ID: 1139508126

View in Genome Browser
Species Human (GRCh38)
Location 16:67409825-67409847
Sequence ATGTAAACACAGATGAGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 224}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139508122_1139508126 -4 Left 1139508122 16:67409806-67409828 CCCAGCCTGCGCACTTAGGATGT 0: 1
1: 0
2: 1
3: 9
4: 57
Right 1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG 0: 1
1: 0
2: 1
3: 26
4: 224
1139508118_1139508126 22 Left 1139508118 16:67409780-67409802 CCTTGGCCAGTCAGCACTTATCG 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG 0: 1
1: 0
2: 1
3: 26
4: 224
1139508116_1139508126 30 Left 1139508116 16:67409772-67409794 CCCTCTGACCTTGGCCAGTCAGC 0: 1
1: 0
2: 1
3: 24
4: 166
Right 1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG 0: 1
1: 0
2: 1
3: 26
4: 224
1139508120_1139508126 16 Left 1139508120 16:67409786-67409808 CCAGTCAGCACTTATCGGAGCCC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG 0: 1
1: 0
2: 1
3: 26
4: 224
1139508117_1139508126 29 Left 1139508117 16:67409773-67409795 CCTCTGACCTTGGCCAGTCAGCA 0: 1
1: 0
2: 1
3: 18
4: 237
Right 1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG 0: 1
1: 0
2: 1
3: 26
4: 224
1139508123_1139508126 -5 Left 1139508123 16:67409807-67409829 CCAGCCTGCGCACTTAGGATGTA 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG 0: 1
1: 0
2: 1
3: 26
4: 224
1139508124_1139508126 -9 Left 1139508124 16:67409811-67409833 CCTGCGCACTTAGGATGTAAACA 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG 0: 1
1: 0
2: 1
3: 26
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139508126 Original CRISPR ATGTAAACACAGATGAGACC GGG Intronic
903019539 1:20384500-20384522 ATCTATAGACAGATGAGGCCAGG + Intergenic
903419833 1:23210730-23210752 GTGGAAACTCAGATGAGAGCTGG - Intergenic
904259817 1:29281974-29281996 ATAGAAACACAGCTGGGACCAGG + Intronic
904416894 1:30368374-30368396 ATGCACACACACATGAGCCCAGG + Intergenic
904577201 1:31512634-31512656 AAGTAGACACAGATGACCCCAGG - Intergenic
904613531 1:31737886-31737908 ATGTATGCACAGAACAGACCCGG + Intronic
904673270 1:32181488-32181510 ATCCAAACACAGAAGAGATCCGG + Exonic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
906162405 1:43660069-43660091 ATGTACACACAGATGTAAACCGG - Intronic
908669419 1:66530371-66530393 ATGTCAACCCAGATCATACCAGG - Intergenic
909281765 1:73764592-73764614 TTGTAAAGACAAATGAGACCTGG + Intergenic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
909771426 1:79427076-79427098 AAATAAACACAGAAGAGACTAGG + Intergenic
910465621 1:87496200-87496222 CTGTTAACACAGAAGAGACCAGG + Intergenic
911590243 1:99739038-99739060 ATGTAAAGACAGATCATACTAGG + Intronic
912040114 1:105379181-105379203 AAGAAATCACAGATGAGGCCGGG - Intergenic
912380509 1:109245579-109245601 ATGTAATCCCACTTGAGACCAGG + Intergenic
914360433 1:146931282-146931304 CTGTTAACACAGAAGAGACCAGG + Intergenic
914493314 1:148168616-148168638 CTGTTAACACAGAAGAGACCAGG - Intergenic
915271580 1:154757534-154757556 ATCTAAACAGAGATGGGCCCTGG + Intronic
916332477 1:163633079-163633101 ATTTAAAAACAGACTAGACCAGG - Intergenic
