ID: 1139508244

View in Genome Browser
Species Human (GRCh38)
Location 16:67410325-67410347
Sequence GAGCCTTGCAAAGATGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139508244_1139508247 -4 Left 1139508244 16:67410325-67410347 CCAGCTGCATCTTTGCAAGGCTC 0: 1
1: 0
2: 2
3: 24
4: 187
Right 1139508247 16:67410344-67410366 GCTCAGAGGTACACAGCCTTGGG 0: 1
1: 0
2: 1
3: 12
4: 169
1139508244_1139508246 -5 Left 1139508244 16:67410325-67410347 CCAGCTGCATCTTTGCAAGGCTC 0: 1
1: 0
2: 2
3: 24
4: 187
Right 1139508246 16:67410343-67410365 GGCTCAGAGGTACACAGCCTTGG 0: 1
1: 0
2: 0
3: 26
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139508244 Original CRISPR GAGCCTTGCAAAGATGCAGC TGG (reversed) Intronic
900712441 1:4122860-4122882 GAACCTTGCAAAGATGACTCTGG + Intergenic
900951061 1:5858505-5858527 GGGCCCTGCAAAGGGGCAGCGGG - Intergenic
901720010 1:11189498-11189520 GAGGTCTGCAAAGCTGCAGCAGG - Exonic
903755439 1:25657359-25657381 CAGCCTGGCCAGGATGCAGCTGG + Intronic
904283620 1:29438992-29439014 TAGTCTTGAAAAGATGCAGCGGG + Intergenic
904880221 1:33690819-33690841 GAGACTTGCAAAGATGAATCAGG + Intronic
906605154 1:47164133-47164155 AGGCCATGCAAAGATGGAGCAGG - Intergenic
910294797 1:85633675-85633697 GCCCCTTGAAAAGATGCAGCTGG - Intergenic
911237171 1:95423999-95424021 GAGCCTAGTTGAGATGCAGCTGG + Intergenic
912193346 1:107367543-107367565 CAGGCTTGCCAAGATGCAACAGG - Intronic
913059631 1:115193207-115193229 GAGACTGGCAAAGAAGTAGCAGG - Intergenic
915448196 1:155986722-155986744 GAGACATGCAAAGATGCTGATGG + Intronic
915656554 1:157365621-157365643 GAGCCTTGCACCCATGAAGCAGG + Intergenic
918296767 1:183164554-183164576 GAGCCTTGGAATGCTGCAACTGG + Intergenic
920555151 1:206899159-206899181 CAGCCTTGCTAAGGTGCAGTGGG - Intronic
920631644 1:207658823-207658845 GAGCCCTGCAAAGCAGCATCTGG + Intronic
921678005 1:217998363-217998385 GGTCATTGCAAAAATGCAGCAGG + Intergenic
922561101 1:226570093-226570115 GAGCCCTGCAAACATCCAGCAGG - Intronic
1063779793 10:9308586-9308608 GAGCCTTGCACAGACGATGCTGG - Intergenic
1064995383 10:21292035-21292057 GAGCATTACAAAGATATAGCTGG - Intergenic
1073499829 10:103926402-103926424 GACCCTTGCAAAGATGAAGAGGG + Intergenic
1076825255 10:132963949-132963971 GAGGCTTGCAAAGATGGAGGTGG - Intergenic
1076837333 10:133027725-133027747 GGGCCTTGCAGGGAGGCAGCCGG + Intergenic
1079063927 11:17273535-17273557 GACCCTTTGAAAGATGCAGCAGG - Intronic
1081324584 11:41728919-41728941 AAGCCTTGCTAAGCTGCAGTGGG + Intergenic
1083280994 11:61627287-61627309 GAGCTTTGCAAAGTTACAGCTGG - Intergenic
1085299207 11:75448735-75448757 GTGCCCTGCAAAGATGCAGGAGG - Intronic
1087418974 11:97896638-97896660 GAGCCTTGCCAAGAGGTTGCAGG - Intergenic
1089124855 11:116169686-116169708 GAGCTTTGCAGAGATGGAGAGGG - Intergenic
1090286304 11:125502518-125502540 GAGCTTTACAAAGTTTCAGCTGG + Intergenic
1091244392 11:134079477-134079499 GAGCCTTCCAGAGATGCAGTGGG - Intronic
1092791785 12:12076647-12076669 GAGCCTGGGAGGGATGCAGCGGG - Intronic
1097291358 12:57918423-57918445 TTGCCTTGCAAGGATGCAACAGG - Intergenic
