1009276768 6:61692179-61692201 TTGTTTCAGATGAGTCAGAATGG - Intronic
1011077934 6:83458001-83458023 TTGACTCCACTGAGGCAGAGGGG - Intergenic
1011343678 6:86346161-86346183 TTGTCTCAGATGAGACTTTGGGG - Intergenic
1012064609 6:94534610-94534632 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1012266227 6:97146846-97146868 TTGTCTCACCTTGGACAGATGGG - Exonic
1012829621 6:104188014-104188036 TTCTCTCAGCAGAGAGACAGGGG + Intergenic
1014705375 6:124739988-124740010 CTGTTTCATCTGAGACAAAGGGG + Intronic
1014870320 6:126586927-126586949 TTGTATATGCTGAGACATAGGGG + Intergenic
1019818435 7:3218748-3218770 TTGTCGCAGCTGAAAGAGACAGG + Intergenic
1020498123 7:8882219-8882241 CTGTCCCAGCTGATACTGAGTGG + Intergenic
1021363567 7:19747536-19747558 TTTTCTCAGCTGAAATATAGAGG - Intronic
1022087663 7:27084641-27084663 GTGACTCTGCTGAGAAAGAGAGG + Intergenic
1022296062 7:29054729-29054751 ATGTCTAAGCAGAGTCAGAGAGG - Intronic
1022724402 7:32967725-32967747 TTGTTTTAGTTTAGACAGAGTGG + Intronic
1022939609 7:35220449-35220471 TTCTAGCTGCTGAGACAGAGAGG + Intronic
1024585511 7:50838554-50838576 TTGTCTGAGGTCACACAGAGAGG - Intergenic
1024981567 7:55161482-55161504 TGGCCTCTGCGGAGACAGAGTGG - Exonic
1025049204 7:55720106-55720128 TTGTTTTAGTTTAGACAGAGTGG - Intergenic
1025849249 7:65232428-65232450 TTGTCTCAGATGAGCCTCAGAGG + Intergenic
1026975278 7:74494126-74494148 TTGTCTGAGCTCAGCCAGATGGG + Intronic
1031565487 7:123291925-123291947 TTGTTTCAGAGGTGACAGAGGGG + Intergenic
1031983450 7:128146028-128146050 TTGTACTAGCTCAGACAGAGTGG + Intergenic
1032450017 7:132022566-132022588 TAGTCTCAGCTGAGAGGGATGGG - Intergenic
1032506399 7:132437880-132437902 CTGTCTCCACTGAGAAAGAGAGG + Intronic
1032935686 7:136729155-136729177 TTGTCTCTGCTGAGTCATACAGG - Intergenic
1033968780 7:147011637-147011659 TTGTCTCAGAGGAGAATGAGTGG - Intronic
1035716057 8:1755706-1755728 TTGTCTCTGCTGAGGAAGTGGGG - Intergenic
1037088633 8:14884923-14884945 AAGTCACAGCTGAGAGAGAGGGG - Intronic
1038889681 8:31705619-31705641 TTCTCTCAGCAGAGAAACAGTGG - Intronic
1039818866 8:41118766-41118788 TTGTCTGACTTGAGAGAGAGGGG - Intergenic
1040431894 8:47350959-47350981 ATGTCCCAGATGAGACAGAATGG - Intronic
1040837879 8:51751837-51751859 TTCTCTTAGCTGATAAAGAGGGG - Intronic
1041846859 8:62339227-62339249 TTGTCTGAGATGAGAGAGAAAGG + Intronic
1042045583 8:64647670-64647692 ATGTCCCAGCTGAAACAGTGAGG + Intronic
1042085173 8:65099545-65099567 TTGTCTCTGCTCAGACTGACTGG - Intergenic
1043825582 8:84924532-84924554 TTATCTCTGGTGAGAAAGAGAGG + Intergenic
1047091862 8:121583887-121583909 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1047713405 8:127574121-127574143 ATGTCTCAGTCAAGACAGAGTGG + Intergenic
1048179091 8:132179105-132179127 CTGCCTGAGCTGAGACACAGGGG + Intronic
1048892662 8:138961680-138961702 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1049031621 8:140042518-140042540 TTATCTCAGCTGAAAAAGTGGGG - Intronic
1049047878 8:140166876-140166898 TTGGCTCAGCTGGGAGGGAGTGG - Intronic
1049081366 8:140445736-140445758 TTGTCCCAGTTGAGACAGGCTGG - Intronic
