ID: 1139508769

View in Genome Browser
Species Human (GRCh38)
Location 16:67414371-67414393
Sequence GGTCTCTGCTTTTGTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139508769_1139508777 19 Left 1139508769 16:67414371-67414393 CCAGTTCCACAAAAGCAGAGACC 0: 1
1: 0
2: 2
3: 14
4: 192
Right 1139508777 16:67414413-67414435 ACCCAGCTCTCTTTCAGTAAAGG 0: 1
1: 0
2: 0
3: 19
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139508769 Original CRISPR GGTCTCTGCTTTTGTGGAAC TGG (reversed) Intronic
900331676 1:2137898-2137920 GGCCTCTGTGTTTGTGAAACTGG - Intronic
900840575 1:5045816-5045838 CTTCTCTGCTTTTCTGGGACAGG + Intergenic
901905574 1:12406646-12406668 GGTCTCTGCATTTGTGAAATGGG - Intronic
902669260 1:17961270-17961292 GGTGGCTGCTTCTGTAGAACCGG + Intergenic
902732455 1:18378189-18378211 AGGCTCTGCTGTTCTGGAACGGG + Intronic
902926293 1:19698000-19698022 GCTCTCTGCTTTTCTAGAAAAGG - Intronic
903385846 1:22925830-22925852 GGACTCTGGCCTTGTGGAACAGG - Intergenic
903744803 1:25579640-25579662 GGTAGCTGCTTCTGTGGCACTGG - Intergenic
904081069 1:27872832-27872854 GGCTTTTGCTTTCGTGGAACGGG + Intronic
904774254 1:32896966-32896988 GGTTTCCTCTTTTGTGAAACAGG + Intronic
908413819 1:63892905-63892927 GGCCTGTGCTTTTGGGAAACAGG - Intronic
914416790 1:147491364-147491386 GGACCATGCTTCTGTGGAACTGG + Intergenic
915227818 1:154423827-154423849 CAGCTCTGCTTTTGTGGAAGAGG + Intronic
916496361 1:165352019-165352041 GGTCTCTGTTTTTGTGCATTAGG - Intronic
916571328 1:166030371-166030393 AGTTTCTTCTTTTGTGGAAATGG + Intergenic
917626270 1:176849479-176849501 GGACTGTGCTATTGTGTAACTGG - Intergenic
918433828 1:184490257-184490279 GGTCCCTGCCTTTAAGGAACTGG + Intronic
918457630 1:184740013-184740035 GGTGGTTGCTTTTGTGAAACTGG + Intronic
919698070 1:200599757-200599779 TGTCTATGCTTTTCAGGAACAGG - Intronic
921583101 1:216917627-216917649 GGACTCTGCTCTTGTGGGAAAGG - Intronic
1062982671 10:1737920-1737942 GGTCTCTGCATTTCTGAAAGAGG - Intergenic
1066199145 10:33128735-33128757 GGTCACTGCTCTTGTAGAAAGGG - Intergenic
1067231980 10:44418393-44418415 GGTGTCTGCTTCTGGGGAAGAGG - Intergenic
1067551954 10:47242555-47242577 GGTTTCTGCATTTCTGGAAAGGG - Intergenic
1068298709 10:55110671-55110693 TGTCTTTGCTTTTAAGGAACAGG - Intronic
1069960929 10:72078901-72078923 GGTCTCTGCTCTCAAGGAACTGG - Intronic
1070500466 10:77067736-77067758 GGCCTCTGCTTTTGCAGAGCTGG + Intronic
1070540177 10:77410074-77410096 GGGCTCTGGCTTTGTGGCACAGG - Intronic
1071826684 10:89332492-89332514 GGTCTGTGCTTTTATGAAAGGGG - Intronic
1072800985 10:98392299-98392321 AGTCTCTGCATTTGGGAAACAGG - Intronic
1074232964 10:111555888-111555910 GGTGTCTGATTTGGTGGTACAGG - Intergenic
1074314329 10:112347825-112347847 GGTCTCTTCTTCTGTGAAATGGG - Intergenic
1074455299 10:113590718-113590740 GGTCTGTGCTGCTGTGAAACTGG + Exonic
1077551322 11:3201645-3201667 GGTCTCTTCTTCTGTGGAGAGGG - Intergenic
1078307594 11:10205718-10205740 GGTATCTGCCTTTGGGGAAAGGG - Intronic
1078655488 11:13234950-13234972 GTGCTTAGCTTTTGTGGAACTGG + Intergenic