1101950143 12:109168218-109168240 GTGCCTTACAAAAATGCAGATGG + Intronic
1106231194 13:27822341-27822363 AAGCTTTGCAAAGACGCACCGGG - Intergenic
1106632651 13:31492219-31492241 GAGCCTGGCCAAGATTTAGCTGG - Intergenic
1116118097 14:40682792-40682814 GACCCTTTGAAAGAAGCAGCAGG - Intergenic
1116284443 14:42954039-42954061 GATCCTTGCAAAGGTACATCTGG + Intergenic
1116405973 14:44567262-44567284 GATCCTTTGAAAGAAGCAGCAGG + Intergenic
1118690592 14:68335711-68335733 GAGCCTTGTTCAGATGCACCTGG + Intronic
1119218907 14:72891182-72891204 GAGCCCTGCATAGGTGCTGCTGG + Intronic
1120711537 14:87798134-87798156 GAGCCTTGCAGTGGTGGAGCAGG - Intergenic
1120738455 14:88081116-88081138 GAGCCATGCAAAGATGAAAGGGG - Intergenic
1121247703 14:92474348-92474370 GAGCCATGCAAGAATCCAGCAGG + Intronic
1121791412 14:96702336-96702358 GAGCCTGGCACAGTTTCAGCAGG + Intergenic
1121952460 14:98183625-98183647 GAGAACTGCCAAGATGCAGCAGG + Intergenic
1123078217 14:105679898-105679920 GGGCCTTGCAAGGCTGCACCTGG - Intergenic
1124013567 15:25858963-25858985 GTGCCTTGCAAGGGTGCTGCTGG - Intronic
1124935525 15:34166455-34166477 AAGCCTTGCAGAGCTGCAGTGGG - Intronic
1129536986 15:76321594-76321616 GGGCCTTGAAAATATGAAGCAGG - Intergenic
1133764663 16:8829554-8829576 GAGCCTTGCCAAGTTGATGCTGG - Intronic
1134200090 16:12190841-12190863 GAGCCTTTCCAAGATGACGCTGG + Intronic
1135812148 16:25597796-25597818 GAGCTATGCAAAGATTCAGGAGG - Intergenic
1139325054 16:66146062-66146084 GGGGCTTGCAAAGGTGCAGGTGG - Intergenic
1139508244 16:67410325-67410347 GAGCCTTGCAAAGATGCAGCTGG - Intronic
1139682556 16:68576444-68576466 GAGCTTTGAAAAGCTCCAGCAGG + Intergenic
1139965112 16:70741024-70741046 GAGCCTAGCAAAGGTGAAGTCGG - Intronic
1140210218 16:72963587-72963609 GACATTTGCAAAGATGCAGTGGG - Intronic
1142104710 16:88296078-88296100 GGGCCCTGCAAAGGCGCAGCCGG - Intergenic
1142232026 16:88904535-88904557 GGTACTTGCAAAGAGGCAGCAGG + Intronic
1142335688 16:89488978-89489000 GAGGCTTGGGAAGATGAAGCTGG - Intronic
1142814574 17:2415139-2415161 GAGCATTTCAAAGGTGCAGCAGG - Intronic
1143900404 17:10170199-10170221 GATCCTTGTAAACATCCAGCTGG + Intronic
1144013640 17:11173316-11173338 AAGCCTTACACAGATGCACCAGG + Intergenic
1144467706 17:15509479-15509501 GAAACTCGCAAAGGTGCAGCTGG - Intronic
1145957657 17:28865641-28865663 GTGCCTTGCAGAGAGGCAGAGGG - Intergenic
1146486432 17:33246564-33246586 GAGCCTTGCAAGGGCGCGGCGGG + Intronic
1146937079 17:36818648-36818670 TAGCCTTGCAAGGATGTAGGAGG - Intergenic
1147889247 17:43705447-43705469 CAGCCTGGGAGAGATGCAGCAGG + Intergenic
1149573704 17:57696240-57696262 GAGCCTGGCATGGATCCAGCTGG + Intergenic
1149867882 17:60160876-60160898 GAGCCTTCCAGAGAAACAGCAGG + Intronic
1150521151 17:65867174-65867196 GCTCCCTGCAAAGTTGCAGCTGG - Intronic
1150631893 17:66885624-66885646 GCTCCTTACACAGATGCAGCTGG + Intergenic
1153463935 18:5368042-5368064 CAGCCCTGCAAAGTTGGAGCTGG + Intergenic
1156368450 18:36450927-36450949 GAACCCTGGAAAGCTGCAGCTGG + Intronic
1160039431 18:75332651-75332673 GAGACATGCAAAAAGGCAGCAGG + Intergenic
1160295517 18:77633421-77633443 AGGCCTTGGACAGATGCAGCAGG + Intergenic