917103979 1:171473756-171473778 ATGTAAATACAGATCACACATGG + Intergenic
918399691 1:184151370-184151392 ATGTAAACACAAATGACCCGCGG - Intergenic
922744045 1:228033964-228033986 ATAGAAACACAAATGAGGCCAGG + Intronic
922916479 1:229262107-229262129 ATGGAGACACAGATGAGAAAGGG - Intergenic
923453994 1:234146807-234146829 ATGGAAAGAAAGATGAGGCCGGG - Intronic
923785681 1:237066208-237066230 ATGTAAACAGACATGAGAAAAGG - Intronic
1062811321 10:468463-468485 ATTAAAACAAAGATGAGACCAGG + Intronic
1063099608 10:2938039-2938061 ATGTGAAAACAGAAGAAACCTGG - Intergenic
1063824204 10:9875840-9875862 ATATAAAGACAGATGAGAAAAGG + Intergenic
1064535561 10:16354242-16354264 ATGTAGACTCAGAAGAGAACAGG + Intergenic
1064584266 10:16823537-16823559 AGGTAAACACAGGTGAGACTTGG + Intergenic
1064728400 10:18304249-18304271 ATGAAAACACTGATTAGGCCGGG - Intronic
1068634935 10:59338322-59338344 ATGCAAAAAGAGATGAGCCCTGG - Intronic
1069269337 10:66505451-66505473 ATGTAATCACAGATGACTCAGGG + Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1071710905 10:88048199-88048221 ATGTAAAATCAGAGGAGACAGGG - Intergenic
1071767407 10:88683396-88683418 ATAAAAATACAGATGAGGCCAGG + Intergenic
1072126812 10:92453312-92453334 ATATAAACACAGATGATGACTGG - Exonic
1073731336 10:106291777-106291799 ATTGAGACACAGATGAGAACAGG + Intergenic
1073928187 10:108541996-108542018 ATGGAAACACATATTAAACCTGG + Intergenic
1075190514 10:120302911-120302933 AAGTAACCACAGATTAGACTAGG + Intergenic
1076301133 10:129427184-129427206 ATGTGAAAACAGCTGAGAACTGG - Intergenic
1076355257 10:129847986-129848008 AAGTAATCACAGATCAGACTGGG + Intronic
1080226312 11:29965145-29965167 ATGTAAACAGAGATGAGAGGAGG + Intergenic
1080785554 11:35472055-35472077 AAGTAAACACTGATGAAACTCGG - Intronic
1082045157 11:47719897-47719919 AAGGAAACACAGATGAGATGGGG - Intronic
1083746291 11:64738732-64738754 ATATAAAAACATATGAGACTGGG - Intronic
1084370506 11:68739307-68739329 ACATAAAGAAAGATGAGACCTGG - Intronic
1085823053 11:79813720-79813742 ATGCAAACAGAGATGATAACAGG + Intergenic
1086079042 11:82883704-82883726 GTGTAAGCAAAGATGAGACTTGG + Intronic
1086889365 11:92238583-92238605 AGGTAAACAAAGATGAAATCTGG - Intergenic
1087217772 11:95512798-95512820 GTGTAAACACTGAGGAGCCCAGG + Intergenic
1087939289 11:104075820-104075842 ATATAAAGACAGATAAGGCCTGG - Intronic
1089350687 11:117820057-117820079 TTGAAAAAACAAATGAGACCCGG + Exonic
1091520289 12:1233108-1233130 CTCTACACACAGAAGAGACCAGG + Intronic
1092795321 12:12105601-12105623 ATAAAAACACAAATGAGGCCAGG + Intronic
1093864258 12:24205927-24205949 TTGCAAACACAGATTAGAGCAGG - Intergenic
1094612666 12:32009197-32009219 ATGAAAACACACACGAGGCCGGG + Intergenic
1095470024 12:42526638-42526660 ATGTGAACACTGATGAGAAGTGG + Intronic
1096111157 12:49030165-49030187 ATGTAAACACACAGGACAGCAGG + Intronic
1097622845 12:61962731-61962753 AATTTAATACAGATGAGACCGGG - Intronic
1099060344 12:77900374-77900396 ATGGATACAAAGATGAGAACAGG - Intronic
1099089692 12:78290525-78290547 AAGAAAAGAGAGATGAGACCTGG - Intergenic
1100224764 12:92545058-92545080 ATTTAAAAACAGCTGATACCAGG - Intergenic
1100618439 12:96249587-96249609 TTGTAAACACACAGGAGGCCAGG - Intronic