1081765706 11:45608590-45608612 AGAATCTGGTTTTGTGGAACTGG - Intergenic
1083508070 11:63179515-63179537 GGTTTCTGTTTTTCAGGAACTGG + Intronic
1084228862 11:67735760-67735782 GTTTGCTGATTTTGTGGAACAGG - Intergenic
1087719363 11:101644603-101644625 GGTCTCTGCTATTGTGAATAGGG - Intronic
1090432432 11:126657355-126657377 GGGCTCTACTTTTTTGGAACTGG - Intronic
1091197822 11:133746983-133747005 GTTCTCTGCCATTTTGGAACGGG - Intergenic
1091746715 12:2997474-2997496 GGGCTCTGCTTTGGTGGAGGAGG + Intronic
1092295448 12:7193894-7193916 TGTCTCTGCCTCTGTGAAACAGG - Intronic
1092626954 12:10337664-10337686 CTTCTCTGCTTTTCTGGGACAGG - Intergenic
1093863800 12:24200266-24200288 AGTCACTGCTTTTGTGGACAAGG - Intergenic
1097102135 12:56597220-56597242 GGTCTCTGCTGCTGGGGAAGGGG + Exonic
1097223308 12:57462622-57462644 GGTCTCTGTTTTGGGGGAACAGG - Intronic
1099413008 12:82355200-82355222 GGTCTCTGGATTTGTGGACTAGG - Intronic
1099804320 12:87498694-87498716 GGTCTCTGCTGTTGGCAAACTGG + Intergenic
1099810457 12:87575834-87575856 CCTCTCTGCTTTAGTGGAACAGG + Intergenic
1102817244 12:115876832-115876854 GGTCTCTGCCTTTCTGGAACTGG + Intergenic
1103270111 12:119666494-119666516 AGTCTCTTCTTTTGTGAAATGGG - Intergenic
1103553494 12:121751984-121752006 GGTCTTTCCTTTAGTGGAATGGG + Intronic
1106565565 13:30881658-30881680 GGTTTCTTCTTTTTTGGAGCAGG - Intergenic
1107049259 13:36030026-36030048 GGCCTCTGCGTTTGTAGATCTGG - Intronic
1107847371 13:44530384-44530406 GGTCTCAGTTTTTGTGAAAGGGG - Intronic
1113054273 13:106251339-106251361 GTTTCCTGGTTTTGTGGAACAGG + Intergenic
1113222576 13:108121661-108121683 GGTCTCTGTTTTGGTAAAACAGG + Intergenic
1115652062 14:35409806-35409828 GTTCTCTGCTCCTGTGTAACAGG + Intergenic
1117155362 14:52934098-52934120 GGTCTCTGCTTTTGAGACACAGG - Intronic
1120176431 14:81298270-81298292 GTGCTTTGTTTTTGTGGAACAGG - Intronic
1122847457 14:104507726-104507748 GGTCTCTGCTTTTGTGTCCTGGG - Intronic
1124394540 15:29290041-29290063 CTTCACTGCTTTTGTGGATCTGG + Intronic
1125564300 15:40664172-40664194 GGTCTCTGCTTTTTTGGGTTTGG + Exonic
1126190909 15:45877636-45877658 GGTCTCTGTTGGTGTGTAACAGG - Intergenic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1130691617 15:86086250-86086272 TGTATCTGCAGTTGTGGAACAGG + Intergenic
1131069684 15:89458208-89458230 GGTCTCTGCCCTTGTGGAACTGG + Intergenic
1131122472 15:89831006-89831028 GGGCTCAGCGTTTGGGGAACCGG + Exonic
1134175263 16:12000867-12000889 GCTCTCTGCTCTTCTGTAACTGG + Intronic
1135021957 16:18970309-18970331 GGTGTCTGTTTTTTTGAAACAGG + Intergenic
1137941580 16:52693440-52693462 GGTATATGATTTTGTAGAACTGG - Intergenic
1139315216 16:66061860-66061882 GGTCCCTGCTCTTGTGAAGCTGG - Intergenic
1139508769 16:67414371-67414393 GGTCTCTGCTTTTGTGGAACTGG - Intronic
1140642348 16:76990930-76990952 GGTCTCTACATTTCGGGAACGGG - Intergenic
1142430448 16:90023390-90023412 GGGCTCTCCCTTTGTGGTACAGG + Intronic
1144718888 17:17454110-17454132 GGTCTCTGCCCTTATGGAGCTGG - Intergenic
1144755943 17:17680978-17681000 GGTCCCTGCTGTCGTGGAGCTGG - Intergenic