1160388916 18:78515543-78515565 GAGCCAGGCCAAGATGCGGCTGG + Intergenic
1161565247 19:4998206-4998228 GTGCCTGGCAAAGATGTAGGTGG + Intronic
1164551208 19:29213601-29213623 GAGCTTTGCACAGATGCCTCTGG - Intergenic
1165812034 19:38617622-38617644 GAGCCTTGCAAAGGGGAAGTTGG + Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1168186149 19:54700876-54700898 GAAGCTTCCCAAGATGCAGCCGG + Intronic
924977823 2:193977-193999 GAGCTGGGCAAAGATGGAGCCGG + Intergenic
925473034 2:4183276-4183298 GAGCCTTGAGAAGGTGCAGGGGG + Intergenic
925750661 2:7088520-7088542 GAGCCTAGCAAGGATGCTACGGG + Intergenic
926741648 2:16116204-16116226 GAGCCATTCACAGAAGCAGCTGG + Intergenic
927364486 2:22278066-22278088 CAGCCTTGCAAATATGCAAAAGG - Intergenic
927953041 2:27186916-27186938 GAGACTGGCAAAGGTGCAACTGG - Intergenic
928815872 2:35293562-35293584 GACCCTTTGAAAGACGCAGCAGG - Intergenic
932539991 2:72641580-72641602 AAGCCTTGCAGAGCTGCAGTGGG - Intronic
932925504 2:75969001-75969023 GATCCTTTGAAAGAAGCAGCAGG + Intergenic
934497837 2:94824922-94824944 CAGTGTTGCAAAGATGCTGCAGG + Intergenic
934856368 2:97732760-97732782 GAGCCTTGCAGAGAAGCTGCAGG - Intronic
934989670 2:98912479-98912501 AGGCCTTGCAAAGCCGCAGCTGG - Intronic
935524557 2:104149847-104149869 GAGTCATTCAAGGATGCAGCAGG + Intergenic
937433156 2:121857647-121857669 GAAGCTTGCAAAGAAGCATCTGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939591370 2:144067597-144067619 GAGCCAGGCAGAGAAGCAGCTGG + Intronic
939675318 2:145065239-145065261 GAGCCTTGCAAATATGAAATAGG - Intergenic
939802010 2:146721554-146721576 GCTCCATGCAAAGTTGCAGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
945236962 2:207639973-207639995 GAGCCTGGCACACATGCAGTGGG + Intergenic
946890590 2:224272051-224272073 CAGCCTGGAAAACATGCAGCAGG + Intergenic
947602216 2:231460543-231460565 GAGCCTGTCAAAGAAGCACCTGG - Exonic
949049904 2:241892019-241892041 AAGCCTTTCAAAGATTTAGCAGG + Intergenic
1170884595 20:20329239-20329261 GACCCTAGCACAGATGGAGCTGG - Intronic
1170979300 20:21196046-21196068 CAGCCTTGCAAGGATGGAGTTGG - Intronic
1172692906 20:36802927-36802949 GAGCCAGGAAAAGCTGCAGCTGG - Exonic
1172884593 20:38222640-38222662 GAGCCTTGGAAGGTTGCAGAGGG - Intronic
1179292443 21:40030478-40030500 GAGCCCTGCAAAGATCCTTCTGG + Intronic
1180011709 21:45055459-45055481 GAGCCTCTCAAAGATCCAGGAGG + Intergenic
1181037681 22:20177857-20177879 GAACCTTGCCCAGCTGCAGCTGG + Intergenic
1181316038 22:21971399-21971421 GAGCCCTGCAGAGAAGCAGGTGG - Intronic
1183055962 22:35305784-35305806 GAGCCTTGCAAAGATGGAACTGG + Intronic
1183665938 22:39245666-39245688 TAGCCCTGCGAAGATGCTGCAGG - Intergenic
1184349221 22:43932609-43932631 GTGCCTGGCAAAGAGGCAGATGG - Intronic
949623873 3:5846834-5846856 GAGCCTTCCAGAGATGAAGCTGG + Intergenic
949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG + Intronic
953649935 3:44793182-44793204 GAGGCTTGAAAAGGTTCAGCTGG + Intronic
953829699 3:46285465-46285487 CAGCCTTGCACAGCTGTAGCCGG + Intergenic
954658616 3:52213758-52213780 GAGCCTTGCAGACATGATGCTGG - Intronic
955499847 3:59572929-59572951 GAGCCTTGCAAAGGTGCAGGGGG - Intergenic