1101333238 12:103774180-103774202 ATGTGAACAATGATGAGTCCAGG - Exonic
1102091365 12:110191464-110191486 TGATAAAGACAGATGAGACCGGG - Intronic
1104719278 12:131035987-131036009 AGGTAAACAAAAAGGAGACCAGG - Intronic
1106345751 13:28875919-28875941 ATTTAAACATTGATGAGACTTGG + Intronic
1107038943 13:35928759-35928781 ATGTATACACATATAAGATCAGG + Intronic
1108906651 13:55483473-55483495 ATGAAAAAACACATGAGACTGGG - Intergenic
1109152951 13:58867404-58867426 ATGAAAACCCAGATCAGGCCAGG + Intergenic
1110907084 13:80904586-80904608 CTGTAAACAAAGATGAGAAAAGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1114919960 14:27313643-27313665 ATGTAACCAGGGATGAGACTGGG - Intergenic
1115035910 14:28856376-28856398 TTGAAAAGGCAGATGAGACCTGG + Intergenic
1115541104 14:34422200-34422222 CTGTAAAGAAAGATGACACCTGG + Intronic
1117099597 14:52332991-52333013 TTGAAAACACAGAAGAGGCCGGG - Intergenic
1118203339 14:63698147-63698169 ATGTAAACACAAATGGCCCCTGG + Intronic
1122472407 14:101979127-101979149 ATGTGAACAAACATGAAACCAGG - Intronic
1124047040 15:26160065-26160087 ATGAAAACACAGATGCGAGAAGG + Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127676646 15:61245751-61245773 ATGTAAACAGAAATAAGACATGG - Intergenic
1127884342 15:63186211-63186233 AAGTAAACACAGAGAAGAGCAGG + Intergenic
1128220066 15:65962796-65962818 ATGCAGACTCAGAGGAGACCAGG + Intronic
1131167305 15:90151779-90151801 ATGTAAAGATACAGGAGACCTGG + Intergenic
1137834912 16:51582830-51582852 ATATAAAACCAGATGAGGCCGGG - Intergenic
1138015573 16:53425408-53425430 ATTTAAACACAGTTTGGACCGGG + Intergenic
1139138872 16:64237076-64237098 ATGTAAGCACAAAGGAAACCTGG + Intergenic
1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG + Intronic
1140451275 16:75072769-75072791 ATGTAAACAGAGCTGTGACATGG + Intronic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1144079694 17:11752700-11752722 ATGCAAAGGCAGATCAGACCTGG - Intronic
1144567850 17:16374985-16375007 ATTTAAACATAGATTAGATCAGG - Intergenic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1145200854 17:20943434-20943456 ATGAAAACACAGATTAGGCCGGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146770776 17:35567218-35567240 ATCTAAACACAGTTGAGGCCGGG + Intergenic
1153535041 18:6092795-6092817 ATATAAACAAAAATGAGAACTGG + Intronic
1154456075 18:14526820-14526842 ATCTAAATACAGATAGGACCAGG - Intronic
1155009408 18:21760612-21760634 ATTTAAACACACATGACAACTGG - Intronic
1155231758 18:23780995-23781017 AGGTAAACAAAGATGAGGTCTGG + Intronic
1157020772 18:43778923-43778945 ATGTAACCAGAGATGAAACTAGG + Intergenic
1157392946 18:47318050-47318072 ATGTAAAGACAGTTGTGACAAGG + Intergenic
1158055939 18:53280305-53280327 ATGTAAACAGAAATGAGACTAGG - Intronic
1159034768 18:63266225-63266247 ATGTAGACACAGAAGAGAAGAGG + Intronic
1162343180 19:10104855-10104877 AGGTACACACAGTTGACACCCGG + Intergenic
1164846395 19:31436695-31436717 CTGTATGCACAGAAGAGACCAGG - Intergenic
1165678450 19:37749516-37749538 ATGTAAATACATATGAGAAAAGG + Intronic
1166148654 19:40854547-40854569 ATCCAAACACAGATGAGCACAGG - Intronic
1166152794 19:40886332-40886354 ATCCAAACACAGATGAGCACAGG - Intronic
1166177438 19:41084626-41084648 ATCCAAACACAGATGAGCACAGG + Intergenic