1144837895 17:18167017-18167039 AGTGTGTGTTTTTGTGGAACTGG + Intronic
1146691132 17:34876911-34876933 GGTGTCTGTTTTTTTGGAAAAGG + Intergenic
1146810041 17:35895915-35895937 GGTCTCTGCTTCTCTAGAAAAGG + Intergenic
1148574755 17:48702161-48702183 GGTCTCTACTCTAGTGGAAAGGG + Intergenic
1148957167 17:51363396-51363418 GGTCACTGCTTCTGTGGACTTGG + Intergenic
1149655246 17:58306413-58306435 TCTCTCTGCTTTTCTGGATCAGG - Exonic
1149680679 17:58504971-58504993 GATGTCTGCTTTTGTGTAGCTGG - Exonic
1149857479 17:60095582-60095604 CAACTCTGCTTTTGTGCAACTGG - Intergenic
1151260852 17:72914963-72914985 TGTTTCTGCTTTAGTGGCACAGG + Intronic
1152081173 17:78188058-78188080 GGTCTGTGCTTATGTGGCACAGG + Intronic
1153011739 18:545913-545935 GGTATGTGCTTTTGAGGAAACGG - Intergenic
1156745723 18:40388978-40389000 GCTCTCTGCTTTTGAGGTGCTGG - Intergenic
1159187160 18:64989877-64989899 TGTCTCTGCCTTTGTGGAGGAGG - Intergenic
1162491565 19:10995582-10995604 GGTCTCTGCGTTTGTGCATCAGG - Intronic
1165232107 19:34393706-34393728 TGACTCTGCTTTTGTGTCACAGG + Exonic
1165941750 19:39417943-39417965 GCTCAGTGCTTTTGGGGAACTGG + Exonic
1166712001 19:44943839-44943861 TGTTTCTCCTTTTGTAGAACGGG - Intronic
1167749010 19:51368697-51368719 GGTCCCTGCTTCTGGGGACCTGG + Exonic
1168208616 19:54871807-54871829 GTTTCCTCCTTTTGTGGAACAGG - Intergenic
925024032 2:593936-593958 GGACTCTGGATTTGTGGTACTGG + Intergenic
925836761 2:7953736-7953758 AGTGTCTGCTCTTGTGGAATCGG - Intergenic
926671875 2:15584169-15584191 ACTCCCAGCTTTTGTGGAACAGG - Intergenic
926696870 2:15776379-15776401 GGTCCCTGCTTGAGTAGAACTGG - Intergenic
927549718 2:23987320-23987342 TGTCTCTTCTTCTGTGGAAGAGG + Intronic
927607621 2:24501851-24501873 GATCTCTGTTTTTGTGGACTGGG + Intronic
928185342 2:29104994-29105016 GGACTCTGCTTTTGTCCAATGGG + Intronic
928431900 2:31227048-31227070 AGTGTCTGCTTTTGTAGCACAGG - Intronic
929956144 2:46460188-46460210 GGTTTCTGCTTCTGTAAAACGGG - Intronic
930432635 2:51299727-51299749 GATTTCAGCTTCTGTGGAACTGG - Intergenic
934513655 2:94969684-94969706 GGTCCCTGCTTTTCTGGTGCAGG - Intergenic
935697963 2:105786424-105786446 GGTCTCTGCCTTTGGAGACCTGG + Intronic
937920158 2:127123127-127123149 GGTTTCACCTTTTGTGAAACAGG + Intergenic
942698818 2:178679640-178679662 GGTTTCTTCTCTTCTGGAACAGG + Exonic
943760593 2:191604113-191604135 CCTCTCTGCTTCTGTGTAACAGG + Intergenic
944677948 2:202049744-202049766 GGTCTCTGCATTTCTGGGCCAGG - Intergenic
948452627 2:238086389-238086411 GGTCTGTGCTTCACTGGAACTGG + Intronic
948974864 2:241457880-241457902 GTTCTCTGCTGTTGTGGCACGGG + Intronic
1170239377 20:14146444-14146466 GGTTGCTGCTTGTGTGGATCAGG + Intronic
1170716951 20:18840104-18840126 GGAGTCTGCCTTTGTGAAACAGG - Intergenic
1171272422 20:23827142-23827164 GGTCTCTGAATCTCTGGAACAGG + Intergenic
1171383036 20:24747601-24747623 GGTCTGTGCTTTAGTGCAGCAGG + Intergenic
1172791806 20:37511001-37511023 GGCCTGTGCTTTTCTGGATCAGG - Intronic
1173216033 20:41084910-41084932 GGTTTCTTCTGTTGTTGAACAGG - Intronic