957051168 3:75413478-75413500 GAGCCTGGAATAGATACAGCCGG - Intergenic
957730429 3:84126303-84126325 GCTCCATGCAAAGCTGCAGCTGG - Intergenic
957794357 3:84984293-84984315 GGGAATTGCAAAGATGCAGAAGG - Intronic
958531094 3:95330746-95330768 GACCCTTTGAAAGAAGCAGCAGG - Intergenic
958688870 3:97434917-97434939 GAGCCTTAGAAAGATGGAGATGG - Intronic
960997330 3:123348775-123348797 GAGCCTGGCAGGGAGGCAGCTGG - Intronic
961505607 3:127368927-127368949 GGGCCATGCAGAGAAGCAGCGGG + Intergenic
961634980 3:128327703-128327725 GAGCACTGCACAGATGCAGGAGG + Intronic
966223396 3:177572459-177572481 GAGCATAGCAAAGAAGCAACTGG - Intergenic
966929516 3:184666795-184666817 GAGCCTTGCCAGGATGTAGACGG - Intronic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
970531930 4:16993770-16993792 AAGCCTTGCACAGAAGCTGCTGG + Intergenic
973061725 4:45734776-45734798 GATCCCTGCAAAGATGCTCCAGG - Intergenic
976131686 4:81891505-81891527 GAGCTCTTCCAAGATGCAGCAGG + Intronic
976967555 4:91063236-91063258 AAACCTTGCAAAGTTGCAACTGG - Intronic
979434498 4:120672945-120672967 GATCCTTTGAAAGAAGCAGCAGG + Intergenic
980480876 4:133385494-133385516 GCTCCTTGCAAGGCTGCAGCTGG - Intergenic
982501617 4:156164188-156164210 GAGCCTTGCACACATTCATCTGG - Intergenic
985599834 5:821655-821677 GAGCCTTTAAAAGAAGCCGCAGG + Intronic
985995097 5:3593360-3593382 GAGCCCTGCAAAGGTGCAGAAGG - Intergenic
986867207 5:12003787-12003809 GAGCCTGGCAAACCTTCAGCAGG - Intergenic
986953581 5:13122203-13122225 GATCCTTGCCAAGATGTAACTGG - Intergenic
987555113 5:19436296-19436318 GACCCTTTGAAAGAAGCAGCAGG - Intergenic
989576360 5:42992025-42992047 TCGCCATTCAAAGATGCAGCCGG - Intergenic
993129671 5:83879668-83879690 GAGACTTTCAAAGATGCATCTGG + Intergenic
996695518 5:126390641-126390663 CAGCCTTTCATAAATGCAGCTGG + Intronic
997146470 5:131439592-131439614 GAGCCTTGAGGAGATGCAGGAGG + Exonic
998736383 5:145145939-145145961 CAGCCTTCCAAAGATCCATCTGG + Intergenic
998835526 5:146199758-146199780 GAGCATTGCCAAGATGGAGAAGG - Intergenic
1000237433 5:159375797-159375819 GAGCCTTTGAAAGAAGCAGCAGG + Intergenic
1003016279 6:2469965-2469987 GAGCCGGGCGAAGATGCAGGAGG + Intergenic
1003299405 6:4863564-4863586 GATCCTTGCTTTGATGCAGCTGG + Intronic
1003318900 6:5035503-5035525 GAGCCTTGCCTTGAAGCAGCTGG - Intergenic
1003632609 6:7801742-7801764 AAACCTTGCAAAGAGGCAGAAGG - Intronic
1004737741 6:18424786-18424808 GAGCCTTGCATAGAGGCACCTGG + Intronic
1005692057 6:28316114-28316136 GAGCCTTGAAAATTTGTAGCAGG + Intergenic
1005809507 6:29505436-29505458 GAACCTTGGAAAGATCCAACTGG - Intergenic
1006259245 6:32854217-32854239 GTGCCTTGCAGGGATGCTGCGGG + Exonic
1006315791 6:33290773-33290795 GACCCTTGCTCAGCTGCAGCAGG + Exonic
1011187708 6:84697245-84697267 ATGCCTTTCAAATATGCAGCAGG + Intronic
1013495483 6:110693226-110693248 GACCCTTTGAAAGAAGCAGCTGG + Intronic
1013743564 6:113318198-113318220 GAGCCTTGCGAAGAGGCACCTGG + Intergenic
1015706330 6:136091836-136091858 GAGCCATGGAAAGATACAGATGG + Intronic
1015720550 6:136236709-136236731 GATCCTTGCAACGATGCAGAAGG - Intronic