1166355386 19:42224434-42224456 ATGCCAACACAGATGTCACCAGG + Exonic
1167343644 19:48931497-48931519 ATAGAAACACAAATGGGACCAGG - Intergenic
1167784319 19:51625065-51625087 CTGTAAACACAGAAGAGAAGGGG + Intronic
1168311696 19:55463968-55463990 CTGTAAAGACAGATGTGAGCAGG + Intergenic
1168393503 19:56029559-56029581 ATTTAAATACAAATGAGGCCGGG - Intronic
1202632279 1_KI270706v1_random:11929-11951 ATGTAAACACCGTCGAGACTAGG - Intergenic
927271190 2:21212665-21212687 ATGTAAAGACCATTGAGACCAGG - Intergenic
927341554 2:21989442-21989464 ATGAAAAAACAAATGAGACCAGG - Intergenic
927354589 2:22158357-22158379 ATGTAAAGACCATTGAGACCAGG + Intergenic
929622072 2:43365218-43365240 TTAAAAACACAGATGAGGCCAGG - Intronic
931349897 2:61477606-61477628 ATGAGAACACAGATGTAACCTGG - Intergenic
936627064 2:114159532-114159554 AAATAAACACAGGTGAGACCTGG - Intergenic
937638236 2:124181098-124181120 ATGTGAACACAGAAGAAACTTGG - Intronic
938553006 2:132398017-132398039 AAGCAGACACAGATGAGACATGG - Intergenic
938784713 2:134616026-134616048 TTGTAAAAAGAGATGAGACGTGG + Intronic
939279853 2:140049124-140049146 ATGCAAACACACATTAGCCCAGG - Intergenic
939535763 2:143426113-143426135 TAGTAAACACAGATTAGCCCAGG - Intronic
941468368 2:165856362-165856384 ATGAAAACCCAGGTGAGACCAGG + Intergenic
942274838 2:174313228-174313250 TTGTAAAGATAGAAGAGACCCGG - Intergenic
943505794 2:188755811-188755833 ATGGAACCACAGAAGAGTCCAGG - Intronic
943936188 2:193919547-193919569 ATGTAAGGACAGAAGAGACTAGG + Intergenic
944069123 2:195650444-195650466 TCGAAAATACAGATGAGACCAGG - Intronic
944080373 2:195781314-195781336 ATGTAGACATAGATGAGATATGG + Intronic
944208837 2:197185226-197185248 AGGTAAGCACAGATGAGGCCAGG - Intronic
946817816 2:223597296-223597318 ATGTACAGGCAGATGAAACCAGG - Exonic
1170940578 20:20845076-20845098 GTGTAAACACAGAAGGGATCTGG + Intergenic
1173830383 20:46081223-46081245 ATCTAAACACTGACTAGACCTGG + Intronic
1174334377 20:49848217-49848239 ATTTAAAAACAGATTAGACTGGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176644495 21:9337808-9337830 ATGTAAACACCGTCGAGACTAGG - Intergenic
1176818087 21:13626520-13626542 ATCTAAATACAGATAGGACCAGG + Intronic
1177102337 21:16914014-16914036 ATGTAAAAATAAATGAGGCCGGG - Intergenic
1177315983 21:19461759-19461781 ATGAAAACACACCTGAGACTGGG + Intergenic
1177462646 21:21433109-21433131 GGGTCAACACAGATGAGACCAGG - Intronic
1177852316 21:26363334-26363356 AAGTAAATACAGATGAAAACAGG + Intergenic
1177853354 21:26374942-26374964 ATATAAATACAAATAAGACCTGG + Intergenic
1178405779 21:32322085-32322107 ATGGAATCAAAGATGAGATCAGG - Intronic
1179098455 21:38336124-38336146 AGGTGGACTCAGATGAGACCAGG - Intergenic
1179301745 21:40117989-40118011 ATGCAGACACATATGAGACATGG + Intronic
1179348315 21:40582661-40582683 ATGTACATAAAGATAAGACCTGG + Intronic
1180368454 22:11961428-11961450 ATGTAAACACCGTCGAGACTAGG + Intergenic
1181727617 22:24822385-24822407 AAGAAAAGAGAGATGAGACCAGG - Intronic
1183974539 22:41503622-41503644 ATGAAAACAGAGAACAGACCAGG - Intronic
1185079533 22:48701981-48702003 ATGTACACACAGAGGGGACCTGG + Intronic
952408230 3:33024905-33024927 ATGTTGACACAGATAAGTCCGGG + Intronic