1051876222 9:21796659-21796681 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1052952258 9:34222230-34222252 ATCACTCAGCTGAGTCAGAGTGG + Intronic
1053003038 9:34588202-34588224 TTGTGACAGTGGAGACAGAGAGG + Intronic
1053536416 9:38930982-38931004 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1054629718 9:67432966-67432988 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1055270391 9:74551476-74551498 ATGTCCCAGACGAGACAGAGCGG + Intronic
1055787117 9:79883350-79883372 CTGTCCCACCTAAGACAGAGGGG + Intergenic
1056022500 9:82454951-82454973 CTTTCTCAGCTCAGAGAGAGAGG + Intergenic
1056852454 9:90095937-90095959 GTGTCTCAGCAGCGACAGAGCGG - Intergenic
1057988661 9:99744460-99744482 TTGTGGCAGCAGGGACAGAGAGG - Intergenic
1058980081 9:110160886-110160908 TGTTCTAAGATGAGACAGAGTGG - Intronic
1059140679 9:111850187-111850209 GTGTCTAAGCTGAGACTCAGTGG + Intergenic
1059897693 9:118886080-118886102 TTGTGTCACCTGGGACTGAGAGG - Intergenic
1060032528 9:120227732-120227754 TTCTCTCAGCTGACACGGACAGG - Intergenic
1060485610 9:124044613-124044635 ATGTCTGTGCTGAGACAGAAAGG + Intergenic
1061026126 9:128050981-128051003 TGCTCTCAGCTGAGTCAGTGTGG - Intergenic
1061346550 9:130030903-130030925 TCATCTGAGCAGAGACAGAGAGG + Intronic
1061458175 9:130713640-130713662 TTGGCTGAGCTGAGACTAAGGGG - Intergenic
1061735815 9:132657716-132657738 TATTCTCAGCTGAGAGGGAGTGG - Intronic
1062438430 9:136557348-136557370 CTGGCTCAGCTGTGACCGAGAGG - Intergenic
1185481779 X:451662-451684 TTCACTCAGCTGAGAGAAAGGGG + Intergenic
1185715397 X:2337986-2338008 TTGTCTCAGCTGAGGCACAGCGG - Intronic
1186034302 X:5404283-5404305 TTGTCTCAGGTGAGCCTTAGAGG + Intergenic
1186400206 X:9251073-9251095 TTCCCTCAGCTAAGACGGAGAGG - Intergenic
1187588834 X:20693427-20693449 TTGTCTCTGCTGAGTCATACAGG - Intergenic
1187657123 X:21488936-21488958 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
1188133967 X:26471440-26471462 GAGTCTCTCCTGAGACAGAGAGG - Intergenic
1189011441 X:37049349-37049371 TTGTCTCAGATGAGACTTCGGGG + Intergenic
1190962542 X:55266941-55266963 TAGTCTCTCCTAAGACAGAGTGG + Intronic
1191780238 X:64856681-64856703 GTGTCTCAGCTGAGACCTAAAGG - Intergenic
1192235854 X:69295519-69295541 ATGCCTCAGCTGGGGCAGAGTGG - Intergenic
1193213805 X:78839259-78839281 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1193651121 X:84133633-84133655 TTGTCAGAGGTGAGAAAGAGAGG - Intronic
1193761315 X:85469890-85469912 TTGTATAAGTTGAGACATAGGGG + Intergenic
1193816415 X:86109583-86109605 TTGTATGAGGTGAGAGAGAGGGG - Intergenic
1194113875 X:89872606-89872628 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1197781237 X:130162584-130162606 TTGTCTCAGCAGAAACAACGGGG + Intronic
1199121582 X:144060878-144060900 TTGCCTCTGCTGAGACAGACAGG - Intergenic
1199174953 X:144776556-144776578 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1199356914 X:146873437-146873459 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1200466614 Y:3527961-3527983 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1200712539 Y:6500793-6500815 TTGTGTGAGCTGAGATAGTGGGG + Intergenic
1201471212 Y:14336774-14336796 GTGTGTCAGCTCAGAAAGAGAGG + Intergenic