1016498520 6:144690905-144690927 GACCCTTTGAAAGAAGCAGCAGG - Intronic
1019108693 6:169691979-169692001 GATCCTTTTAAAGAAGCAGCAGG + Intronic
1019865882 7:3709540-3709562 GACCCTTTGAAAGAAGCAGCAGG - Intronic
1019917634 7:4143893-4143915 AAGCGTTGCAGGGATGCAGCAGG + Intronic
1020647740 7:10835700-10835722 GAGCGTTCCGAACATGCAGCTGG - Intergenic
1020997208 7:15279671-15279693 GACCCTTTGAAAGAAGCAGCAGG + Intronic
1025636539 7:63324882-63324904 GAGCCTCTCAGAGAAGCAGCTGG + Intergenic
1025646157 7:63423220-63423242 GAGCCTCTCAGAGAAGCAGCTGG - Intergenic
1032597334 7:133254657-133254679 GAGTTTTGCAAAGATGAAGCAGG + Intronic
1032740534 7:134734064-134734086 GAGCCTTACAGAGGTGAAGCTGG + Intergenic
1034013493 7:147556555-147556577 GAGAGTTGCAGTGATGCAGCAGG + Intronic
1036408706 8:8478822-8478844 GACCCTGGGAAAGATGCAGCTGG + Intergenic
1038666176 8:29540039-29540061 GAGCCTTGGGAAAATGCAGAGGG + Intergenic
1039111931 8:34050602-34050624 GAACCTTTGAAAGAAGCAGCAGG + Intergenic
1040363032 8:46685217-46685239 GACCCTTTGAAAGAAGCAGCAGG - Intergenic
1041574765 8:59381305-59381327 CAGCCTTGCTAAGTTGCAGTGGG - Intergenic
1045026142 8:98088803-98088825 GAGCCATGAAAAGATGCACAAGG + Intronic
1048954802 8:139526881-139526903 GGGAATTGCAGAGATGCAGCTGG - Intergenic
1049996693 9:1041946-1041968 GAGACTTGCAAATATGAAGGAGG + Intergenic
1050513566 9:6419008-6419030 GACATTTGGAAAGATGCAGCCGG - Intronic
1052284838 9:26773213-26773235 GAGCCATGCAAAACTGCAGCTGG + Intergenic
1053311404 9:37023143-37023165 GAGCCTGGAAAGGAAGCAGCAGG + Intronic
1057340771 9:94199101-94199123 GACCCTTTGAAAGAAGCAGCAGG - Intergenic
1057409774 9:94807901-94807923 GAATATTGCCAAGATGCAGCTGG + Intronic
1058007804 9:99938219-99938241 GAGCCCTGGAAATATGCAGAGGG - Intronic
1058460919 9:105181899-105181921 GTGGCGTGCAAAGATGTAGCTGG + Intergenic
1059389439 9:113989562-113989584 GAGCCTTGGAAACATGGAGTAGG - Intronic
1060618906 9:125044902-125044924 GCGCCATGCAAGGTTGCAGCTGG - Intronic
1060722373 9:125987570-125987592 GAGCCCTGCAAAGCTGCCCCAGG - Intergenic
1061501273 9:131004052-131004074 GAGCCTGCTAAGGATGCAGCAGG - Intergenic
1061864719 9:133486214-133486236 GGGCCTTGCAAAGATTCAGACGG - Intergenic
1062028225 9:134350318-134350340 GGGCCTTCCAAGGCTGCAGCTGG - Intronic
1062135103 9:134922644-134922666 GAGCCTTGGAAGGATACAGAGGG + Intergenic
1186306101 X:8259820-8259842 TAGCCAAGAAAAGATGCAGCTGG + Intergenic
1191210017 X:57875201-57875223 GACCCTTTGAAAGAAGCAGCAGG + Intergenic
1192905716 X:75547959-75547981 GATCCTTTGAAAGAAGCAGCGGG - Intergenic
1193281501 X:79656085-79656107 CAGCCTTGCAGAGCTGCAGTGGG + Intergenic
1193477259 X:81981966-81981988 AAGCCTTGCTGAGATGCAGTGGG - Intergenic
1195504669 X:105643568-105643590 GATTCTTGCAAAGAAGCAGAGGG - Intronic
1198273298 X:135076090-135076112 GAGCCTACCAAAGAAGCACCTGG - Intergenic
1199241490 X:145553250-145553272 GATCCTTTCAAAGATGCAGGAGG + Intergenic
1200179027 X:154139213-154139235 GAGCCATGCAGAGATCCAGGAGG - Intergenic
1201857837 Y:18564916-18564938 GACCCATGCCAAGATGCAGAGGG - Intronic
1201875484 Y:18755465-18755487 GACCCATGCCAAGATGCAGAGGG + Intronic