953521421 3:43646803-43646825 ATGTAAAGAAAGAAGAGGCCAGG - Intronic
958500732 3:94905197-94905219 ATATAAACACAGGTGAGACCCGG + Intergenic
961466419 3:127084642-127084664 ATGTGACCACCGATGTGACCTGG + Intergenic
962005227 3:131342933-131342955 ATGTATACAAAGAAGTGACCAGG + Intronic
962650921 3:137489880-137489902 ATGGAAACAAATATGAGACCGGG + Intergenic
965656147 3:170987434-170987456 AGGTAAACACTGATGAGGCATGG - Intergenic
965847903 3:172986300-172986322 ATGTAAATACATATGAGTACTGG + Intronic
965851313 3:173029010-173029032 ATGTAATATCAGATGAGGCCAGG + Intronic
1202742394 3_GL000221v1_random:67260-67282 ATGTAAACACCGTCGAGACTAGG + Intergenic
970544550 4:17114172-17114194 ATGTAGATACAGATGAGATGTGG - Intergenic
970886312 4:20991348-20991370 ATGAAAACACAAATGAGATGAGG + Intronic
971098986 4:23441326-23441348 AAGTAAAGAAAGATGAAACCTGG - Intergenic
971763146 4:30795275-30795297 ATTTAAACACATAAGAGAGCTGG - Intronic
972968795 4:44546836-44546858 AAGAAAACACAGATAAGACCTGG - Intergenic
975183785 4:71377690-71377712 GTGGAAACACAGATGAGAGAAGG - Intronic
976360928 4:84177292-84177314 ATGAAAACATACATGAGACTGGG + Intergenic
977299914 4:95255906-95255928 AAGTGAACACAGATTAGAGCGGG - Intronic
978068227 4:104432879-104432901 AAGTAAACCAATATGAGACCTGG + Intergenic
978856977 4:113404505-113404527 ACATAAACAGAGAAGAGACCAGG - Intergenic
979375744 4:119944529-119944551 TTAAAAACACAGATGAGACTGGG - Intergenic
980326593 4:131354304-131354326 ATGTAAAGACCGTTGAGACTAGG + Intergenic
981231405 4:142360446-142360468 AAGCAAACACAGTTGAGACCTGG + Intronic
982351621 4:154421687-154421709 GTTTAAACACAGATGAGTTCGGG - Intronic
982553218 4:156828371-156828393 AAGTAATGACAGATGAGATCCGG + Intronic
987482274 5:18473734-18473756 ATGTAAAGACCGTTGAGACTAGG + Intergenic
990820355 5:59832898-59832920 ATGGAAAAACAGATGAAAACGGG + Intronic
992984410 5:82212829-82212851 ATGTAGACACAGAAGAGAACAGG - Intronic
993424884 5:87750972-87750994 ATATAAAAATAGATGATACCTGG + Intergenic
993496096 5:88610739-88610761 GTGTAAACACAAATGAGAAAAGG - Intergenic
993623162 5:90191924-90191946 ATGTAAAAACAAGTGAGACATGG - Intergenic
994715902 5:103321201-103321223 ATGTAAACAAAAATGAGGCTGGG - Intergenic
996493888 5:124130872-124130894 CTGCAAACACACATGGGACCAGG + Intergenic
996549139 5:124711940-124711962 ATGGGAAAACAGATGAGACAGGG + Intronic
997886634 5:137636296-137636318 ATGCAAACACAAATGTGCCCTGG - Intronic
998092713 5:139380532-139380554 ATGTAAGCATAGAAGAGGCCGGG - Exonic
999376773 5:151092224-151092246 ATGTAAAGAGAGCTGAGACTGGG + Intronic
1001704615 5:173732912-173732934 ATGAAAAGACAGACGGGACCTGG - Intergenic
1002867889 6:1139302-1139324 ATGTAATGACACATGAGACATGG + Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005248409 6:23915420-23915442 ATGCAAACACTGATCAGACTGGG - Intergenic
1005399419 6:25416240-25416262 ATGGAAACATAGATGAGTCATGG - Intronic
1006311051 6:33260391-33260413 ATATAAACACTGATGAGACAAGG - Intronic
1007229215 6:40336776-40336798 TTGTGAACACAGATGTGACTTGG + Intergenic
1008176972 6:48280188-48280210 ATGCAAACCCTCATGAGACCAGG + Intergenic
1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG + Intronic