1175328916 20:58149203-58149225 GGTCTCTGCTTCCCTGGAGCTGG - Intergenic
1176998298 21:15581194-15581216 GGTCTCTGCTTTTGGAAAACTGG - Intergenic
1178111093 21:29371003-29371025 AATCCCTGCTCTTGTGGAACTGG - Intronic
1178310961 21:31529677-31529699 GCTCTCTGCATTTGAGGAGCAGG - Intronic
1180992184 22:19943192-19943214 GGTCTCTGCTCTTCTTGCACAGG - Intronic
1182562287 22:31170015-31170037 TGTGTCTGCTTCTGTGGAAATGG + Intronic
1183281869 22:36936532-36936554 TGTCTCTGCTCTTGCAGAACGGG + Exonic
1183802897 22:40183008-40183030 GGTCTCTGCTTTCAGGAAACCGG - Intronic
1184232758 22:43167524-43167546 GGTCTCTGCTCTTATGCATCAGG - Exonic
1184362352 22:44025913-44025935 GGTGCTTGCTTTCGTGGAACGGG + Intronic
1184429612 22:44434194-44434216 GGTCTCTGCTTCTGTGAATGTGG + Intergenic
949336098 3:2977622-2977644 GGGTTCTGCTTTTGTGGGCCTGG - Intronic
949923295 3:9021278-9021300 GGTCTCTCCTTATGTGGAGGGGG - Intronic
951892719 3:27582137-27582159 AGTCTTTGCTTTTGTGGCCCAGG + Intergenic
955798513 3:62662391-62662413 TGTCTGTGCTTTTGTGCAGCTGG - Exonic
958089183 3:88854261-88854283 GGTGTCTGCTTTTGGGGCAGAGG + Intergenic
958465288 3:94449631-94449653 GGTGTCTGCCTTTCTGGATCTGG + Intergenic
960641317 3:119826421-119826443 GTTTTCTTCTTTTGTGGAAGGGG + Intronic
961107066 3:124251099-124251121 GGTCTCTTCCTTTGGTGAACAGG + Intronic
962961028 3:140311051-140311073 TCTCTCTGCTGTTGTGGCACTGG - Intronic
962967770 3:140370370-140370392 GGTCTCTGGTCTGGTGGTACAGG - Intronic
965779875 3:172273931-172273953 AGTCTCTGTTCTTTTGGAACCGG + Intronic
968240816 3:197083522-197083544 TGTCTCTGCTTTTGTGGGGAAGG - Intronic
968989729 4:3901732-3901754 GTTTGCTGATTTTGTGGAACAGG - Intergenic
974744738 4:66057336-66057358 GGGCTCAGCTTTTATGGTACTGG - Intergenic
975886476 4:78972041-78972063 GGTCTCTTCTTTTATAGAACGGG + Intergenic
979663574 4:123286080-123286102 GTTCTATGCTCTTGGGGAACAGG - Intronic
981539477 4:145833527-145833549 CTTCTCTGCTTTTCTGGAAGAGG + Intronic
982623206 4:157731961-157731983 GGTCTCTGCTGTTGGCAAACTGG + Intergenic
983529731 4:168796966-168796988 ATTCATTGCTTTTGTGGAACAGG - Intronic
985833345 5:2251958-2251980 GGTCTCAGACTTTGTGGAACAGG + Intergenic
986191185 5:5497516-5497538 AGTCTTTGCTTCTGTGGAAACGG - Intergenic
986658768 5:10040743-10040765 GGGCTCTGCTCTTCTGGCACAGG - Intergenic
988092553 5:26562211-26562233 GGTCTCTGCTGTTGGCAAACTGG - Intergenic
990990875 5:61682636-61682658 GGTCTGTGCTTGTGTGGGCCTGG + Intronic
990991139 5:61685113-61685135 GGTCCCTGCTTTTCTTAAACTGG + Intronic
991569937 5:68043262-68043284 GGTCTCTGCTTTTGTTCACAGGG - Intergenic
997583606 5:135031876-135031898 GGTCTCTGCTTTTCTGAACTAGG + Intronic
997978443 5:138454053-138454075 GGTCTCTGCTCTTATGTATCAGG - Intergenic
998018785 5:138753248-138753270 GGCCTCCGCTTTTGGGGAAAGGG - Intronic
998641047 5:144011602-144011624 GGTGTCTGCCTCTGTGCAACAGG - Intergenic
1004256320 6:14068015-14068037 GGTCTCTGCCCTTGTAGATCAGG - Intergenic
1005606064 6:27478573-27478595 GGTCTCTAGTTTTCTGGAAACGG + Intergenic
1006259566 6:32856366-32856388 GGTCTCTGAATTTGTGGAGGAGG + Intronic