1010397941 6:75413545-75413567 ATGCACACACAGATGATAACAGG + Intronic
1012794387 6:103740987-103741009 ATGAAAACACACAAGAAACCTGG - Intergenic
1012919648 6:105208397-105208419 ATGCAAACACATATTAGCCCAGG + Intergenic
1014788058 6:125640546-125640568 ATATAATCAGAGATGAGAACAGG - Intergenic
1016649715 6:146449396-146449418 ATGAAAACATACATGAGACTGGG + Intergenic
1016946974 6:149544483-149544505 ATGTAAACTCCAATGAGAGCAGG - Intronic
1017107970 6:150906129-150906151 ATGTAAAAGCAGATGAGCGCCGG + Intronic
1018055242 6:160046752-160046774 ATTTAAATACTGATGAGACCTGG + Intronic
1020889076 7:13856247-13856269 ATGAAAACATAGAAGAGACCTGG + Intergenic
1021643343 7:22762113-22762135 ATGTAAAACCAAATGAGAGCTGG - Intergenic
1022059068 7:26772413-26772435 ATGAACACAGAGATGAGAACAGG - Intronic
1022594149 7:31695901-31695923 ATGTCAAAACACATGAGACCGGG - Intronic
1022741326 7:33124139-33124161 ATATAAACTCAGATGAGAGGTGG - Intergenic
1024159520 7:46660009-46660031 ATGTATACACATATGATACAGGG - Intergenic
1024235665 7:47395741-47395763 ATTAAAACACAGATGATATCTGG - Intronic
1025064700 7:55843324-55843346 ATGTAAACATAGAGGAAAGCTGG + Intronic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1026425882 7:70293109-70293131 ATGACAACAGAGATGAGATCAGG - Intronic
1027365448 7:77452864-77452886 ATATAAACACAAAAGAGGCCTGG + Intergenic
1027692354 7:81364030-81364052 AGGTAAACAAAGATGATCCCAGG - Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1030041227 7:105452230-105452252 ATGTAAAAAGAGATGACAACAGG - Intronic
1031550442 7:123105186-123105208 ATCTAGGCACAGATGAGAACAGG + Intergenic
1031767117 7:125794630-125794652 GTGTTAACACAGAAGAGGCCAGG + Intergenic
1032464394 7:132134760-132134782 ATGGAAATACAAATGAGACGGGG - Intronic
1036914224 8:12789267-12789289 ATGTAACCACAGAGGAGAATTGG - Intergenic
1037544628 8:19906691-19906713 CTATAAAGACACATGAGACCGGG - Intronic
1042279318 8:67038812-67038834 AAATAAACACAGAAGAGAGCAGG - Intronic
1043115113 8:76241265-76241287 TTGTAACCACAGATGAAACATGG - Intergenic
1047029351 8:120860266-120860288 ATGGAAACACAGAAGAAACCTGG - Intergenic
1047785816 8:128153077-128153099 TGGTAAACACAGATGACAGCTGG + Intergenic
1050035954 9:1436481-1436503 ATGCAATCACAGGTGACACCAGG - Intergenic
1050531467 9:6593595-6593617 AGGAAAGCATAGATGAGACCAGG - Intronic
1051942334 9:22522987-22523009 ATTTAAACCCAAATAAGACCTGG - Intergenic
1055160520 9:73120975-73120997 ATTAAACCACAAATGAGACCTGG + Intergenic
1056345211 9:85687200-85687222 ATGTATACACAGCTAAGAACAGG + Intronic
1062570885 9:137184829-137184851 ATGCAGACACAGAGGAGACACGG + Intronic
1203529272 Un_GL000213v1:122984-123006 ATCTAAATACAGATAGGACCAGG - Intergenic
1203711026 Un_KI270742v1:97184-97206 ATGTAAACACCGTCGAGACTAGG + Intergenic
1188144447 X:26592777-26592799 ATATAAACACATATGAGAGAGGG - Intergenic
1188865410 X:35307148-35307170 ATGAAGACATACATGAGACCGGG - Intergenic
1190189150 X:48261866-48261888 ATGTGAACACTGATAAGACAGGG + Intronic
1193820824 X:86162407-86162429 ATGTAAATAGAGAATAGACCAGG + Intronic
1194806546 X:98335811-98335833 CTGTAACTACAGATGAGACCAGG - Intergenic
1200037796 X:153344636-153344658 ATGGAAAGACTGATGAGCCCTGG + Intronic