1009860538 6:69325504-69325526 TGTTTCTGCTTTTGAGGACCAGG - Intronic
1011130873 6:84050892-84050914 GGTCTTTGGATTTGTGGCACTGG + Intronic
1012968063 6:105697025-105697047 GGTTTCTGCCTTTCTGGGACTGG - Intergenic
1014865920 6:126530023-126530045 GGACTCTGCTTGAGTGGAAGTGG - Intergenic
1015005987 6:128282193-128282215 GGTGTTTGCTTTTGTAGAAAAGG + Intronic
1015018893 6:128447946-128447968 GGCCTTTGCTTTTGTGCTACAGG - Intronic
1015407862 6:132857531-132857553 GATCTCTGGTTTTGTGCAAAGGG + Intergenic
1017084376 6:150700379-150700401 GGTCTCTGATTTGGTGGGGCTGG - Intronic
1019476860 7:1248509-1248531 GGTCCCCGCCTTTGTGGAACTGG + Intergenic
1020504790 7:8971192-8971214 GATTTCTGCTGTTGTGAAACAGG + Intergenic
1020644474 7:10797766-10797788 GGTTTCTGTTTTTGTTGAACAGG - Intergenic
1023070037 7:36420744-36420766 GGTATGTACTTTTGTGGAAAGGG + Exonic
1026448228 7:70504332-70504354 GGTCTCTGATTGTGTGGCAAAGG - Intronic
1028483623 7:91334733-91334755 GGTGTCTGCTTTTCAGGATCAGG + Intergenic
1032505571 7:132431948-132431970 GGTTTCTGCTTAGGTGGAAGTGG + Intronic
1033278129 7:139987920-139987942 GTTCCGTTCTTTTGTGGAACTGG - Intronic
1033898506 7:146106222-146106244 GGGCTCTCCTTCTGTGGAAATGG - Intergenic
1034095069 7:148400183-148400205 GGGCTCTGCACTTGTGTAACTGG - Intronic
1034561671 7:151884065-151884087 GGTCTCTGCCTCTGTGCACCTGG - Intergenic
1039798648 8:40935996-40936018 GGTGTCTCCTTGTGTGAAACGGG - Intergenic
1041219356 8:55633494-55633516 GGTCTCCGCTTTCGTGGAGCGGG - Intergenic
1045187014 8:99848499-99848521 ATTCTCTGCTTCTTTGGAACTGG - Intronic
1046213239 8:111107368-111107390 GGTCTTTGTTTTTTTGTAACTGG + Intergenic
1046998015 8:120545627-120545649 CGGCTCTGCTTTAGAGGAACAGG - Intronic
1047364422 8:124199235-124199257 GTTCTCTCCATTTATGGAACAGG - Intergenic
1049500196 8:142958939-142958961 GGTCTCTGCCTTCGGGGAAGAGG + Intergenic
1051414439 9:16824354-16824376 GGTCCCTTCTTTTGTGGCCCTGG + Intronic
1051664563 9:19456645-19456667 GAGCTCTGCTTTTGGGGCACTGG + Intergenic
1052088928 9:24302866-24302888 TGTCTCAGCTTTTGTTGATCTGG + Intergenic
1052772030 9:32698784-32698806 GGACACTGCTCTGGTGGAACCGG + Intergenic
1055422495 9:76159150-76159172 GGTCTCAGCTTTTGGCCAACAGG + Exonic
1056291394 9:85147512-85147534 TGTCTGTGCTTTTGAGGACCAGG + Intergenic
1056858597 9:90158538-90158560 GTCCTGTGCTTTTGTAGAACTGG - Intergenic
1058477225 9:105349828-105349850 GGTCTCTGCTCCTGTGTAATAGG + Intronic
1060762103 9:126262716-126262738 GGTCTCTATTTTTCTGGAATTGG + Intergenic
1061601753 9:131674967-131674989 GGAGTCTGCTTCTGGGGAACCGG - Intronic
1185529821 X:808717-808739 CGTCTCTGCATATGTGGACCCGG - Intergenic
1186490202 X:9966064-9966086 GGTCAATGCTTTTGTGTGACTGG - Intergenic
1194985223 X:100482862-100482884 GGTTTCTTCTTTTGTGAAATGGG - Intergenic
1197812964 X:130464695-130464717 AGTCGTTGCTTTTATGGAACAGG - Intergenic
1198261385 X:134968016-134968038 TGTTTCTTCTTTTGTGAAACAGG + Intergenic
1198509304 X:137333387-137333409 GGTTTCTGATTCTGTGGATCTGG + Intergenic
1200306318 X:155029309-155029331 GCTCTCAGATTTTGTGGATCAGG - Intronic